ID: 1122157332

View in Genome Browser
Species Human (GRCh38)
Location 14:99757783-99757805
Sequence ATTTTATTCAGGGAGCTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 243}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122157332_1122157335 -4 Left 1122157332 14:99757783-99757805 CCATGAAGCTCCCTGAATAAAAT 0: 1
1: 0
2: 0
3: 18
4: 243
Right 1122157335 14:99757802-99757824 AAATGTGAGCTTTAAAAAACAGG 0: 1
1: 0
2: 5
3: 66
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122157332 Original CRISPR ATTTTATTCAGGGAGCTTCA TGG (reversed) Intronic
900467533 1:2833073-2833095 ATTTTATGCAGGGAGCTCTGTGG - Intergenic
901662397 1:10806698-10806720 ATTTTTTTCAGAGTCCTTCAAGG + Intergenic
902545514 1:17187138-17187160 ATATTAAGCAGGAAGCTTCAAGG - Intergenic
904041553 1:27588037-27588059 GTTTTATCCAGTGGGCTTCAAGG - Intronic
905371601 1:37485422-37485444 ATTTTTTCCAGGCAGCCTCAAGG - Intergenic
905901561 1:41584818-41584840 ATGCTATTCAGGGAGAGTCAGGG + Exonic
907718281 1:56948118-56948140 ATTTGAATCAGGGAGCTGGAAGG + Intronic
911069408 1:93820656-93820678 ACGTTATTCAGAGAGCTTCCAGG - Intronic
911716608 1:101140382-101140404 AATTTATTCATGGTTCTTCATGG + Intergenic
911860048 1:102935004-102935026 AATTTAATCAGGGAGCTGTAAGG + Intronic
912154229 1:106897422-106897444 AATTTATTCTGGGAGCCTAAGGG + Intergenic
912865586 1:113253366-113253388 ATTTTTTTAATGGACCTTCAGGG - Intergenic
916147810 1:161756571-161756593 GTTGTATTCAGGGAGCTTGAAGG - Intronic
916173424 1:162019256-162019278 ATGTTATTCAAGGAGCTGGAAGG + Intronic
921972478 1:221165320-221165342 ATCTTGTTCAGGGACCTACATGG - Intergenic
922626734 1:227053788-227053810 ATTTTATTCAGGGACAGCCATGG + Intronic
922919755 1:229292630-229292652 CTCTTAGTCAGGAAGCTTCAAGG - Intronic
924248948 1:242112000-242112022 ATTTTGTTCATAGAACTTCATGG + Intronic
924395502 1:243615543-243615565 ATTTTATTCAGGGGGATGAAAGG + Intronic
1064308788 10:14192723-14192745 ATTTTATTCTGTGAGTTTCCAGG + Intronic
1064356253 10:14621181-14621203 ATTCTTTTCAGGGAATTTCAGGG + Intronic
1064909430 10:20384278-20384300 GTTTTATTCAGAAAGCCTCAGGG + Intergenic
1065060429 10:21895482-21895504 AAATTGTTCAGGGTGCTTCATGG + Intronic
1065818438 10:29503241-29503263 CTTTTATTCAGGGTACTTGAGGG - Intronic
1068510653 10:57961651-57961673 TTATTATTCAGGGAGTTTGAAGG - Intergenic
1069968144 10:72139028-72139050 ATTCTATTAAGAGAGCTTAAGGG + Intronic
1070459935 10:76655194-76655216 GTTTTATTCTGCTAGCTTCAGGG - Intergenic
1071449614 10:85781645-85781667 ATTTTACTCAGGAGGCTTGAGGG - Intronic
1072354901 10:94599048-94599070 ATTTAATTAAGGTAGCTTTATGG + Intronic
1074602400 10:114928645-114928667 ATGTTATACAGGGACATTCAGGG - Intergenic
