ID: 1122157240

View in Genome Browser
Species Human (GRCh38)
Location 14:99756972-99756994
Sequence TACACACACATCCCCAGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 237}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122157236_1122157240 3 Left 1122157236 14:99756946-99756968 CCTGTGCCCACAATGACACGCAG 0: 1
1: 0
2: 0
3: 12
4: 111
Right 1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1122157237_1122157240 -3 Left 1122157237 14:99756952-99756974 CCCACAATGACACGCAGTTCTAC 0: 1
1: 0
2: 0
3: 0
4: 61
Right 1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1122157238_1122157240 -4 Left 1122157238 14:99756953-99756975 CCACAATGACACGCAGTTCTACA 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG 0: 1
1: 0
2: 1
3: 29
4: 237
1122157235_1122157240 22 Left 1122157235 14:99756927-99756949 CCACAAGGATGCGCGTGCTCCTG 0: 1
1: 0
2: 1
3: 5
4: 86
Right 1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG 0: 1
1: 0
2: 1
3: 29
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122157240 Original CRISPR TACACACACATCCCCAGGAC CGG Intronic
900083980 1:878072-878094 TACACACACATTCCCTGGAGGGG + Intergenic
900103287 1:971845-971867 GACACACAAAGCCACAGGACTGG - Intronic
900841728 1:5054248-5054270 TCCACCCACATGCCCAGGGCTGG + Intergenic
901261712 1:7876140-7876162 CACACAAACATCCCCAGGGCTGG + Intergenic
903151735 1:21414718-21414740 TCCACAGAGATCCCAAGGACAGG - Intergenic
905314606 1:37073994-37074016 TACACACCCAGCCCAAGGAAGGG + Intergenic
910644781 1:89502192-89502214 AACACACACATACCCTGGAGAGG - Intergenic
912207471 1:107524311-107524333 TGCACACACATCCTGAGGACAGG - Intergenic
913291299 1:117274706-117274728 TACACACACATCGCCCAGGCTGG - Intergenic
915307867 1:154991257-154991279 CACACACACATACACAGGCCGGG + Intronic
917845925 1:179020131-179020153 TACACACACATACACAGAGCAGG - Intergenic
918248347 1:182680250-182680272 TACACAAACACCCCAAGGTCTGG + Intronic
920263447 1:204705434-204705456 CACACACACATCCCCAACAGCGG + Intergenic
920778653 1:208966447-208966469 TAGACACACATACCCAAGACAGG + Intergenic
921253449 1:213318566-213318588 AATAAACACATACCCAGGACTGG + Intergenic
922068641 1:222169163-222169185 TACATACACATGCCTTGGACTGG - Intergenic
922541636 1:226424687-226424709 TACACACACTCACCCAGCACAGG + Intergenic
923002595 1:230019972-230019994 GACACCCACATTCTCAGGACAGG - Intergenic
923105562 1:230851043-230851065 TACACACACATCCCTATCATGGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924806764 1:247367489-247367511 TACAAAGACATACCCAAGACTGG - Intergenic
1063264579 10:4434021-4434043 TACACACACATACCAAGTACAGG - Intergenic
1063584319 10:7337692-7337714 TACAAAGAAATACCCAGGACTGG - Intronic
1067767114 10:49095225-49095247 TACACACACAAGTCCAGGATAGG + Intronic
1068675176 10:59763111-59763133 TTCATACTCAGCCCCAGGACTGG + Intergenic
1069420401 10:68241573-68241595 TACACACACCTTCCCAGCCCCGG + Intergenic
