ID: 1122154240

View in Genome Browser
Species Human (GRCh38)
Location 14:99740849-99740871
Sequence GATGCTGGCTCTACACATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122154237_1122154240 1 Left 1122154237 14:99740825-99740847 CCTGGCATAGATGGGGCCTCAGA 0: 1
1: 0
2: 0
3: 27
4: 180
Right 1122154240 14:99740849-99740871 GATGCTGGCTCTACACATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 120
1122154236_1122154240 5 Left 1122154236 14:99740821-99740843 CCTGCCTGGCATAGATGGGGCCT 0: 1
1: 0
2: 1
3: 18
4: 165
Right 1122154240 14:99740849-99740871 GATGCTGGCTCTACACATCCTGG 0: 1
1: 0
2: 0
3: 6
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122154240 Original CRISPR GATGCTGGCTCTACACATCC TGG Intronic
911253771 1:95610586-95610608 GCTGCTGGCTCTTCAAATACTGG - Intergenic
915252937 1:154603449-154603471 GCTGCCAGCTCCACACATCCAGG - Intronic
919935447 1:202247854-202247876 GGTGCTGGCTCCACTCTTCCTGG - Intronic
921392539 1:214631054-214631076 GATGATGACTCTACCCAGCCTGG + Intronic
923266797 1:232322287-232322309 GTGGCTGGCTCGACACAACCCGG + Intergenic
923596027 1:235361395-235361417 GACCCTGGCTCTACACAGCCTGG - Intergenic
1069512427 10:69052403-69052425 GCTGCTGGCTTTAAACCTCCAGG + Intergenic
1071334325 10:84589000-84589022 GATGGTGGCTCTGAGCATCCAGG + Intergenic
1076162618 10:128256964-128256986 GCTGCAGACTCTACTCATCCTGG + Intergenic
1076192697 10:128494050-128494072 GATGCTGCCTGCACAAATCCAGG - Intergenic
1078359452 11:10657101-10657123 GATGATGGCTCTATACTTTCTGG - Intronic
1080590987 11:33723029-33723051 GATGCTATCACTACACATCTAGG - Intronic
1080868689 11:36217419-36217441 GATGCTGGAACTAGACTTCCTGG + Intronic
1080927676 11:36775007-36775029 GATGCTGGCTCTGGACTTACAGG + Intergenic
1084151784 11:67290939-67290961 GAGGCTGGCCCTCCACCTCCAGG + Intronic
1089337153 11:117733164-117733186 GTTGGTGGCCCTGCACATCCCGG + Intronic
1089340467 11:117754023-117754045 CTTGCTGCCTCTCCACATCCTGG - Intronic
1091697904 12:2640425-2640447 GATGCTGGATCCACAAAGCCTGG + Intronic
1092257753 12:6936569-6936591 GACCCTGGCTCCACACAGCCTGG - Exonic
1095962930 12:47846590-47846612 GATTCTGGCTCCACCCGTCCTGG - Intronic
1099559221 12:84151356-84151378 GATGTTTGCACTACACATCAGGG + Intergenic
1103403408 12:120658677-120658699 GTGGCTGTCTCTACTCATCCTGG + Intronic
1104741262 12:131176530-131176552 TATTCTGGCTCTTCACATGCAGG - Intergenic
1105070856 12:133233785-133233807 GATGCTGGCTCTCCAAAGACAGG + Intronic
1106454777 13:29917557-29917579 TATGCTGGCACTACAGATACTGG - Intergenic
1108497725 13:51041878-51041900 GCTGCTGCCTCTACACATGTTGG + Intergenic
1115632899 14:35263340-35263362 TATGCTGGCTCTACACACATTGG - Intronic
1116040778 14:39684278-39684300 GATCCTGGGTCTAGACATCCTGG + Intergenic
1121100220 14:91245165-91245187 GATGCTGGCACGTCACTTCCAGG - Intronic
1122154240 14:99740849-99740871 GATGCTGGCTCTACACATCCTGG + Intronic
1125483113 15:40093875-40093897 GATGCTGGGTCTGCATTTCCAGG - Intronic
1128861701 15:71079661-71079683 CATGCCTGCCCTACACATCCAGG + Intergenic
1130841645 15:87706390-87706412 GTTTCTGGCTCTACAGAGCCTGG - Intergenic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1136394504 16:29985819-29985841 GTTGCTGGCTCGGCACAGCCTGG + Exonic
