ID: 1122157330

View in Genome Browser
Species Human (GRCh38)
Location 14:99757776-99757798
Sequence TCAGGGAGCTTCATGGCATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122157330_1122157335 3 Left 1122157330 14:99757776-99757798 CCCAATGCCATGAAGCTCCCTGA 0: 1
1: 0
2: 1
3: 12
4: 169
Right 1122157335 14:99757802-99757824 AAATGTGAGCTTTAAAAAACAGG 0: 1
1: 0
2: 5
3: 66
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122157330 Original CRISPR TCAGGGAGCTTCATGGCATT GGG (reversed) Intronic
901823957 1:11848402-11848424 CCTGGGAGCTTCATCACATTTGG - Intergenic
902581733 1:17412058-17412080 TCAGGGTGGCTCATGGCCTTTGG - Intronic
902720951 1:18303547-18303569 CCAGGGTGCTTCCTGGCACTGGG - Intronic
902894599 1:19470435-19470457 TGAGAGAGCTTCGTGGCAATTGG - Intronic
904307680 1:29600646-29600668 TCAGGGATCATCCTGGAATTGGG + Intergenic
906842322 1:49152767-49152789 CCAGGTAGCTTCTTGGCATATGG - Intronic
906937938 1:50230586-50230608 AAGGGGAGCTGCATGGCATTTGG + Intergenic
906967012 1:50467668-50467690 TCAGGAAGCATGATGGCATAAGG + Intronic
916431332 1:164731876-164731898 TCAGGAAGCTTCGTGGCAGCAGG - Intronic
917301802 1:173582543-173582565 TGAGGGAGCTACCGGGCATTGGG - Intronic
917695935 1:177524141-177524163 GGAGGGAGATTCATGGTATTAGG + Intergenic
920199372 1:204250104-204250126 TCAGGGAGCTTCAGGGTAGTGGG - Intronic
921734480 1:218611652-218611674 TCAGGGAACTTCATGGTACTTGG + Intergenic
923112280 1:230901827-230901849 TCAAGGAGCTTGATTGCTTTTGG - Intergenic
923621505 1:235583058-235583080 ACATGGAGCTTCCTGGCATCAGG + Intronic
924198033 1:241629641-241629663 TAAAGGAACTTCATGGCAATTGG - Exonic
924269320 1:242316398-242316420 GCAGGCACCTTCATGGCTTTCGG + Intronic
1064351148 10:14578204-14578226 TCAGGGAACTTCCTGTCATTAGG - Intronic
1066715580 10:38282369-38282391 GCAGGCACCTTCATGGCTTTCGG - Intergenic
1067099589 10:43324901-43324923 TCAGGAAGCTCCATGCCAGTGGG + Intergenic
1067755097 10:48999277-48999299 TCAGGGAGATTCAGGGCTTGGGG + Intergenic
1068042824 10:51848067-51848089 TTAGGGAGTTTCCTAGCATTTGG - Intronic
1069866036 10:71503436-71503458 TCAGAGACCTTCATGACTTTGGG + Intronic
1071263844 10:83946106-83946128 TCAGGGAGATTCATGCCTGTGGG - Intergenic
1072803751 10:98411050-98411072 CCAAGGATCTTCATGGCATGGGG - Intronic
1074053046 10:109897315-109897337 TCAGGAAGCTTCATGGAAAAGGG - Intronic
1075553769 10:123413934-123413956 GCAGGGCCCTTCATGGGATTGGG + Intergenic
1076586259 10:131549953-131549975 TCAGGCAGCTGCATGTCAGTGGG - Intergenic
1077798911 11:5518727-5518749 TCAGGGGCCTTCATGGCCTGTGG - Intronic
1078025257 11:7689013-7689035 ACATGGAGCTTCATGGGATGTGG - Intergenic
1082249119 11:49960364-49960386 ACAGGGAGTTTCATGGCCTGGGG + Intergenic
1084278019 11:68065934-68065956 TCAGGGAGCCTCCAGGCATACGG - Intronic
1085460552 11:76690498-76690520 TCTGGGACCTTCTTGGCAATTGG + Intergenic
1086388438 11:86335036-86335058 ACAGTGAGCTTTGTGGCATTTGG + Intronic
1092242424 12:6843417-6843439 TCAGGGAACTTTGTGGCATGTGG + Exonic
1095165865 12:38971184-38971206 GCAGGGAGAGTCATGGTATTTGG + Intergenic
1095951884 12:47786070-47786092 TCAGGGAGGTTAAGGGCCTTGGG + Intronic
1096204459 12:49709079-49709101 GCAGTGTGCTTCATGGCATCTGG + Intronic