1069545460 10:69324763-69324785 GACTAACACATCCCCAGAACTGG - Intronic
1069878753 10:71578864-71578886 TACCCCCACATCCCCAGAACTGG + Intronic
1070188687 10:74091647-74091669 TACACACCCACCACCAGGCCTGG - Intronic
1070613847 10:77953620-77953642 TGCACCCACATGCCCATGACTGG - Intergenic
1071551088 10:86566732-86566754 TACTCAGAAATCCCCAGGCCTGG - Intergenic
1071559383 10:86633163-86633185 TACTCAGAGATCCCCAGGCCTGG + Intergenic
1071788994 10:88934759-88934781 TACACTCATAACCCCAGTACTGG - Intronic
1072071960 10:91926634-91926656 TACACACTCAACCCTAGGAAAGG + Intronic
1072460312 10:95612395-95612417 TTCTGAGACATCCCCAGGACAGG + Intronic
1072465513 10:95658531-95658553 TACAAAGACATACCCAAGACTGG - Intergenic
1073981955 10:109164072-109164094 TCCAAACACAACCTCAGGACTGG + Intergenic
1074400493 10:113137891-113137913 TGCACACACACCCCCAGCAATGG + Intronic
1075677325 10:124304446-124304468 CTCACACACATCCCCTGGAGGGG - Intergenic
1076901219 10:133338943-133338965 TAGACACACATCCCAAACACTGG + Intronic
1078533427 11:12154411-12154433 TACATACACATTCCAAGGCCAGG - Intronic
1078598853 11:12713313-12713335 TAAATGCACAGCCCCAGGACAGG - Intronic
1079098500 11:17526558-17526580 TGCAGACACATCCCCAGGGACGG - Intronic
1079244997 11:18745388-18745410 TACAAACACAGCTCCAGGACCGG - Intronic
1081667319 11:44924085-44924107 CACACACACAACCCCAGAAGGGG - Intronic
1083309442 11:61776903-61776925 TAGACAGCCCTCCCCAGGACTGG + Intronic
1084266163 11:68006318-68006340 CACAGTCACATCCCCAGGAAGGG + Intergenic
1084937842 11:72596505-72596527 CACACACACACACCCTGGACAGG + Intronic
1085121416 11:73969862-73969884 TACTCACATAACCCCAGGAAGGG - Intronic
1085237943 11:75029880-75029902 TAAACAGACATCCCAAGGAGGGG - Intergenic
1085489873 11:76905140-76905162 TACACACACATGGCCAGGTGTGG - Intronic
1086049829 11:82577220-82577242 TCCATACACATCCCTAGGAAGGG + Intergenic
1089858134 11:121565279-121565301 AACACACACATCCAGAGGAAGGG - Intronic
1090456708 11:126856233-126856255 TACAAACACATAACCAGGATGGG + Intronic
1091226900 11:133962705-133962727 CACACACAAATGACCAGGACAGG - Intergenic
1091636517 12:2201185-2201207 CACACACACAGTCCCAGGATAGG + Intronic
1095874825 12:47068787-47068809 TTCAAAAACATCCCCAGGCCTGG - Intergenic
1096325960 12:50662239-50662261 TACCCAGAGATCCCCAGAACAGG - Intronic
1096365683 12:51026603-51026625 GACCCACACAGCCCCTGGACTGG + Intronic
1097298225 12:57990143-57990165 TGCACAAACATTTCCAGGACTGG + Intergenic
1097314809 12:58160520-58160542 AACACACACATAACCAGGCCTGG - Intergenic
1099615483 12:84929310-84929332 CAGGCACACATCACCAGGACTGG - Intergenic
1101923441 12:108951891-108951913 GCCACACAGATCCCCAGGAGGGG - Intronic
1104293986 12:127495261-127495283 TCCAGACACATCCACAGCACTGG + Intergenic
1105782968 13:23720568-23720590 TACAAAAAAATGCCCAGGACTGG + Intergenic
1106796763 13:33214729-33214751 CACACACACATCCCCTGCAATGG + Intronic