1148987375 17:51634978-51635000 GATGCTGGCTCTTTAAACCCAGG + Intronic
1152257124 17:79246614-79246636 CAGGCTGGCTCTCCACACCCGGG - Intronic
1153466851 18:5397504-5397526 GCTGCTGGCTTTAGACATCCTGG - Intronic
1157999222 18:52596745-52596767 GTTGCTGGCTATACATATGCAGG + Intronic
1163653020 19:18529861-18529883 GATGCTGGCTCCGCCCATCCTGG + Intergenic
1165152884 19:33771320-33771342 GCTGCTGGCTGTGGACATCCAGG - Intronic
1165548360 19:36561651-36561673 GCTGCTGGCTCTACAGGTCTAGG - Intronic
1168725546 19:58579714-58579736 GAAGCTGATTCTACACATACTGG + Intergenic
925779829 2:7372026-7372048 TATGCTGGCTCTAGGAATCCAGG + Intergenic
926951489 2:18248380-18248402 GATGCTGGCACCATGCATCCTGG - Intronic
927248905 2:20980902-20980924 GCTTCTGGCACTACACACCCAGG + Intergenic
927645099 2:24872572-24872594 GCTGCTGGCTCTGCTCTTCCAGG + Exonic
929967828 2:46548716-46548738 GATGCTGGCACTGAGCATCCTGG + Intronic
933909132 2:86923577-86923599 GATGTTGGCTCACCACCTCCTGG + Intronic
933928723 2:87126157-87126179 GATGTCGGCTCTTCACCTCCTGG + Intergenic
934000056 2:87701942-87701964 GATGTCGGCTCTTCACCTCCTGG + Intergenic
934023592 2:87979808-87979830 GATGTTGGCTCACCACCTCCTGG - Intergenic
936364241 2:111837543-111837565 GATGTCGGCTCTCCACCTCCTGG - Intronic
936663918 2:114573155-114573177 GATGCTGTCTCTACAAAAACTGG - Intronic
937905198 2:127049694-127049716 AAAGCTGGCTCTACACAGCGGGG + Intronic
938706347 2:133930983-133931005 CATGGTGGCTCTACACTTCATGG + Intergenic
943826441 2:192399756-192399778 GATGCTGGCTTCACACAACAGGG + Intergenic
948890941 2:240906835-240906857 GCTGCTGGCTATAGACATTCAGG + Intergenic
1169892446 20:10468141-10468163 GATGCTGCCTCCACACACCCTGG + Intronic
1170196279 20:13692766-13692788 GATGCTGGCACCACACTTCTTGG + Intergenic
1172628101 20:36360319-36360341 GAGGCTGGCTCCACACGGCCTGG - Intronic
1175244006 20:57570462-57570484 GGTGCTGGGCCTACACAGCCTGG + Intergenic
1178428052 21:32494856-32494878 GATGCTGGCTCTGCCCATCTTGG + Intronic
1183104679 22:35607401-35607423 GATGCTTGCTCTGCAGAACCTGG + Exonic
1183303366 22:37069392-37069414 GAAGCTGCCTCTCCCCATCCAGG + Intronic
1184708709 22:46234456-46234478 GTAGCTGGCACTAGACATCCTGG - Intronic
1185097763 22:48821050-48821072 CATCCTGGCTCCACACATGCAGG + Intronic
949433838 3:4006833-4006855 AATTCCGGCTCTACACATTCTGG + Intronic
952151636 3:30600088-30600110 CTTGCTGGCTCTACTCCTCCTGG + Intergenic
952258435 3:31715414-31715436 GATGCTGGCTCTAACAATCTGGG + Intronic
953679230 3:45027134-45027156 GATGTTGTCTCAACACAGCCTGG - Intronic
954332037 3:49896277-49896299 GCTGCTGGCTTTACACTGCCTGG - Exonic
954431783 3:50474695-50474717 GGTGCTGGCTGCACACATCAGGG + Intronic
954715978 3:52527214-52527236 GAGGCTGCCTCTGCACAGCCTGG + Intronic
956568655 3:70669435-70669457 AATCCTGGCTCTACACATTTTGG + Intergenic
957898559 3:86455766-86455788 GATCCTGTTTCTGCACATCCTGG - Intergenic
960715151 3:120567918-120567940 TATGCTGGCTGTAAAGATCCTGG + Intergenic
961565716 3:127762005-127762027 GATCCTGGCTCTACCACTCCTGG + Intronic
962265984 3:133944672-133944694 GCTTCTGGCTCTACCCTTCCAGG + Intronic
962344407 3:134608927-134608949 GATGGTGCCTCTTCCCATCCAGG - Intronic
962932815 3:140053223-140053245 GCTTCTGGCTCTTCACACCCTGG + Intronic
