ID: 1122153950

View in Genome Browser
Species Human (GRCh38)
Location 14:99739237-99739259
Sequence CGGGGCTCCCGCAGCCCCGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122153950_1122153959 6 Left 1122153950 14:99739237-99739259 CCGCCGGGGCTGCGGGAGCCCCG 0: 1
1: 0
2: 1
3: 30
4: 275
Right 1122153959 14:99739266-99739288 AGCAGACAGCTCTTTCTGGCTGG 0: 1
1: 0
2: 1
3: 32
4: 234
1122153950_1122153957 2 Left 1122153950 14:99739237-99739259 CCGCCGGGGCTGCGGGAGCCCCG 0: 1
1: 0
2: 1
3: 30
4: 275
Right 1122153957 14:99739262-99739284 AGCCAGCAGACAGCTCTTTCTGG 0: 1
1: 0
2: 1
3: 19
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122153950 Original CRISPR CGGGGCTCCCGCAGCCCCGG CGG (reversed) Intronic
900203072 1:1419964-1419986 CCTGGCTCCAGCTGCCCCGGTGG + Intronic
900226126 1:1534403-1534425 CCTGGCTCCTGCTGCCCCGGGGG - Exonic
900313224 1:2044765-2044787 CGGGCCGCCCTCAGCCCCGGGGG - Intergenic
900488987 1:2936974-2936996 CTGGCCTCCCCCAGCCCCCGTGG + Intergenic
900671340 1:3856913-3856935 TGGCGCTGCCGCGGCCCCGGTGG + Exonic
901633474 1:10659003-10659025 GGGGGCTCCCGGACCCCAGGGGG - Intronic
902385617 1:16073774-16073796 CGGGGCTCCCCCACCTCCTGGGG + Intergenic
902786813 1:18738317-18738339 CGGGGCTGCCGCTGCCGCTGGGG - Intronic
902920646 1:19664702-19664724 GGGGGCTGCCACAGCCCGGGAGG + Intergenic
903078021 1:20787057-20787079 CGGGGCGCCCGGGTCCCCGGAGG - Intronic
903211934 1:21823516-21823538 GTGGGCTCCAGCAGCCCAGGAGG + Exonic
903694064 1:25194692-25194714 CGCGGCTGCCGCAGCCCTGGGGG - Intergenic
904418180 1:30375390-30375412 CGGGACTCCTGCAGACCCGAGGG + Intergenic
904822670 1:33256005-33256027 GGGGGCTCCCGGGGCCCCGGCGG - Intergenic
905408375 1:37752784-37752806 TGGGGCTCCCGCAGGACCGACGG + Intronic
905731852 1:40303620-40303642 TGGGGCGCCCGCATCCCCGCTGG + Exonic
905946743 1:41907580-41907602 TGGGCCTCCCGCAGGCCCAGGGG - Intronic
906523329 1:46479806-46479828 CAGGCCTCCCTCAGCCCCTGTGG + Intergenic
907012697 1:50978126-50978148 CGGGGAACCCGCAGCTCCCGGGG - Intergenic
907051198 1:51330679-51330701 CCGCGCTCCCGCACCGCCGGGGG + Intronic
907296549 1:53459683-53459705 GGCGGCGGCCGCAGCCCCGGAGG - Exonic
908401134 1:63774061-63774083 CGGGGCTCCCTCGGCGGCGGCGG - Exonic
909337273 1:74490290-74490312 TGGGGCTTCAGCAGCCCCTGTGG + Intronic
910251375 1:85201520-85201542 CGGGGTCCCCGCGGCACCGGGGG - Intergenic
910408413 1:86914631-86914653 CGGCGCAGCCGCAGCGCCGGTGG + Intronic
917345135 1:174021960-174021982 CCGGGCTGCCGCTGCCGCGGAGG + Intronic
918045086 1:180936565-180936587 TAGGGCTCCTGCAGCCCCCGAGG - Exonic
920394170 1:205631822-205631844 CGGGGCGCCAGGAGCCGCGGCGG - Exonic
922212384 1:223495962-223495984 AGGGGCTCCCACTGCCCCAGGGG + Intergenic
922705595 1:227788584-227788606 CGGGGCTCCGGCAGCCGGAGGGG - Intergenic