1078519081 11:12049111-12049133 ATTGTTTTCAGGTTGCTTCATGG - Intergenic
1078973706 11:16446479-16446501 ATTTTATTTAATTAGCTTCATGG + Intronic
1079390057 11:20014385-20014407 ATTTTATTAAGGGTGCTGTAGGG - Intronic
1079485880 11:20935575-20935597 ACTTTATTCTGAGAGCTTTAGGG + Intronic
1080004321 11:27390368-27390390 TTTTTATTCAGAGTGCTTCTGGG + Intronic
1081847317 11:46250095-46250117 GTTTTTATCAGGCAGCTTCATGG + Intergenic
1084748300 11:71187449-71187471 GTTTTATTCAGGACACTTCATGG + Intronic
1086536201 11:87849725-87849747 ATTTTATTCAGGGAAGTTTCTGG - Intergenic
1089481718 11:118811156-118811178 ATTTTATTCAGGAAGCTACTGGG + Intergenic
1089767252 11:120776965-120776987 ATTGTGTTCAGGGAGCTACGAGG + Intronic
1091233589 11:134003797-134003819 ACATTTTTCAGGGAGCTTCTGGG - Intergenic
1091356200 11:134939830-134939852 ACTTTATTCTGGTAGTTTCATGG + Intergenic
1091829889 12:3542181-3542203 ATTTAATCCAGGGAGGCTCAAGG + Intronic
1091986561 12:4914468-4914490 AGTTTCTTCAGGGAGCCTCAAGG - Exonic
1092676440 12:10926400-10926422 ATTCCATTCAGAGAGCTTCCGGG + Intronic
1092685789 12:11044322-11044344 GTTTTCTTATGGGAGCTTCATGG - Intronic
1092691625 12:11117948-11117970 GTTTTCTTATGGGAGCTTCATGG - Intronic
1093312888 12:17612661-17612683 ATTCTAATCAAGGAGCTTCTTGG - Intergenic
1093584093 12:20817311-20817333 ATTTTATTGAGGTAGTTTTATGG + Intronic
1096334200 12:50740791-50740813 ATTTTTTCTAGGTAGCTTCATGG - Intronic
1097301721 12:58026264-58026286 ATTTCATTCAGTGAAATTCATGG - Intergenic
1097356585 12:58608935-58608957 TTTTTGTTCAGGGAACTCCATGG + Intronic
1098144199 12:67482695-67482717 ATTTTATTAAGAGGTCTTCAAGG - Intergenic
1098314202 12:69176442-69176464 ATTTTATTAAGGAAGGTTTAGGG - Intergenic
1099095296 12:78368347-78368369 TCTTTATGCAGTGAGCTTCAAGG + Intergenic
1099252117 12:80269304-80269326 ATCTTCTTCAGGGATTTTCAAGG + Intronic
1099359078 12:81676367-81676389 ACTTAATTCAGGAAGCTTCCAGG - Intronic
1099694991 12:86006930-86006952 ACTTTATTCAAGGAACTTCATGG - Intronic
1100392182 12:94153270-94153292 ATTTAATTAGGGGACCTTCAAGG - Intronic
1104182872 12:126399378-126399400 ATTTTAAGCTGGGAGCTTCAGGG - Intergenic
1105320181 13:19312347-19312369 CTTTTATTCAGGTAGCTTTGTGG + Intergenic
1105390425 13:19972086-19972108 ATTTCATTCAGGGATCTCTAGGG - Intronic
1105584602 13:21732215-21732237 ATATTAGTCAGGGTCCTTCAGGG - Intergenic
1106012653 13:25839889-25839911 ATTTGAGTCAGAGATCTTCAAGG + Intronic
1107709551 13:43138298-43138320 CATTTGTTTAGGGAGCTTCAAGG + Intergenic
1109168700 13:59068731-59068753 ATTTTAATCAGTGAAATTCATGG + Intergenic
1109465268 13:62723472-62723494 ATATTATTCAGGGTTCTCCAGGG + Intergenic
1110884010 13:80609855-80609877 AATTTTTTCAGGGAGATGCATGG - Intergenic