968753025 4:2400038-2400060 GATGCTGCCTCTCCACATGGAGG + Intronic
972712521 4:41612015-41612037 TATGCCGGCTCTACTCACCCAGG + Intronic
973813613 4:54597826-54597848 GATGGTTTCTCTACACACCCAGG - Intergenic
974411771 4:61550892-61550914 AATAATGGCTCTACAAATCCAGG + Intronic
975049874 4:69849279-69849301 TATGCTTGCTCTAAACCTCCAGG + Intronic
984268973 4:177527709-177527731 GATGCTGGCTTTTAACACCCTGG + Intergenic
992751708 5:79868517-79868539 GATGCTGGTTCTCCATGTCCTGG + Intergenic
993636427 5:90349803-90349825 GATCCTGGCTCTCCAAGTCCTGG - Intergenic
995186872 5:109281096-109281118 TCTGCTGGCTCTCCACATGCAGG - Intergenic
995996426 5:118306131-118306153 TATGCTGGCACAACACAGCCAGG - Intergenic
996305505 5:122042425-122042447 GATGTTGTCTCTACAAAGCCAGG - Intronic
997831991 5:137158161-137158183 GATCCTGCCTCTCCCCATCCTGG + Intronic
999471130 5:151856408-151856430 GATGCAGGATCTGCACATCAGGG + Intronic
999625785 5:153518929-153518951 GATGCTGACTCTACCAGTCCAGG - Intronic
1000058739 5:157633736-157633758 GATGCTATTTCTACAAATCCAGG + Intronic
1001677608 5:173531490-173531512 GTTGCTTTCTCTCCACATCCTGG - Intergenic
1003355040 6:5360550-5360572 TATGCTGGGTCTACAAATTCTGG - Intronic
1003844941 6:10163340-10163362 GAAACTGGTTCTACACACCCAGG + Intronic
1004883073 6:20027825-20027847 GATGCAGGCTCTACAGAGCTAGG + Intergenic
1006995423 6:38255492-38255514 GATTCTGGCTCTACACAAAGAGG + Intronic
1007652783 6:43433504-43433526 AATCCTGGCTCTACACTTACTGG + Intronic
1007947235 6:45837468-45837490 GGTGCAGGCTCTACAGAGCCAGG + Intergenic
1011920637 6:92572477-92572499 GATGCTGGCTCCAAAAATGCTGG - Intergenic
1014270258 6:119328339-119328361 CTTGCTGGCTCCTCACATCCAGG + Intronic
1017340370 6:153314522-153314544 TAGGCTGGCTCTAAACCTCCAGG + Intergenic
1017724540 6:157267864-157267886 GGTGCTGGCTTTGAACATCCAGG - Intergenic
1020030409 7:4929015-4929037 TATGCTGGCTTTACATATGCTGG + Intronic
1020125715 7:5531501-5531523 GGGGCTGGGTCTACACAGCCTGG + Intronic
1022566319 7:31406312-31406334 GATGCAGGCCCTACAACTCCAGG + Intergenic
1024532296 7:50403533-50403555 GATCCAGGCTTTCCACATCCTGG - Intronic
1029250534 7:99233022-99233044 GATGCTGTCTCTACAGCCCCTGG - Intergenic
1036930192 8:12949315-12949337 GATGCTGGGTGTACACATGGGGG - Intronic
1039029535 8:33294548-33294570 GCTGCTTGCTCTACAAATCTAGG + Intergenic
1039251022 8:35664239-35664261 GATGATGATTCTACAGATCCTGG + Intronic
1039840060 8:41286659-41286681 GATTCTGTCTTTACACACCCTGG + Intronic
1041249163 8:55918124-55918146 GATGCTGGCTCGACTCAGACAGG + Intronic
1042066768 8:64885968-64885990 GATGCCTCCTCTACTCATCCGGG + Intergenic
1042218705 8:66452413-66452435 GATGTTGGCTATGCCCATCCAGG + Intronic
1045836993 8:106534125-106534147 GATGCTGACTCAACAGATCTGGG + Intronic
1056705874 9:88952492-88952514 GATGCTGGCCCTGCTGATCCTGG + Intergenic
1060497727 9:124130457-124130479 GATGGTGGCTCTAGTCAGCCAGG - Intergenic
1061502975 9:131014160-131014182 GAGGCTGGCTACACCCATCCTGG - Intronic
1062288112 9:135782453-135782475 CAGGCTGGCTCTGCCCATCCTGG + Intronic
1062323896 9:136003554-136003576 GATGCCGGCTCTGCCCAGCCTGG + Intergenic
1192524220 X:71828048-71828070 GAAGCTGGGTCTACAAGTCCAGG + Intergenic
1198364497 X:135927276-135927298 GATTAGGGCTCTCCACATCCAGG + Intergenic