923569932 1:235104304-235104326 CGAGGCTCCCGGAGGCCGGGGGG + Intergenic
923611957 1:235504088-235504110 CGGGCCTCCCACCCCCCCGGCGG + Intronic
923744433 1:236686923-236686945 CTGTGCCCTCGCAGCCCCGGGGG + Intronic
924561078 1:245156549-245156571 CCGGGCTCCGGCAGCGGCGGCGG + Exonic
1064384442 10:14878437-14878459 CGCAGCTACCGCAGCCCCGTGGG - Intergenic
1065025413 10:21535161-21535183 CGGGGTTCCCGGGGCCACGGGGG + Intronic
1065025489 10:21535449-21535471 CGGGGCTGCTGCAGCGCCTGTGG + Intronic
1066180547 10:32957816-32957838 CGGGGCTGCCGGAGCTGCGGGGG - Exonic
1067278464 10:44854014-44854036 CGGGGCTTCCGCTGGCCCTGGGG - Intergenic
1067343015 10:45419501-45419523 CGGCCCTCCCCCAGCCCCGCAGG + Intronic
1067830973 10:49610808-49610830 CGGCGCTGCAGGAGCCCCGGCGG + Exonic
1073212661 10:101817876-101817898 CGCCGCTCCCCCAGCCCCGGCGG + Exonic
1073363629 10:102919142-102919164 CCGGGCTCCCGCCGCCCCCGTGG + Exonic
1075032129 10:119030394-119030416 CCGGGCGGCCGCCGCCCCGGAGG - Exonic
1075207100 10:120457241-120457263 CGCGGCTCCCGCAGCTCGGCCGG - Exonic
1075668342 10:124246254-124246276 CGGGGCTCCCTGAGGTCCGGCGG - Intergenic
1075748569 10:124744531-124744553 CGGGGCCCGGGCAGCCGCGGTGG - Intronic
1076403853 10:130200017-130200039 CGGTGCTCCAGGAGCCCCTGTGG - Intergenic
1076403855 10:130200021-130200043 AGGGGCTCCTGGAGCACCGGAGG + Intergenic
1076458701 10:130623455-130623477 TGGGTCTCCTGCAGCCCCAGGGG - Intergenic
1076749825 10:132537210-132537232 CGCGACTGCCGCCGCCCCGGTGG + Intergenic
1076872443 10:133200573-133200595 CGGGGCTGCCTTTGCCCCGGGGG + Intronic
1077077355 11:707613-707635 CGGGGCTCCCACAGGGCAGGAGG + Intronic
1077360714 11:2139174-2139196 CGGGGAATCCGCAGGCCCGGCGG + Intronic
1077360776 11:2139358-2139380 CGGGCCTCACGCAGCTCCGCCGG + Intronic
1077434898 11:2534250-2534272 CAGGGCGCCCGCAGGCCCGCAGG + Intronic
1077460788 11:2708436-2708458 CAGGGCACCCACAGCCCCCGAGG + Intronic
1077889783 11:6410800-6410822 AGGGGCTCAGGCAGCCCTGGGGG + Exonic
1079406926 11:20156054-20156076 TGGGGCTACCGCAGGGCCGGTGG + Intergenic
1081653464 11:44841038-44841060 CAGGGCTCCTGCTGCCCTGGGGG - Intronic
1083389630 11:62338088-62338110 CGGCGCTCCCGCCCTCCCGGAGG - Exonic
1083747334 11:64743463-64743485 CGGGGCTGCGGCAGCCCCCAGGG + Intronic
1083999745 11:66289595-66289617 CGGAGCCCCGGCAGACCCGGAGG + Intergenic
1084154020 11:67303880-67303902 CGGGGCCTCCGCAGCCCGGGCGG - Intronic
1084486356 11:69450467-69450489 GGGGGCTCCCCCAGCCCTGTGGG + Intergenic
1085405163 11:76257317-76257339 CGGGGCTCCAGGATCCCCTGGGG - Intergenic
1088172859 11:107017910-107017932 CTGGGCTCCAGCGGCCCGGGCGG + Exonic
1089208928 11:116787937-116787959 CGGGGCGACGGCAGCCCCCGGGG + Exonic
1089242696 11:117096554-117096576 CAGGGCTCCCTCAGACCCTGAGG - Intronic