1098559413 12:71855063-71855085 TCAGGAAACTTCATGGCAGAAGG + Intronic
1100841190 12:98613064-98613086 TCTGGGTCCTTCATGGCTTTAGG - Intergenic
1100847361 12:98673601-98673623 TCTGTGATCTTTATGGCATTAGG + Intronic
1101588234 12:106103574-106103596 TCATGGAGATGTATGGCATTTGG - Intronic
1102019625 12:109672993-109673015 TCAGGTAGCCCCATGCCATTTGG - Intergenic
1103146726 12:118601352-118601374 TCAGGGAGCTACAAGACAATAGG - Intergenic
1105683088 13:22749867-22749889 ACAGAGAGCTTTTTGGCATTAGG - Intergenic
1107386886 13:39920095-39920117 TCTGGGAGTTTCATAGCTTTAGG - Intergenic
1108109183 13:47049353-47049375 GCAGGGAGTTTCCTGGCAATTGG - Intergenic
1115045335 14:28985768-28985790 TAAGAGAGCTTCATGGAGTTTGG + Intergenic
1119360215 14:74043073-74043095 TGCTGCAGCTTCATGGCATTGGG + Intronic
1122157330 14:99757776-99757798 TCAGGGAGCTTCATGGCATTGGG - Intronic
1122173340 14:99895982-99896004 GCTGGTAGCTTCATGGCATGAGG + Intronic
1123704721 15:22942822-22942844 TCAGGGAGCATCTTGGCAAGGGG - Intronic
1124604973 15:31163025-31163047 TCAGGAAGCTGCAAGGCTTTGGG + Intergenic
1124703148 15:31935042-31935064 TCATGTAGACTCATGGCATTGGG + Intergenic
1126431532 15:48590264-48590286 TTAGAGAGCTTCATGGAATCAGG - Intronic
1127277525 15:57460571-57460593 TCAGGAAACTTCATGGCAGAAGG + Intronic
1132552542 16:559520-559542 TCAGGGAGCTGCTTGGAACTTGG + Intergenic
1133636915 16:7675678-7675700 AAAGGTAGGTTCATGGCATTTGG - Intronic
1134045684 16:11099146-11099168 TCAGGGAGCTCCAAGGCCCTGGG + Intronic
1134288448 16:12882802-12882824 TCAGGGAGCTTCTTCTCATGGGG + Intergenic
1134304643 16:13021190-13021212 TCAGGGTGTTTGGTGGCATTTGG + Intronic
1136925047 16:34363924-34363946 TCATGGAGCTGCAGGCCATTTGG - Intergenic
1136979526 16:35047882-35047904 TCATGGAGCTGCAGGCCATTTGG + Intergenic
1141070824 16:80953080-80953102 GCAGTGACCTTCATGGCATGAGG - Intergenic
1142165122 16:88582512-88582534 TCAGCGAGCCTCATGGCTGTGGG + Intronic
1146665664 17:34701298-34701320 CCAGGGAGCTTCAAAGCATGTGG + Intergenic
1148213049 17:45819693-45819715 TCAGGGAGCCTCAGGCCCTTGGG - Intronic
1149441774 17:56680131-56680153 TTAGAGAGCTTCCTGGCATAGGG - Intergenic
1151286267 17:73113707-73113729 TCAGGGAGCCACCTGGCACTTGG + Intergenic
1159794236 18:72822334-72822356 CCAGGCAGCTTCCTGGCTTTGGG - Intronic
1161698596 19:5783533-5783555 TCAAGGAGCTGCAGGGCAGTGGG - Exonic
1165391505 19:35541845-35541867 TCAGGGACCCTCCTGGCCTTTGG + Intronic
926188464 2:10709528-10709550 CCAGGGAGCTGCAGGGCTTTAGG + Intergenic
927075685 2:19574671-19574693 ACAGAGAGCATTATGGCATTTGG - Intergenic
927604068 2:24470558-24470580 TCTGGGAGCATGAAGGCATTGGG + Intergenic
928097318 2:28412560-28412582 CCAGGGAGCTTCCTGGCTCTGGG + Exonic
928207198 2:29294061-29294083 TAAGGAAGCTTCATGGGATGTGG + Intronic
928871097 2:35980866-35980888 TCTGTTAACTTCATGGCATTGGG - Intergenic
930336223 2:50049818-50049840 TCTGAGAGCTTCTTGGCATGTGG - Intronic
930862145 2:56086096-56086118 TTGCGGAGCTTCATAGCATTTGG + Intergenic
935882741 2:107582458-107582480 TAATGCAGCTTCATGGTATTTGG + Intergenic
938160610 2:128981675-128981697 TCAGGAAGCTTCAGGGCATTAGG - Intergenic
939012729 2:136865287-136865309 GCTTGGAGCTTCATTGCATTGGG + Intronic