1107764892 13:43723784-43723806 CACACACACATACACATGACAGG + Intronic
1112736839 13:102430461-102430483 GACAAAAACATCCCCAGGATAGG - Intergenic
1112963737 13:105161234-105161256 TACATTCACCTCCCCAGTACCGG - Intergenic
1113547037 13:111160925-111160947 TACAAAGACATACCCAAGACTGG - Intronic
1116416893 14:44688993-44689015 TAACCAAAAATCCCCAGGACAGG + Intergenic
1116580469 14:46634951-46634973 CACACACACATCCCTAACACTGG - Intergenic
1116584171 14:46681116-46681138 TACACACACATACCCAGCAGTGG + Intergenic
1118009183 14:61592082-61592104 TACACCCAAAACCCCAGGCCTGG - Intronic
1118620380 14:67609531-67609553 CACACACACATCTTCAGGAAGGG - Intergenic
1119889190 14:78170042-78170064 GACACACACATCCTCAGCAGTGG + Intergenic
1121914533 14:97824613-97824635 TACACTGACAGTCCCAGGACTGG - Intergenic
1122049503 14:99046068-99046090 GACACTCACAGCCCCAGCACAGG + Intergenic
1122157240 14:99756972-99756994 TACACACACATCCCCAGGACCGG + Intronic
1122510520 14:102263235-102263257 TGCACACACATGCCCACGGCGGG + Intronic
1122782410 14:104149303-104149325 CACGCACCCCTCCCCAGGACGGG - Intronic
1122925774 14:104899111-104899133 CACACACACAGCCCCAGCGCCGG + Intergenic
1124017153 15:25886980-25887002 GACACACACTTCCCCAAGCCAGG - Intergenic
1124439003 15:29673945-29673967 CACACACACAGCAACAGGACGGG - Intergenic
1124843908 15:33271901-33271923 TACACACACACACCCAATACTGG - Intergenic
1126145342 15:45468399-45468421 TTCCCCCACATCCCCAGGACAGG - Intergenic
1128154881 15:65385924-65385946 TGCACCCCCATCCCCAGGACTGG - Exonic
1130836661 15:87656471-87656493 CACACACACATGCCCATGCCTGG - Intergenic
1131163592 15:90126243-90126265 CACACACACACCCCCCGCACTGG - Intergenic
1132069791 15:98766065-98766087 TCCACACCCTTCCCCATGACAGG - Intronic
1132865817 16:2092193-2092215 AACACACAGAGCCCCAGGCCGGG + Intronic
1133597412 16:7305908-7305930 TACACACACACCCACAGCAAAGG - Intronic
1133932946 16:10247123-10247145 TAGACACACATCACCATGCCTGG + Intergenic
1134638489 16:15810616-15810638 TACAAACACATCTCCAGGAAGGG - Intronic
1136545005 16:30949671-30949693 TACACACACATCCGTAAGAAGGG - Intronic
1137539300 16:49351142-49351164 CACACACACATCCCCAGCCAAGG + Intergenic
1137574225 16:49587937-49587959 CACGCACACATAACCAGGACAGG + Intronic
1146283895 17:31561500-31561522 TAGACACTGATCCCCAGGGCTGG - Intergenic
1147576624 17:41604705-41604727 TACACACACATACACACGAGTGG - Intergenic
1147769434 17:42857273-42857295 AACACACCCAGCCCCAGGACAGG - Exonic
1148673939 17:49434125-49434147 TCCAAGCTCATCCCCAGGACAGG + Intronic
1149025808 17:52026516-52026538 AACAAAGACATACCCAGGACTGG + Intronic
1150693766 17:67386541-67386563 TACCTACACATCCCTAGGAGAGG - Intronic
1151892519 17:76959012-76959034 AAAACACCCATCCCCAGCACAGG - Intergenic
1152399357 17:80055950-80055972 TACACACACACCACCAGGCCTGG + Intronic
1153698085 18:7664282-7664304 TAATCCCACATCCCCAGGACAGG - Intronic