1089273197 11:117315662-117315684 CGGGGCAGCCGCAGCCCCAGGGG + Exonic
1091226032 11:133956870-133956892 CGGTGCTCCTGCAGCCCGGGTGG + Exonic
1092123082 12:6057944-6057966 CGGGGCTCCGCCAGCCCAGAGGG + Exonic
1092446714 12:8564741-8564763 AGGGGCTCCCCCTGCCCCGCAGG + Intergenic
1097222843 12:57460914-57460936 GCTGGCTCCCGCTGCCCCGGTGG - Intronic
1100186466 12:92145306-92145328 CGAGGTTCCCGCAGCCCCGACGG + Intronic
1100565522 12:95790539-95790561 CGGGGCTCCCGCCGCCCCCCAGG - Exonic
1101150344 12:101877638-101877660 CGGGGCAGGCCCAGCCCCGGAGG - Exonic
1101592845 12:106139040-106139062 CGGCGCTCGCGCGGCCCCAGGGG + Exonic
1102349864 12:112184383-112184405 TGGGGCTCCAACAGGCCCGGAGG + Exonic
1103294796 12:119877106-119877128 CAGGCCTCCCGCAGCCCTGGGGG + Intronic
1103432936 12:120903815-120903837 CGGGGCTCCGGGAGGCCGGGAGG - Intronic
1103612771 12:122134013-122134035 CGGGGCTCCCCCCGACCCAGAGG + Intronic
1103690996 12:122774475-122774497 CGGGGAGCCCCGAGCCCCGGCGG + Exonic
1103764647 12:123271619-123271641 CGGCGCGCCCGCCGCCCGGGGGG - Exonic
1103764802 12:123272070-123272092 CTGGCCTCCCGCAGCCGCCGCGG - Exonic
1104602418 12:130162539-130162561 CGGCGCCCCCACAGCCCGGGCGG - Exonic
1104803890 12:131572610-131572632 CGCTGCTCCTGCAGCCCTGGGGG - Intergenic
1104841957 12:131829753-131829775 GGTGGCACCCGCAGCCCCTGTGG + Intronic
1105512099 13:21060537-21060559 CTGGCCGCCCGCAGCCCGGGAGG + Intronic
1105830642 13:24160842-24160864 CGGGGCTCCGCCGGCACCGGAGG + Intronic
1105847687 13:24307855-24307877 CTGGGCCGCAGCAGCCCCGGAGG + Intronic
1107779094 13:43879474-43879496 TCGGCATCCCGCAGCCCCGGCGG - Exonic
1113464421 13:110503850-110503872 GGGGGCTCCCACAGTCCCGGGGG - Exonic
1113814398 13:113161451-113161473 CTGGCCTCCCCCAGCCCCGTGGG - Intronic
1113900096 13:113791999-113792021 GGGGCCTCCCGCAGTTCCGGGGG - Intronic
1115545626 14:34462565-34462587 CGGGGCCCCCGCAGCCCAGCGGG + Intronic
1118145362 14:63128783-63128805 GGGGACTCCCACAGCCCCGCAGG - Intergenic
1119438209 14:74611659-74611681 TGGGGCTCCCCCAGCCCGGCTGG + Exonic
1121432878 14:93899917-93899939 CGGTGCTCCCACAGCCCCGAGGG - Intergenic
1121450504 14:94004245-94004267 CTGTCCTCCCGCAGTCCCGGAGG - Intergenic
1122153950 14:99739237-99739259 CGGGGCTCCCGCAGCCCCGGCGG - Intronic
1122604331 14:102938271-102938293 CCTGGCCCCCGCAGCCCTGGGGG - Intronic
1122637928 14:103138897-103138919 CGGGGAGGCCGCAGCCCCCGCGG + Intergenic
1122840822 14:104461785-104461807 CTGGGGTCCCGCAGCGCCTGGGG + Intergenic
1122887218 14:104715473-104715495 TGCCGCTCCCGCAGCCCTGGTGG + Intronic
1122898971 14:104774282-104774304 CTGGGCCCCGGCAGCCCCTGAGG + Intronic
1122987138 14:105217664-105217686 CGGGGCCTCAGCAGCGCCGGCGG - Exonic
1124531993 15:30516627-30516649 TGGGGCTCCCACAACCCCCGGGG - Intergenic