939882460 2:147645854-147645876 TGAGGGAGGTTCATGGCTTAGGG + Intergenic
1168733155 20:104526-104548 TCAATGAGCTTCTTGCCATTTGG - Intergenic
1169242555 20:3996874-3996896 GAATGGAGCTTCATGGCATCAGG - Intronic
1169866787 20:10209723-10209745 CCAGGGACCTACATGCCATTTGG - Intergenic
1174277727 20:49415978-49416000 GCAGGGAGCTGCATGGCAATAGG - Intronic
1175152373 20:56945385-56945407 TCAAGGAGCCTCATGTCATGGGG + Intergenic
1176360264 21:5989325-5989347 TGAGGGAGCTTCATGGCAGGGGG + Intergenic
1178819957 21:35966051-35966073 CCAGGAAGCTTCAGGGAATTGGG + Intronic
1179763254 21:43549225-43549247 TGAGGGAGCTTCATGGCAGGGGG - Intronic
1183394644 22:37564464-37564486 TCAAGGAGCTTCCTGGAATAAGG - Intronic
1183949434 22:41344461-41344483 TCAGGGAGGGTCAGTGCATTTGG - Intronic
953209710 3:40864838-40864860 TCAGGAAGCTTCATGGTAGAAGG - Intergenic
954903070 3:54036382-54036404 TCAGGGAGCTTCATGCTAATTGG + Intergenic
955490982 3:59482398-59482420 CCAGGGAACTTCACTGCATTTGG - Intergenic
955797676 3:62654743-62654765 TCAGTGAACTACATGGTATTTGG + Intronic
957778768 3:84791385-84791407 TCTGGAAGATTCATGGAATTTGG - Intergenic
958271950 3:91511476-91511498 TAAAGGAACTTCACGGCATTTGG + Intergenic
960381076 3:116962446-116962468 TCTGGGAGCTTCATGTCTATAGG + Intronic
960446623 3:117757378-117757400 TGAGGGATCTTCATAGCAGTGGG + Intergenic
961103515 3:124221810-124221832 TCTGGTAGCTTCCTGGTATTGGG + Intronic
961979883 3:131065917-131065939 TTAGGGATCTCAATGGCATTAGG + Intronic
962966392 3:140358237-140358259 TCTGGAAGCTTCCTGGCTTTAGG + Intronic
963124708 3:141804397-141804419 TGAGGGAGCTTTAAGGAATTTGG - Intronic
963140192 3:141940553-141940575 TCAGGGAGCCCCCGGGCATTTGG + Intergenic
968082562 3:195856858-195856880 TCAGGGCTCCTCATGGCCTTGGG - Intergenic
969034890 4:4245150-4245172 TTGGTGAGCATCATGGCATTGGG - Intronic
971370443 4:26014819-26014841 TGAGGGAGGTTCATGGCCTCTGG + Intergenic
973743454 4:53940519-53940541 TCAGGTAACTTGATGCCATTAGG - Intronic
975042169 4:69759544-69759566 TCAGGAAGCTACAGGGTATTAGG + Intronic
976527939 4:86115297-86115319 TCCGGGAGCTGCATGGGATAAGG - Intronic
979183644 4:117759914-117759936 TCAGGGATCCTCTTGGCATTGGG + Intergenic
982032741 4:151316900-151316922 TCAGGTAGTTTCAGGGCATAGGG - Intronic
982430577 4:155317523-155317545 TCTGGGAGCTTCATTTCCTTGGG + Intergenic
983901268 4:173137194-173137216 TCTGTGAGTGTCATGGCATTGGG + Intergenic
985046468 4:185945928-185945950 TTTGGCAGCTTCATGGCAATGGG + Intronic
985419615 4:189771243-189771265 TCAGGGAGTTTTGTGGCATATGG - Intergenic
986255576 5:6100378-6100400 TAAGGGAGGTTCATGGGATGGGG - Intergenic
986350553 5:6875280-6875302 TCAGGAAGCTACATTGCTTTTGG + Intergenic
990647588 5:57861825-57861847 TCAGAGAGCTTTGTGGCCTTGGG - Intergenic
990770584 5:59239706-59239728 TTGGGGAGCTAAATGGCATTTGG - Intronic
992022511 5:72638309-72638331 TCTGGGAGCTGCCTGGCACTAGG + Intergenic
992780827 5:80125395-80125417 TCAGGGAGCTTGATAGAAATAGG + Intronic
995061675 5:107817404-107817426 CCATATAGCTTCATGGCATTTGG - Intergenic
995533044 5:113109892-113109914 TCATGGAGTTGCATGGCAGTGGG - Intronic
995558542 5:113355909-113355931 TAAGGAAGCTGCATGGCATCTGG + Intronic
996094105 5:119379972-119379994 GCAAGCAGCTTCATGGCATTTGG + Intronic