1155067427 18:22279858-22279880 TACACACACAGCAGCATGACTGG + Intergenic
1155382969 18:25244816-25244838 TGCACAAACATCCCCAGCAATGG - Intronic
1155670512 18:28365408-28365430 TACACACAGAACAGCAGGACTGG - Intergenic
1156544030 18:37945939-37945961 TGCACACCCATCCCCAGAGCTGG + Intergenic
1157050328 18:44155994-44156016 TATACACACATACCCAAGACTGG - Intergenic
1158178482 18:54685274-54685296 TACACACACATACACACGCCTGG + Intergenic
1158275832 18:55766379-55766401 TATAAAAACATCCCCAGGACTGG + Intergenic
1159191637 18:65052576-65052598 CACACACACAGACACAGGACAGG + Intergenic
1159267352 18:66099943-66099965 TACACAGACAGCCACATGACAGG + Intergenic
1161073824 19:2275505-2275527 TTGACCCACATCCCCAGCACGGG + Exonic
1161263071 19:3348234-3348256 TGCACAGACAGCCCCAGGCCAGG - Intergenic
1161988212 19:7669354-7669376 GACACCAACAGCCCCAGGACAGG - Exonic
1162248778 19:9425322-9425344 TACTCACAGATCCCCAGGATGGG - Intronic
1162386157 19:10361733-10361755 CACAGACACACCCCCAGGCCTGG + Intronic
1163105588 19:15121318-15121340 TTCACACACATCCGGAGTACAGG + Intronic
1163510564 19:17732799-17732821 GACATAGACATCCCCAGGGCTGG - Intronic
1164901790 19:31933447-31933469 CACACACACATCTCCAGCAAAGG + Intergenic
1168333343 19:55582235-55582257 AACACACACAAACCCAGAACAGG - Intergenic
1168547316 19:57264073-57264095 TACACACACTTCCCAAGAAAGGG - Intergenic
928235509 2:29535994-29536016 CACACATACATCCCTAGGAAGGG + Intronic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
930525155 2:52519520-52519542 AATACAGACATCCCCAAGACTGG - Intergenic
933577830 2:84090038-84090060 GTCACACACATGCCCAGCACAGG + Intergenic
934110726 2:88739758-88739780 CAGACACACACCACCAGGACCGG + Intronic
935580722 2:104753968-104753990 TCCACACATATCCTCAGGAAAGG - Intergenic
940284742 2:152022956-152022978 TACAAAGACATACCCAAGACTGG + Intronic
941295499 2:163734453-163734475 TACACACACAGGAACAGGACTGG - Intronic
941499005 2:166245373-166245395 TACCTACACATCACTAGGACAGG + Intronic
942912856 2:181266469-181266491 TATACACACATCCCCATATCAGG + Intergenic
943372481 2:187032152-187032174 TAGGCACACACCACCAGGACCGG - Intergenic
946105904 2:217369300-217369322 TACACACACATCCCATAGATCGG - Intronic
946163749 2:217851464-217851486 CACACACACACCCCAGGGACTGG + Intronic
946199248 2:218062064-218062086 TACACACACATTCCCAGAGCAGG - Intronic
947381854 2:229552722-229552744 TACAAAGACATACCCAAGACTGG - Intronic
947564694 2:231186254-231186276 GACACACAGATCCACAGGGCCGG - Intergenic
948717561 2:239875055-239875077 TACAAACCCATCCCCAGGTGTGG + Intergenic
948953188 2:241268428-241268450 TCCACACACAGCCCAGGGACAGG + Intronic
949034452 2:241810177-241810199 TGCACTCACAGCCCCAGGAGGGG - Intronic
1171416450 20:24984369-24984391 TACACACTCATCCACAGAAAAGG + Intronic
1172104443 20:32508214-32508236 TCCAAACACAGCCGCAGGACAGG - Intronic
1173521468 20:43703319-43703341 TACAAGCCCATCCCCAGCACTGG - Intronic