1124766660 15:32491018-32491040 TGGGGCTCCCACAACCCCCGGGG + Intergenic
1127103350 15:55588586-55588608 CGCGGCTCTTGCAGCCCGGGTGG + Intronic
1128344057 15:66842646-66842668 CGGGGCGCCCGCAGGCCCCGCGG - Intergenic
1128635314 15:69298960-69298982 CGGGGTCGCCGCAGCCCGGGAGG + Exonic
1129221524 15:74134292-74134314 CGGGGCTCCGCCAGCCCCGCCGG - Exonic
1129271519 15:74421642-74421664 CTGGGCTCCCGCACCGCCTGAGG + Intronic
1129296672 15:74603738-74603760 CTGGGCTCCCACAGCTCCTGGGG + Intronic
1129644856 15:77420296-77420318 CAGGTCTCCCTCAGCCCCAGCGG + Intergenic
1129844989 15:78764080-78764102 CAGTGCTCCCGCAGCTGCGGCGG - Exonic
1131517738 15:93090037-93090059 CTGGGCTCCCGGAGCCTCTGGGG - Intergenic
1132602799 16:781509-781531 CCGGGCCCCAGCAGCCCAGGAGG - Intronic
1132694233 16:1194881-1194903 CGGGGCTCCGGCTGACCGGGTGG + Intronic
1132749758 16:1452100-1452122 CTGGGCTCCAGCAGCACAGGGGG + Intronic
1132779341 16:1614295-1614317 CGGGGCTCCCATAGACCCCGGGG + Intronic
1132796299 16:1724974-1724996 CAGAGCTCCTGCAGCCCCTGGGG + Intronic
1133006026 16:2882448-2882470 CGCGGCTCTCCCAGCCCCGCGGG - Intergenic
1133049157 16:3106813-3106835 TGGGCCTCCCGCAGCCGCGTAGG + Intergenic
1133353315 16:5117361-5117383 CGGCCCTCCCACAGCCCTGGTGG + Intergenic
1134656160 16:15949761-15949783 CGGGGCTTCTGCAGCGCCGATGG + Exonic
1135480075 16:22814636-22814658 CGGGGCCACCTCAGCCGCGGAGG + Exonic
1137738524 16:50742414-50742436 CGGGGCTTCCCCATCCCCCGAGG + Intronic
1139334962 16:66225306-66225328 TGGGATTCCCGCAGACCCGGTGG + Intergenic
1139528069 16:67528726-67528748 CGCGGCTCCCGCACCCCTAGAGG - Intronic
1140078651 16:71723999-71724021 CGCCCCTCCCGCAGCCCCGCTGG + Intronic
1140472313 16:75222760-75222782 CGGGGACCCCGCAGCCTGGGGGG - Exonic
1142057123 16:88004973-88004995 AGGGGTTCACGCAGCCCCAGGGG - Intronic
1142163193 16:88570148-88570170 CGGGGCTCCGGCTGGGCCGGCGG - Intergenic
1142185747 16:88694004-88694026 CCGAGCTGCCGCGGCCCCGGTGG + Intergenic
1142476899 17:194064-194086 CTGGCTTCCAGCAGCCCCGGTGG + Intergenic
1143299585 17:5899702-5899724 CGGGGCTCCTGCACCCCTGATGG + Intronic
1143503544 17:7352069-7352091 CGAGGCTCGCGCGGCCCGGGCGG - Intronic
1143512556 17:7404648-7404670 CGGGGCTCTCGCGGTCTCGGAGG - Intergenic
1144565114 17:16353361-16353383 CGGGGCCTCCGCGGCCCCCGCGG - Exonic
1147582940 17:41637081-41637103 CTGGGCTCCAGCAGCCTCTGGGG - Intergenic
1151582388 17:74987824-74987846 CCGGGGTCCCGCAGAGCCGGGGG - Exonic
1151743579 17:76000308-76000330 CCGGGCTCCTGCAGCTCCAGAGG - Exonic
1151801810 17:76383550-76383572 CGGGGCTCGCGCGCCCCCGCCGG - Intronic
1151854363 17:76710696-76710718 CCGAGCTCCCCCAGCCCCGCGGG + Exonic
1152111336 17:78359273-78359295 TGGGGCACCCACTGCCCCGGGGG + Intronic
1152457981 17:80426969-80426991 TGGGGCAGCCGCAGCACCGGTGG + Intronic