1111922245 13:94424529-94424551 ATTTTATTCAGTGACCTTTAGGG - Intergenic
1111943796 13:94642304-94642326 TTTTTTTTTAGGGAGCTTCTGGG + Intergenic
1112105341 13:96233846-96233868 ATATAATTCAGGGAGCTTTTGGG + Intronic
1112116733 13:96363818-96363840 ATTCTATTCAGCAAGTTTCAGGG + Intronic
1112781286 13:102903795-102903817 ATTTTATTCTGGGATCTCTAGGG - Intergenic
1113750662 13:112774481-112774503 ATTTTAATCAGGGACTCTCAGGG + Intronic
1114385227 14:22247307-22247329 GTTTTCTTCAGGGGGCTACAGGG - Intergenic
1114704490 14:24711465-24711487 AGTTTATTCCAGGAGCTGCAGGG - Intergenic
1116205168 14:41856389-41856411 TTTTCATTCAAGGAGCTTCAAGG + Intronic
1116321043 14:43463317-43463339 ATTTTTTTCTGGTAGTTTCATGG + Intergenic
1116652420 14:47610427-47610449 ATTTTATTCTAGGAGCTTTCTGG - Intronic
1116934230 14:50721870-50721892 ATTTCCATCAGGGAACTTCAGGG - Intronic
1116974851 14:51104843-51104865 ATTTTATTCTCTGAGCTTCTAGG + Intergenic
1117584299 14:57184460-57184482 ATCTTAATTAGTGAGCTTCATGG + Intergenic
1122157332 14:99757783-99757805 ATTTTATTCAGGGAGCTTCATGG - Intronic
1122512931 14:102284708-102284730 ATTTGTTTCAGAAAGCTTCAAGG + Intronic
1125899175 15:43329551-43329573 ATTTCATTCTGGCAGCTTCTAGG - Exonic
1126838945 15:52696880-52696902 ATTATATTCTGGGGGATTCATGG + Intronic
1127041350 15:54980499-54980521 AATTTATCCAGGGAGCTTATGGG - Intergenic
1128608569 15:69056426-69056448 ATTTTACACAGGGAGCTGCATGG - Intronic
1129145356 15:73642099-73642121 AATTTCTTCAGGGAGCATCTTGG + Intergenic
1129531988 15:76274607-76274629 ATTTTATACAGAAAGCTTCAAGG + Intronic
1129834292 15:78692283-78692305 GCATTATTCAGGGATCTTCAGGG - Intronic
1132136709 15:99348376-99348398 GTTTTATTCTAGGAGCTTTATGG + Intronic
1133824965 16:9270193-9270215 ATTTTATCCAGGGGTCTCCAAGG + Intergenic
1133846116 16:9455220-9455242 CATTTGTTCAGGGGGCTTCAGGG + Intergenic
1141162196 16:81636856-81636878 ATCTAATTCACGGGGCTTCAGGG - Intronic
1146893964 17:36527816-36527838 CTTTTCTTCAGGGAGCTGCTGGG - Intronic
1149069130 17:52518921-52518943 AGTTTCTTCAGGGAAATTCAGGG + Intergenic
1149149499 17:53543361-53543383 ATTTTCTTCTGGTAGTTTCATGG + Intergenic
1151141778 17:72000089-72000111 ATTTCATTCAGGGAGCCAAAGGG + Intergenic
1154305348 18:13226767-13226789 ATTCTACTCAGGTAGGTTCAGGG + Intronic
1154405716 18:14089203-14089225 ATTTTATTCAGAGAATTTGATGG + Intronic
1155260022 18:24032558-24032580 ATTTTATGCATAGAGCTTGAAGG + Intronic
1155371021 18:25100886-25100908 GTTTTATTTAGGAAGGTTCAAGG + Intronic
1156789830 18:40957482-40957504 ATTTTGAAGAGGGAGCTTCATGG - Intergenic
1157017390 18:43733553-43733575 ATTAGATTCAGGGAGCCTCATGG - Intergenic
