ID: 1122154887

View in Genome Browser
Species Human (GRCh38)
Location 14:99744284-99744306
Sequence ATCACACTGGGTCACCGTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122154887 Original CRISPR ATCACACTGGGTCACCGTGT AGG (reversed) Intronic
900758501 1:4454473-4454495 AGCAGCCTGGGTCACCCTGTGGG + Intergenic
907218002 1:52882801-52882823 ATCACAATGGCTTACCCTGTGGG + Intronic
913378625 1:118184866-118184888 ATCACACTGACTCACCTGGTGGG + Intronic
916701694 1:167302288-167302310 ATCTCACTGTGTCACCAGGTTGG + Intronic
923473619 1:234313414-234313436 ATGACAGTGGGTCACCATGCTGG + Intronic
1066641082 10:37554834-37554856 TTCTCCCTGGGTCCCCGTGTTGG + Intergenic
1070496536 10:77029314-77029336 AAGATACTGGGTCACAGTGTGGG + Intronic
1073427107 10:103461802-103461824 AGCACACTGGGACACCGAGATGG + Intergenic
1075847376 10:125555679-125555701 AGCACCCTGGGGGACCGTGTGGG - Intergenic
1075904469 10:126069029-126069051 AACACACTGGGTCCCTCTGTGGG + Intronic
1084198775 11:67541550-67541572 ACCACAGTGGTTCACTGTGTAGG + Intergenic
1084553301 11:69861965-69861987 ATCACACTGGATCACCCCCTTGG + Intergenic
1096241796 12:49963633-49963655 GTCACCCTGGGCCACCTTGTCGG + Exonic
1105466978 13:20653115-20653137 ATCACAGTGGGTGGCCGTGTAGG + Intronic
1106880877 13:34128697-34128719 ATCACACTGGTCCACGGCGTGGG + Intergenic
1111598747 13:90444884-90444906 ACTTCACTGGGTCACAGTGTTGG - Intergenic
1114374794 14:22132746-22132768 ATCAAGCTGGGTCACCGACTGGG - Intergenic
1122154887 14:99744284-99744306 ATCACACTGGGTCACCGTGTAGG - Intronic
1135125375 16:19805121-19805143 ATGACACTGGCTCACCTGGTTGG - Intronic
1135538826 16:23314710-23314732 ACCACCCTGGGTCACTGTGAGGG + Intronic
1142482202 17:225947-225969 ATCACACATGGTCACAGAGTTGG + Intronic
1157552213 18:48589642-48589664 GTCACACTGGTTCACCTTGTGGG + Intronic
1159132195 18:64291718-64291740 ATCAAACTGGGACACCCAGTTGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161031869 19:2061367-2061389 GTCACCCCGGGACACCGTGTGGG - Intergenic
1167590847 19:50403459-50403481 AGCACATTGGGTCACCCTGGTGG - Intronic
925710334 2:6732882-6732904 AACACCCAGGGTCACTGTGTTGG + Intergenic
926314246 2:11697703-11697725 ATCACACTGAGTCATCCTGTTGG + Intronic
926696034 2:15770748-15770770 GTCACCCTGGGTCAGCGTGAGGG + Intergenic
931232634 2:60387538-60387560 TTCACACTGGGCCACCTTTTTGG - Intergenic
935845695 2:107163474-107163496 AGCACACTGGGACACCATGCAGG - Intergenic
936749858 2:115629004-115629026 AGAACACTGGGTCACAGGGTGGG - Intronic
949061113 2:241957951-241957973 ATCACACTGGGTTGCCCTGGTGG - Intergenic
1169750041 20:8982329-8982351 ATCACAAGGGGTCACAGTCTAGG - Intergenic
1181571893 22:23772479-23772501 ATCCCACTGGGTCTCCTTGGTGG - Intronic
1185183958 22:49381517-49381539 ATCTCACTGGGTCACACTCTTGG + Intergenic
954906892 3:54070680-54070702 ATCCCACTGCGTCACTGTGGTGG + Intergenic
955250001 3:57271685-57271707 AGCACCCTGGGTCATAGTGTAGG + Exonic
958813682 3:98892465-98892487 ATCACACTGGGTCAATGTGAGGG + Intronic
961428929 3:126866321-126866343 AGCTCACTGGGTCACTGTGAAGG - Intronic
963028001 3:140939214-140939236 TTCACACTGGGTAACAGTGTGGG + Intergenic
966317195 3:178660851-178660873 ATCCCACTAGATCACCATGTAGG - Intronic
971486086 4:27161928-27161950 ATAACAGTGGGTCACCTTGAAGG - Intergenic
981545754 4:145891753-145891775 AACACACAGAGACACCGTGTAGG - Intronic
984647134 4:182232233-182232255 TTCTCACTTGGCCACCGTGTTGG + Intronic
984935090 4:184882896-184882918 ATCACCCTGGGTAACTGGGTGGG - Intergenic
985649950 5:1102799-1102821 ATGCCACTGGGTCACCAGGTGGG - Intronic
990676044 5:58185994-58186016 AACACACCGGATCACTGTGTGGG + Intergenic
991277938 5:64872955-64872977 AACATACTGAGTCACAGTGTTGG + Intronic
1011433117 6:87309144-87309166 GTCACACTGATTCACCTTGTTGG + Intronic
1018676214 6:166224250-166224272 ACCACACTGGGTAGACGTGTCGG + Intergenic
1018962904 6:168460898-168460920 ATCAAACTGGGTCAGTGTGAGGG + Intronic
1020044840 7:5033084-5033106 ACCACACTGGCTCACCATCTTGG - Intronic
1024232165 7:47370936-47370958 AAAACACTGGGACAACGTGTTGG + Intronic
1025925668 7:65957996-65958018 ATCACAGTGGGTCTCCTTGTTGG - Intronic
1026089048 7:67284900-67284922 AGCACACTGGCTCACCATCTTGG + Intergenic
1029144884 7:98438836-98438858 CTCACACTGGGACACCGGGGTGG + Intergenic
1037584156 8:20265021-20265043 ATCAGAGAGGGTCACCCTGTGGG + Intronic
1038510874 8:28134143-28134165 TTCACACTGGGACACAGGGTGGG - Intronic
1040448719 8:47522622-47522644 ATCACACAATGTCACTGTGTGGG + Intronic
1044957623 8:97498108-97498130 ATCCCACTGAGTCACCTTTTGGG + Intergenic
1049235772 8:141511499-141511521 ATCCCACTGGGTCACCCCATCGG - Intergenic
1057242040 9:93419901-93419923 CTCTCACTGGGTCTCTGTGTGGG + Intergenic
1059926009 9:119209857-119209879 ACAACACTGGATCACCGGGTGGG - Intronic
1185816789 X:3163693-3163715 ATCACACTGGGTCCTCCTGGTGG - Intergenic
1190500735 X:51075540-51075562 CTCCCACTGGGTCACTGTGTGGG - Intergenic
1193641374 X:84013438-84013460 AGAACACTTGGTCACAGTGTGGG + Intergenic
1195391950 X:104371591-104371613 ATCACATTGGGTGATTGTGTGGG + Intergenic
1197327474 X:125111380-125111402 GTCTCACTGTGTCACTGTGTTGG - Intergenic
1198221569 X:134607341-134607363 AGCACACTGGGTAACAATGTAGG - Intronic
1201250302 Y:12050798-12050820 CTCACAGTGGGCCACCGTCTTGG - Intergenic