1152569281 17:81114494-81114516 CGGGGATCCAGCAGACCCTGAGG + Intronic
1152751798 17:82065710-82065732 CGGGGCCCCTGCAGCTCCCGGGG + Intronic
1154991238 18:21600277-21600299 CGGGGCTCCCGGAGCCCTCGCGG + Intronic
1155507549 18:26548109-26548131 CGGGGCGCCAGCAGTCGCGGCGG + Intronic
1160190115 18:76708573-76708595 GGGGGCTCCCGCAGCAGCTGAGG - Intergenic
1160870664 19:1276311-1276333 GGGTGCTCCCACAGCCCGGGAGG + Intronic
1160871789 19:1281142-1281164 TGGGACGCCCGCAGCCCCGTGGG + Intergenic
1160873251 19:1286379-1286401 GGGGGCGCCCGGAGCTCCGGGGG - Intronic
1161141163 19:2648788-2648810 TGGGCCTCCTGCAGCCCCGTGGG - Intronic
1161887180 19:7005909-7005931 CAGGGCTCCTGCAGCCCCCAGGG - Intergenic
1161975315 19:7605234-7605256 AAGGGCTCCCACAGCTCCGGGGG - Exonic
1162128244 19:8510881-8510903 CGGCGCCCCCGCGGCCCCCGCGG - Exonic
1162805457 19:13135905-13135927 CCCTGCTCCCGCAGCCACGGCGG - Exonic
1162982208 19:14247602-14247624 TGAGGCCCCAGCAGCCCCGGGGG + Intergenic
1163012155 19:14433223-14433245 GCGGGACCCCGCAGCCCCGGGGG + Intronic
1166213953 19:41323845-41323867 CTGGGTTCCCACAGGCCCGGTGG - Exonic
1167284737 19:48592661-48592683 CGGGGTTCCCCCAGCCCCACTGG - Intronic
1167443624 19:49524744-49524766 CGGGGCTGGCGCAGCCCCTCAGG + Exonic
1167622686 19:50568122-50568144 GGGGGCTTCCGCAGCGGCGGCGG + Intergenic
925182723 2:1827410-1827432 AGGGGCTCCTCCAGGCCCGGTGG - Intronic
926202555 2:10812449-10812471 AGGGGCTTCCGCAGCCGCGGGGG - Intronic
926717943 2:15939767-15939789 CAGGTCTCCCGCCGCCCCCGCGG - Intergenic
927277797 2:21276318-21276340 CGGGGCCCGCGCAGGCCCAGGGG + Intergenic
927811943 2:26185203-26185225 CGGCGGTCCCGCGGCCCCGAAGG - Exonic
930753968 2:54957715-54957737 CGGGGGAGCCGCAGCCCAGGAGG - Intronic
934797354 2:97113061-97113083 CGCGCCTCCTGCACCCCCGGCGG - Intergenic
934993389 2:98936515-98936537 CGGGGCTCCGGGAGGGCCGGGGG + Intergenic
936713561 2:115161266-115161288 CCGGGGTCCCGGAGCCCCGTGGG - Intronic
937876266 2:126827680-126827702 CTGGCTTCCCGCAGCCCTGGAGG + Intergenic
937952355 2:127398289-127398311 CAGGACTGCCTCAGCCCCGGTGG + Intergenic
938291337 2:130152414-130152436 CGGGGTTCCTGCAGCCGCAGAGG - Exonic
938296466 2:130182325-130182347 CGGGCCGCCTCCAGCCCCGGGGG - Exonic
938368821 2:130756217-130756239 CGGGGCCCCTGGAGCCGCGGTGG + Intronic
938460285 2:131492312-131492334 CGGGCCGCCTCCAGCCCCGGGGG + Exonic
938465206 2:131520545-131520567 CGGGGTTCCTGCAGCCGCAGAGG + Intergenic
941104871 2:161341076-161341098 CCGAGCTCCCCCAGCCCCGCGGG + Intronic
944237415 2:197453142-197453164 GGGGCTTCCCGCAGCCCCCGGGG + Intergenic
944692588 2:202171340-202171362 CGGGGCCCCTGCCGCCGCGGAGG - Intronic
946321975 2:218959747-218959769 CGCTGCTACTGCAGCCCCGGGGG - Exonic
946899059 2:224355006-224355028 CCGGGCTCCCACAGCCCCCGGGG - Intergenic