1173978837 20:47207550-47207572 TGCACACACATGCCCAGGAACGG + Intergenic
1174715033 20:52748420-52748442 CACACACACAACTCCAGGAGAGG - Intergenic
1175225656 20:57442425-57442447 ACCACAGACATCCCCAGGCCGGG - Intergenic
1175874080 20:62221232-62221254 TACACAGACACCCACAGGCCAGG + Intergenic
1176266772 20:64213462-64213484 CACACACAGACACCCAGGACAGG + Intronic
1176430501 21:6572642-6572664 TACACACACATACACAGGGATGG - Intergenic
1177399692 21:20586890-20586912 TACATACATATACCCAGGAGGGG + Intergenic
1177399802 21:20588002-20588024 CACACACACATACCCAGGAGGGG + Intergenic
1177525604 21:22286758-22286780 TACAAAGACATACCCAAGACTGG - Intergenic
1179005846 21:37513318-37513340 CACTCAGACCTCCCCAGGACTGG - Intronic
1179076501 21:38127312-38127334 TCTTCACACATCCACAGGACAGG + Intronic
1179705895 21:43180104-43180126 TACACACACATACACAGGGATGG - Intergenic
1179883288 21:44302325-44302347 TCCACACACTTCCCCAGTTCAGG + Intronic
1180105758 21:45617148-45617170 TGCACACACATCCTCTGCACAGG + Intergenic
1180215040 21:46318380-46318402 TAAACACTCATCCCCAGGTGTGG + Intronic
1181522888 22:23459637-23459659 CACCCACACAGCCCCAGGTCAGG - Intergenic
1183378550 22:37479268-37479290 CACACCCCCACCCCCAGGACCGG + Intronic
1183706021 22:39475367-39475389 TACAGACACATCCCATGGACTGG - Intronic
1183941416 22:41297663-41297685 TACACACACATCACCACACCTGG + Intergenic
1184939683 22:47753843-47753865 AACACACACATCACCATGTCAGG + Intergenic
949961451 3:9315438-9315460 TCCACTCACAGCTCCAGGACTGG - Intronic
954444551 3:50539730-50539752 TCCACCCACAGGCCCAGGACAGG - Intergenic
955710349 3:61772320-61772342 TATACACACATCACCATGATTGG - Intronic
956717763 3:72093266-72093288 TACAGAAGCATCCCCAGGGCTGG + Intergenic
956753027 3:72359909-72359931 GACACAGACGTCCCCAGGGCAGG + Intergenic
959804874 3:110539405-110539427 TATAAAGACATACCCAGGACTGG - Intergenic
961568425 3:127781060-127781082 CACACACACAACCCCAGGCCAGG - Intronic
962269580 3:133967998-133968020 CACACACACTTCCCCATCACAGG + Intronic
963506976 3:146198541-146198563 CAGACACACATCACCAGGCCTGG + Intronic
963925689 3:150948631-150948653 TACATACACCTTCCCAAGACTGG + Intronic
964138281 3:153369699-153369721 TCCACCCACAGCCCCAGCACGGG - Intergenic
964972804 3:162581966-162581988 GACTCACAGATCCACAGGACTGG - Intergenic
966111602 3:176408890-176408912 TAGACAGCCATCCCCAGGCCTGG - Intergenic
968059316 3:195714957-195714979 GACAGACTCATCCCCAGGACAGG - Intergenic
968065541 3:195757046-195757068 AACACAGACACACCCAGGACAGG + Intronic
968358163 3:198124040-198124062 TACACACACGTTCCCTGGAGGGG + Intergenic
973537281 4:51896050-51896072 AACACACAAAGCCCCTGGACTGG - Intronic
973993882 4:56437015-56437037 TACACACACGCCCCCTAGACAGG - Intronic
974504561 4:62752014-62752036 TACACACACATTCCCAAATCAGG + Intergenic
977670878 4:99693396-99693418 TACTCACACATCCCCAGAGGAGG - Intergenic