1157775660 18:50393981-50394003 ATGGAGTTCAGGGAGCTTCAGGG + Exonic
1161369812 19:3904678-3904700 ATTTTAATCAGAGTGCTCCAGGG - Intronic
1163048308 19:14661598-14661620 ATTTTCTGCAGGGAACTACAAGG - Intronic
1164162894 19:22641310-22641332 ATTTTTTTCAGAGAACTTCTTGG + Intronic
1166525272 19:43506733-43506755 GTTTTATTTAGGGAGCTCCAGGG + Exonic
1167976459 19:53230685-53230707 ATTTTATACAGTAAGCTTCCAGG + Intergenic
1168495212 19:56841882-56841904 ATTCTATACAGGGATATTCACGG + Intergenic
926042180 2:9682077-9682099 ATTTCTTTTGGGGAGCTTCAAGG - Intergenic
926781627 2:16477961-16477983 ACTTTATTCAGGGAGATTCCAGG + Intergenic
927836872 2:26406072-26406094 AGTTAATTCAGGGAGCTTCCAGG - Intronic
930445609 2:51467874-51467896 ATTTTTATCATGGTGCTTCAGGG + Intergenic
931066319 2:58591742-58591764 ATTCTATTTAGTTAGCTTCAAGG + Intergenic
931220957 2:60287304-60287326 ATTTCCTGCAGGGTGCTTCAAGG + Intergenic
933728828 2:85441906-85441928 ATTTTTTTCAGGGGGCTTTCTGG + Intergenic
935347289 2:102120491-102120513 AGTTTACACAGTGAGCTTCATGG - Intronic
936909609 2:117576510-117576532 ATTTTATTCAGTGTGCTTATTGG - Intergenic
936979394 2:118250322-118250344 AGTTAATTCAGGCAGCATCAGGG - Intergenic
937665252 2:124479752-124479774 ATTTTATTGAGGATGCTTCCAGG - Intronic
937958109 2:127434480-127434502 ATGTTATTCAGGGTTCTCCAGGG + Intergenic
938628363 2:133137155-133137177 ATTGAATTCAGAGAGCTTTATGG - Intronic
940142926 2:150514249-150514271 TTTTTATTCATGGAGCTCAAGGG + Intronic
941109612 2:161404532-161404554 ATTTTATCCAGTTAGCCTCAAGG - Intronic
941465357 2:165819263-165819285 ATCTTATACAGTGAGCTTCTTGG + Intergenic
946586002 2:221188545-221188567 CTATTATACAGGGAGGTTCATGG - Intergenic
946928517 2:224649507-224649529 TTGTTTTGCAGGGAGCTTCATGG + Intergenic
1169987451 20:11461132-11461154 TCTGTATTCAGGAAGCTTCATGG - Intergenic
1171114786 20:22515750-22515772 ATTTTCTTGAGGGAAGTTCAGGG + Intergenic
1172132846 20:32667215-32667237 ATTTTATTCCAAGAGCTTCGAGG + Intergenic
1172300188 20:33844294-33844316 ATTCTATCCAGGGTTCTTCATGG - Intronic
1174250446 20:49215682-49215704 ATTTTATTCTCGGAGACTCAAGG - Intergenic
1177361816 21:20082944-20082966 ATTTTATTCTGGACCCTTCATGG - Intergenic
1177566025 21:22821256-22821278 ATTTTATTAATGGAACTTAAAGG + Intergenic
1177752344 21:25300324-25300346 TTTTTAAACAGGGAGATTCATGG - Intergenic
1181661436 22:24352686-24352708 ATTTTATCCTGGGACTTTCATGG - Intronic
1182807075 22:33081900-33081922 ATAAGATTCAGGGAGATTCAGGG + Intergenic
1184019835 22:41813548-41813570 ATTTTCTTTGTGGAGCTTCAGGG + Intronic
949220121 3:1622396-1622418 ATTTAATTCAGAGAGGTTCCAGG - Intergenic
950219296 3:11182443-11182465 TTTTAATTCATGGAACTTCAGGG + Intronic