947362223 2:229357495-229357517 GGGGGCTCCGGCAGCCACAGAGG + Intergenic
948928854 2:241117388-241117410 CAGGGCTCCCGCCCTCCCGGAGG - Intronic
1169486974 20:6042036-6042058 CTGGTCTCCCGCAGGCCGGGTGG + Exonic
1169907372 20:10617386-10617408 AGGGGCTCCCGCAGGCCAGTGGG - Intronic
1170852395 20:20017178-20017200 CTGGGCAGCCACAGCCCCGGAGG + Exonic
1172010294 20:31842513-31842535 CTGGGCTCCCCCAGCCCAGCCGG + Intergenic
1173704170 20:45097995-45098017 CGCGGCCACCGCAGCCACGGCGG + Exonic
1174111684 20:48201834-48201856 CTGGGCTCCCCCAGCTCAGGTGG + Intergenic
1174169456 20:48606998-48607020 CTGGGCTCCCCCAGCCCAGGTGG - Intergenic
1174396450 20:50249978-50250000 GGGGGCTTCCCCAGCCCCAGAGG + Intergenic
1175424408 20:58854678-58854700 TGAGGCTCCCGCCGCCCCTGCGG + Exonic
1176058766 20:63162629-63162651 AGGGCCTCCCGCTGCCCCAGAGG + Intergenic
1178314800 21:31558985-31559007 CTTGGCGCCCGCAGCCCCAGGGG - Intronic
1179647309 21:42783907-42783929 CTGGGCTCTCTCAGCCCTGGAGG - Intergenic
1180009808 21:45041706-45041728 CAGGGCTCCTCCACCCCCGGAGG - Intergenic
1180736993 22:18024533-18024555 GCGCGCTCCTGCAGCCCCGGCGG - Exonic
1181051554 22:20240510-20240532 CGGGGCTCCAGAAGCCTGGGGGG - Intergenic
1182282436 22:29225244-29225266 CAGGGCTCCCTCAGCCCAGGGGG - Intronic
1182296255 22:29312402-29312424 CGGGGCCCCCGCCGCCCCTCCGG + Exonic
1182422000 22:30253297-30253319 CGGGGCACACGCAGGCCTGGAGG - Intergenic
1184403138 22:44285570-44285592 CGGGGTTCCCCCACCGCCGGGGG + Exonic
1184465779 22:44668465-44668487 CGGGACGCCCCCTGCCCCGGCGG + Intergenic
1184523789 22:45009829-45009851 CGGGGCTCCCGGCGCCGGGGGGG - Intronic
1184730743 22:46369763-46369785 CGGGGTTCCCGTAGCCCTGGGGG + Exonic
1185277139 22:49954679-49954701 TGGGGATCCAGGAGCCCCGGAGG + Intergenic
1185341674 22:50293800-50293822 CGGGGCCCCTACAGCCCTGGCGG - Intronic
949709896 3:6861266-6861288 AGGGGCTCCTGCAGGCACGGAGG - Exonic
950438406 3:12993938-12993960 CGGTGCAACCGCGGCCCCGGGGG + Intronic
951080307 3:18444737-18444759 CGCGGCAGCCGCAGCTCCGGCGG - Intronic
952178652 3:30894645-30894667 CGCGGCTCCCGCAGTCTGGGCGG + Exonic
952215981 3:31278575-31278597 CAGGGCTCCCACATCCCCTGAGG - Intergenic
953563689 3:44013666-44013688 AGGGGCTGCAGCAGCCCCTGGGG - Intergenic
954277848 3:49554288-49554310 CAGGGCCCTCGCAGCCCCGCCGG + Intergenic
954301473 3:49702913-49702935 CAGGGCTCCTGCTGCCCCAGTGG - Intronic
954390248 3:50264862-50264884 GGGGGCTCCCGCATCCCAGAAGG + Intergenic
956855194 3:73269115-73269137 AGGGGCTCCCACAGTGCCGGGGG - Intergenic
960096696 3:113696505-113696527 CCGCGCTCCCCCAGCCCCGGAGG - Exonic
961453825 3:127014673-127014695 CGGGGCTCCTGCAGCCCCTGAGG + Intronic
964219153 3:154324358-154324380 GGGGGTCCCCGCAGCTCCGGTGG - Exonic
964509891 3:157438501-157438523 CAGGGGTCCCCCAGCCCCCGGGG + Intronic