981594620 4:146405556-146405578 AACACACACATCTAAAGGACAGG + Intronic
984026449 4:174548413-174548435 CAGACACACATACCCAAGACTGG - Intergenic
988510722 5:31862463-31862485 CACACCTATATCCCCAGGACTGG + Intronic
988705336 5:33720832-33720854 TACACACACATCCCTAAGAGTGG - Intronic
989460362 5:41690638-41690660 TACTCACAGATCCACAGGGCTGG - Intergenic
991117550 5:62971431-62971453 TAAACACACAACCCAAGGAATGG + Intergenic
993583492 5:89693946-89693968 AACATACACAACCCTAGGACTGG - Intergenic
997436761 5:133881312-133881334 TACACACACAGCTCTAGGGCTGG + Intergenic
997677983 5:135728885-135728907 TACACACACACCCCAAGGCTTGG + Intergenic
998796154 5:145821323-145821345 TACACACACATACACAGAAGAGG - Intronic
999018299 5:148133810-148133832 AATACACACATCCGCAGTACAGG + Exonic
999124304 5:149235726-149235748 TACCCACACACCCCCAGAACTGG + Intronic
1002601283 5:180355110-180355132 TACAGACACATCCCCATGGGTGG - Intergenic
1002710787 5:181193778-181193800 CACACACACACCCCCAAGAAAGG + Intergenic
1006346706 6:33488283-33488305 TCCACACACATGCCCAAGGCAGG - Intergenic
1006448541 6:34092888-34092910 CACCCAACCATCCCCAGGACAGG + Intronic
1006786698 6:36672559-36672581 TGTACAAACATCCCCAGGAAAGG - Intergenic
1007476176 6:42121551-42121573 GACACACACATCCTCATGCCTGG + Intronic
1009670347 6:66740805-66740827 TCCACACACACACCCAGGAAGGG - Intergenic
1010942024 6:81930404-81930426 TAAAAACACATCCAAAGGACTGG - Intergenic
1013176660 6:107683626-107683648 TACACACACAAATCCAGGAATGG + Intergenic
1013367552 6:109447206-109447228 TGCACACAGGTCCCCAGCACCGG + Exonic
1013880906 6:114899559-114899581 GACACATACATCAACAGGACAGG + Intergenic
1014214422 6:118738903-118738925 TACACTGGGATCCCCAGGACTGG - Intergenic
1017362750 6:153595272-153595294 AACACACACATCGACAGGAATGG - Intergenic
1018394558 6:163367817-163367839 TGCACACACATCGGCAAGACTGG - Intergenic
1018426497 6:163687734-163687756 TACACTGAAATCCACAGGACAGG - Intergenic
1018705474 6:166460766-166460788 CACACACAAGTGCCCAGGACAGG - Intronic
1019588437 7:1816900-1816922 CACCCACACAGCCCCAGGTCAGG + Intronic
1019736772 7:2653964-2653986 CACACACACCGCCCCAGGACTGG + Intronic
1019860170 7:3651069-3651091 TACACACACATGCCCAGGAGTGG + Intronic
1022281241 7:28912035-28912057 TACACAGACACCCACAGGCCAGG - Intergenic
1022792207 7:33700180-33700202 TACACAATCAGCCCCAGGTCAGG - Intergenic
1022794134 7:33718672-33718694 TACTCACTTCTCCCCAGGACAGG + Intergenic
1024090180 7:45932210-45932232 CACACACACACACACAGGACAGG - Intergenic
1024749994 7:52454451-52454473 TACACATACATGGCCAGGCCCGG + Intergenic
1026564213 7:71476437-71476459 TACTCACAAATCCCCTGAACAGG + Intronic
1027887318 7:83925485-83925507 CACACACACACACCCAGGAAGGG - Intergenic
1030015507 7:105216304-105216326 TACACAGACATCCTAAGCACTGG + Intronic
1030339289 7:108358563-108358585 CACACACAGATTCCCATGACTGG + Intronic
1030513037 7:110508568-110508590 TAAAAAGACATACCCAGGACTGG + Intergenic