997674781 5:135704854-135704876 CTAGGTAGCTTCCTGGCATTAGG + Intergenic
1000093460 5:157950267-157950289 TTAGGTAGCTTCATGTCCTTAGG + Intergenic
1000611188 5:163377013-163377035 TCAAGCAACATCATGGCATTCGG + Intergenic
1001234126 5:170015077-170015099 TCAGGGAGCTCCATGGGGTTAGG + Intronic
1008233840 6:49019236-49019258 TCTGGGCAGTTCATGGCATTTGG + Intergenic
1009171218 6:60402527-60402549 TAAAGGAACTTCACGGCATTTGG - Intergenic
1009297047 6:61964409-61964431 TCAGGGAGCTGAATTTCATTAGG + Intronic
1009635195 6:66256408-66256430 TCAGTGACCTTGATAGCATTTGG - Intergenic
1010240329 6:73609597-73609619 TCAGGGCTCTCCATGGCACTTGG - Intronic
1013612651 6:111809456-111809478 TCATGGTGCTTCGTGGCATGGGG + Intronic
1015159218 6:130133377-130133399 TCTGGGAGATGCACGGCATTTGG + Intronic
1020806097 7:12791972-12791994 CCAGTGAGCTTTATGGCTTTTGG - Intergenic
1022443876 7:30454401-30454423 TCAGGGAGCTTCAAGTCAGCTGG - Intronic
1023082647 7:36539643-36539665 TCAGTGAGCTCTGTGGCATTTGG + Intronic
1026304176 7:69125711-69125733 CCTGGGAGCTTCATTTCATTAGG - Intergenic
1026371235 7:69701815-69701837 CCAAGGAGCTGTATGGCATTGGG - Intronic
1030737210 7:113063712-113063734 TCAGGGTGCTGCAGGGAATTTGG + Intergenic
1036538642 8:9679343-9679365 TCCAAGAGGTTCATGGCATTTGG + Intronic
1036686794 8:10917146-10917168 TCTGGGAGAGGCATGGCATTTGG + Intronic
1036929985 8:12946858-12946880 ATAGGGAACTTCCTGGCATTGGG - Intronic
1037630740 8:20653435-20653457 TCTGTGGGCTTCATGGCCTTGGG + Intergenic
1037948945 8:23006573-23006595 TGAAGGAGCTTGATGGGATTTGG + Intronic
1040937849 8:52799732-52799754 TAAGGGACCTGCATGTCATTAGG - Intergenic
1044356435 8:91228045-91228067 TCAGGAGGCTTCATGCCATTTGG - Intronic
1045599243 8:103694158-103694180 TCAGGGACCAGCATGGCATTGGG + Intronic
1047285668 8:123485292-123485314 TCAGGGAGCTGCACGTGATTTGG + Intergenic
1049045409 8:140147304-140147326 TCTTAGAGATTCATGGCATTAGG - Intronic
1053352679 9:37423926-37423948 CCTGGGAGCTGCATGGCTTTGGG - Intronic
1053590227 9:39506323-39506345 TCATGTAAATTCATGGCATTGGG + Intergenic
1053847985 9:42260492-42260514 TCATGTAAATTCATGGCATTGGG + Intergenic
1054576074 9:66858966-66858988 TCATGTAAATTCATGGCATTGGG - Intronic
1056560157 9:87722972-87722994 TCAAGGAGCATCATGGCAACTGG - Intergenic
1059538287 9:115104717-115104739 TGAGAGAGCTCCATGACATTGGG + Intronic
1059584862 9:115595254-115595276 TCAGGGAGCTGAATAGCCTTTGG + Intergenic
1060498236 9:124133579-124133601 TCTGCGAGCTGCATGGCCTTAGG - Intergenic
1060505416 9:124194296-124194318 TCTGGGAGCTTTATGGTTTTAGG + Intergenic
1186980922 X:14956489-14956511 TAAGGGAGCTTCCTGCCAATTGG + Intergenic
1187039659 X:15580218-15580240 CCAGAGAGCTTCATGGGATAAGG + Intronic
1187287412 X:17918748-17918770 AAAGGGAGCCTCATGGGATTGGG + Intergenic
1191775195 X:64806266-64806288 TAAGCCAGATTCATGGCATTTGG + Intergenic
1195169075 X:102248445-102248467 CCAGGACGCTTCATTGCATTTGG + Intergenic
1195189782 X:102438644-102438666 CCAGGACGCTTCATTGCATTTGG - Exonic
1200324880 X:155226311-155226333 TCAGTGAGGTTGATTGCATTTGG + Intronic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic
1202116129 Y:21470129-21470151 TCTGGGAGATTCAGGGTATTGGG + Intergenic