966355172 3:179071917-179071939 GGCGGCTCCCGCATCCCCGGCGG + Exonic
966390940 3:179451604-179451626 CGGAGCGCGCGCAGCCCGGGCGG + Intergenic
966849488 3:184155810-184155832 CGGGGCTCCCGGAGGCGGGGCGG - Intronic
967884798 3:194325953-194325975 CGGCCCTTCCCCAGCCCCGGGGG + Intergenic
967958037 3:194893358-194893380 CTGGGCTCCCGCTGACTCGGTGG - Intergenic
968178174 3:196568998-196569020 CGAGGCTGCCCCAGCCCCCGGGG - Exonic
968583729 4:1406444-1406466 CCGGCCTCCCGCCGCTCCGGCGG + Intergenic
968593733 4:1472212-1472234 CCGGGCTCCGGCTGCCCCGCGGG - Intergenic
968908338 4:3464515-3464537 CAGGTCCCCTGCAGCCCCGGAGG - Intronic
969413060 4:7042461-7042483 AGAGGCTGCTGCAGCCCCGGAGG - Exonic
975828204 4:78341648-78341670 TGGTGCTCCCTCAGCCCTGGGGG + Intronic
976398536 4:84582994-84583016 CTGGGCTCCCGCCGCCGCGCAGG - Exonic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
982726899 4:158916015-158916037 AGGGGCTCTTGCAGCCCAGGTGG - Intronic
982737108 4:159018244-159018266 CGTGGCTGCAGCAGCCCCTGGGG + Intronic
983940099 4:173529003-173529025 CGCGGCCCCCCCAGGCCCGGGGG + Exonic
985664933 5:1177190-1177212 CGTGGCTCCCACCGCCCCCGGGG + Intergenic
985737631 5:1594084-1594106 AGGGGCTACCTCAGCCCGGGAGG + Intergenic
985932442 5:3069104-3069126 GGGTGCTCCCGTAGCCCCAGTGG - Intergenic
991087489 5:62661299-62661321 TGCGGCTCCCGAAGCCCAGGTGG - Intergenic
994171286 5:96662240-96662262 CGGGGTTCCCCTAGCCCCGATGG - Exonic
996329410 5:122312261-122312283 CGGGGCGCCCGGCGCGCCGGCGG - Exonic
998208363 5:140175417-140175439 AGGGGTTCGCGCAGCCCCTGGGG + Intronic
1002043921 5:176531788-176531810 CGGGGCTTTCTCTGCCCCGGGGG - Intronic
1002302971 5:178268028-178268050 CACGGCTCCCGCAGCCCTGGTGG + Intronic
1002424529 5:179167353-179167375 CCGGGCTCCCGGGGCCCCAGCGG + Intronic
1002897476 6:1388119-1388141 CAGGGCTCCTGCCGCCCCAGGGG + Intergenic
1003139375 6:3457439-3457461 CTGGGCTCCCGCAGCCGCGCGGG + Intergenic
1003218456 6:4135862-4135884 CCGAGCCCCCGCAGCCCCAGAGG - Intergenic
1006606197 6:35259556-35259578 CGGGGCTCCTGGAGCCCAGGCGG - Intronic
1007392957 6:41561074-41561096 GGGGGCTCCCACTTCCCCGGAGG - Intronic
1007447831 6:41920853-41920875 CGGGGAACCCGCAGCCCGGACGG + Intronic
1015058231 6:128930039-128930061 CGTGGCGCCCGCAGCCCTGCAGG + Intronic
1017103175 6:150865994-150866016 CGGAGCAGCTGCAGCCCCGGCGG + Exonic
1017206494 6:151808444-151808466 CGCGGCTCCCGCAGCTCCCTAGG - Intronic
1019196849 6:170288155-170288177 CGGGGCTTCCTGAGCCACGGGGG - Intronic
1020096096 7:5370496-5370518 CTGGGCTCCAGCAGCACCCGGGG + Exonic
1021230943 7:18086339-18086361 CGGGGCTCCCCGAGCCACGGGGG + Intergenic
1021717707 7:23474313-23474335 CGGGGCTCCCGCGCTCCCCGGGG + Intergenic
1022427957 7:30285564-30285586 GGCGGCCCCGGCAGCCCCGGCGG + Exonic