1031133659 7:117862066-117862088 CACACACACATACACAGTACAGG + Intronic
1031752125 7:125589162-125589184 GACTCACATTTCCCCAGGACTGG + Intergenic
1031951826 7:127900741-127900763 TCCACACACATGCCAAGGAGTGG - Intronic
1032457763 7:132086769-132086791 TCCACACCCATCCCGAGGGCAGG - Intergenic
1034003605 7:147443715-147443737 TACACACACTTACCCATGTCTGG - Intronic
1034054096 7:148016218-148016240 TAAACAGACTTCCCCAGGAGGGG - Intronic
1034119737 7:148616638-148616660 TACAAAGAAATCCCCAAGACTGG + Intergenic
1034321733 7:150190736-150190758 AACAAAGACATACCCAGGACTGG + Intergenic
1034384814 7:150732270-150732292 TACAGAAGCATCCCCAGGCCAGG + Intronic
1034771014 7:153776541-153776563 AACAAAGACATACCCAGGACTGG - Intergenic
1035319441 7:158019225-158019247 TACAGAAACAGCCCCAGGATCGG - Intronic
1035412040 7:158652269-158652291 TACTCAGAACTCCCCAGGACGGG - Intronic
1035649622 8:1254970-1254992 CACACACACAGCACCCGGACAGG - Intergenic
1036960934 8:13243915-13243937 CAGATACACAACCCCAGGACAGG - Intronic
1037160652 8:15767952-15767974 GACATACACATACCCAGGGCAGG + Intergenic
1038960184 8:32509814-32509836 TACACACACATCAACAGGCTAGG - Intronic
1041329894 8:56713569-56713591 CACCCGCACATCCCCAGGCCTGG + Intergenic
1041803450 8:61824409-61824431 TACTCACAGTTCCCCAGGACTGG + Intergenic
1043143769 8:76625052-76625074 TATAAACACATACCCAAGACTGG + Intergenic
1043553594 8:81403494-81403516 TACACAGACATCCACAAGCCTGG - Intergenic
1044672476 8:94696874-94696896 TACACACAAATGACCAGGCCAGG + Exonic
1047499407 8:125430253-125430275 TACACACACACTCACAGGCCGGG - Intergenic
1048674168 8:136758886-136758908 TGCACACACATCCACACCACAGG + Intergenic
1049004809 8:139847817-139847839 CTCACACCCATCCCCAGGCCGGG - Intronic
1051127835 9:13824189-13824211 TAAAGACACATCTCAAGGACGGG + Intergenic
1051214674 9:14783565-14783587 GAAACACAGATCCCCAGGCCGGG - Intronic
1053239501 9:36485311-36485333 TACACACACACACCCAGAAATGG + Intronic
1057745936 9:97751022-97751044 TACACACACATACACATGGCTGG + Intergenic
1060086885 9:120711862-120711884 CACACACACACCCACAGGCCTGG + Intronic
1061604743 9:131700238-131700260 TAGTCACACATTCCCAGGTCAGG + Intronic
1062104879 9:134749908-134749930 CACACAGACATACCTAGGACTGG - Intronic
1062160987 9:135079758-135079780 TAGCCACGCATCCCCAGGCCGGG + Intronic
1062198187 9:135286294-135286316 TGCACACACATCCCCCACACAGG + Intergenic
1062198213 9:135286478-135286500 TGCACACACATCCCCCACACAGG + Intergenic
1186068255 X:5789695-5789717 CACACACACATCACCATGACTGG - Intergenic
1186593192 X:10953045-10953067 TCCATACACATCCCCAGGAAGGG + Intergenic
1190431520 X:50382263-50382285 TACACAGAAATCCACAGGTCTGG + Intronic
1191052401 X:56207854-56207876 TACAAAGACATACCCAAGACTGG + Intergenic
1192855385 X:75004736-75004758 CACACAAACATCCACAGAACTGG + Intergenic
1194949447 X:100107501-100107523 TACAAAGACATACCCAAGACTGG - Intergenic