1025809151 7:64863224-64863246 GGGGCCTCCAGCAGCCCCAGCGG + Intergenic
1025813519 7:64889751-64889773 CGGGACTCCTGGAGCCCCGTGGG - Intronic
1026902199 7:74043479-74043501 CGGGGCTCCCCCAGCTCTGCCGG - Intronic
1026951136 7:74347602-74347624 CGCGGCTCCCTGAGCCCTGGCGG + Intronic
1029630512 7:101747499-101747521 CCGTGCTCCCACAGCCCCTGGGG + Intergenic
1031531929 7:122886401-122886423 CGCGGCTCCCTCAGACCCGCGGG - Intronic
1032002156 7:128272302-128272324 CCGGGGTCCCCCAGCCTCGGCGG + Intergenic
1032194672 7:129781949-129781971 CGGGGCGCCCGGAGCGCGGGGGG - Intergenic
1034401176 7:150862595-150862617 TGGGGCTCCCTCAGCTCCAGAGG - Intergenic
1034887129 7:154806522-154806544 AGGGGCTCCAGCAGCACCAGTGG - Intronic
1035181139 7:157090513-157090535 CTGGGCTAGCGCAGCCCGGGGGG - Intergenic
1042021882 8:64377845-64377867 CGCGGGGCCCGCAGCCCGGGGGG - Intergenic
1043148298 8:76682335-76682357 CGGGGCTGGCGGAGGCCCGGGGG + Intronic
1048980811 8:139702668-139702690 CTGGGCTCCCGCGCCCCGGGAGG - Intronic
1049166433 8:141128741-141128763 CAGAGCTCCAGCAGCCCCGAGGG - Exonic
1049178891 8:141210298-141210320 CGGGGCTCCCGCTGGCCGGAGGG + Intronic
1049405372 8:142449873-142449895 GGGGGCTCCAGCAGGCGCGGGGG + Exonic
1049673017 8:143878099-143878121 CGGGGGTCTCGCAGGCCCAGCGG - Intronic
1049676233 8:143890510-143890532 CCTGCCTCCTGCAGCCCCGGTGG + Intergenic
1049989302 9:976871-976893 CCTTGGTCCCGCAGCCCCGGTGG - Intergenic
1052956127 9:34254397-34254419 CGGGCCCACCGCAGCCCCTGAGG - Exonic
1058504684 9:105656004-105656026 AGCGGCTCCCCCAGCCCAGGTGG + Intergenic
1059176733 9:112175143-112175165 CGGCGCTCCCGCGGCGCCGCGGG + Exonic
1060555964 9:124507309-124507331 GGAGGCTCCGGCAGCCCAGGTGG + Exonic
1061177832 9:129008249-129008271 CAGGGCTCTGGCAGCCCCTGGGG - Exonic
1061253000 9:129437534-129437556 GGGGGCTCCGGCCGGCCCGGTGG + Intergenic
1061389882 9:130311580-130311602 CTGGGCACCCACAGCCCCTGAGG - Intronic
1061719422 9:132542598-132542620 CGTGGCTCACGCAGCCCCAGTGG - Intronic
1061844036 9:133376574-133376596 CGGAGCTCCCGCCTCCCCGCAGG - Intronic
1061962623 9:133995753-133995775 CGGGGCTCCCGCCTCACTGGAGG + Intergenic
1062400757 9:136371665-136371687 CGGGGCTCCCACCGCAGCGGGGG - Intronic
1062579204 9:137222086-137222108 GGGGGCTCCGGCGGCTCCGGCGG + Intergenic
1062587449 9:137255621-137255643 CTGGGCTCCCCCCGCCCCGGGGG - Intronic
1062645007 9:137543392-137543414 GGGAGCTGCCGCAGCCCCCGGGG + Intronic
1062651909 9:137582139-137582161 CGGGGCTCCCGGCGGCCCAGGGG + Exonic
1188451109 X:30308871-30308893 CGTGGCTCCGGCAGCGCCCGAGG - Exonic
1189317199 X:40064477-40064499 CGAGCCTCCCGCAGACCAGGTGG - Exonic
1189473577 X:41333035-41333057 CGGGGTCCCCGCAACGCCGGTGG + Intergenic
1200155055 X:153970784-153970806 CGGTGCTTCTGCAGCCCCGCTGG - Exonic