952101850 3:30022948-30022970 ATTTTATTCAGTGAGCAACGGGG + Intergenic
952279655 3:31910752-31910774 ATTTTACTCTGGAAGCTTGAGGG - Intronic
952569516 3:34697630-34697652 ATCATATTCAGGGAACTCCATGG - Intergenic
953532838 3:43753632-43753654 ATATTATTCAGGAAGCCTAAGGG + Intergenic
953994203 3:47507048-47507070 ATTTTAATCAGGTATCTTAAAGG - Intronic
954993638 3:54862355-54862377 ATTTTATTTAGGGAGATGCTTGG - Intronic
955673988 3:61430963-61430985 ATATTATTTAGAAAGCTTCAAGG + Intergenic
956059362 3:65334087-65334109 ATGTGATTCAAAGAGCTTCAGGG + Intergenic
956073307 3:65477897-65477919 ATTTTATGAAGGGATTTTCAAGG - Intronic
956649829 3:71494357-71494379 TTTTTAATCAGGAAGCTTAAAGG - Intronic
957599700 3:82318731-82318753 ATATTAGTCAGGGTTCTTCAGGG + Intergenic
957852708 3:85830622-85830644 ATTTTCTTCTAGGAGCTTTATGG + Intronic
957955202 3:87177371-87177393 TTTTTATTCAGTGTGTTTCACGG + Intergenic
958992058 3:100857854-100857876 ATTTTCTTCTAGGAGATTCAAGG - Intronic
959135966 3:102420787-102420809 ATTTTGTACATGGAGCTTTATGG + Intronic
959966338 3:112359925-112359947 CTTTTAATCAGAGACCTTCAAGG + Intronic
960611101 3:119555495-119555517 ATGTTATTCAGGAAGCTGGAAGG - Intronic
961097665 3:124171833-124171855 ATTTTATTCAGGGACTCTGAAGG - Intronic
964209802 3:154214199-154214221 ACTTTATTCTGAAAGCTTCAGGG + Intronic
964399618 3:156285461-156285483 ATTTTGTTCAGGCCTCTTCATGG - Intronic
968854979 4:3113208-3113230 AATTTAGTCAGAGAGCTCCAAGG - Intronic
969864708 4:10067185-10067207 ATTTTATGCATGGGGGTTCAGGG + Intergenic
969986405 4:11215819-11215841 ATTTTATTCAAAGAGCTGAAAGG + Intergenic
970858613 4:20676537-20676559 ATTTTATGCAGGAGGCTGCAAGG + Intergenic
971771537 4:30903727-30903749 ATTGTATTTAGGGAAATTCATGG - Intronic
971921989 4:32952586-32952608 ATTTTAATCAGGGAAGTTCAAGG + Intergenic
974468934 4:62293534-62293556 ATATTATTGAGTGAGCTTCAAGG - Intergenic
974611256 4:64220085-64220107 AATTTATTCACTGTGCTTCATGG - Intergenic
975381772 4:73708540-73708562 ATTTTAATGAAGGTGCTTCAGGG + Intergenic
975641168 4:76501736-76501758 ATGGGATTCAGGGAGCTTCTGGG + Intronic
976122335 4:81796925-81796947 ATTTTCTTCTAGTAGCTTCATGG - Intronic
976818782 4:89180910-89180932 ATTTTTTTCAGGGTTTTTCATGG + Intergenic
977033434 4:91917707-91917729 ATTTTGCTCAGGAATCTTCATGG - Intergenic
982196977 4:152926360-152926382 ATTTTTTTTAGGGAGCTTAATGG - Intergenic
982507294 4:156236335-156236357 ATTTTTTGGAGGAAGCTTCATGG - Intergenic
984016257 4:174430280-174430302 ATTTAGTTCAGGCAGCTGCAGGG - Intergenic
984150401 4:176123153-176123175 ATTTTATTAAGGCACATTCATGG - Intronic
985953517 5:3242334-3242356 ATTTTATTATGGTAGCTTTATGG + Intergenic
987353109 5:17038760-17038782 AATTTATTTTAGGAGCTTCAAGG - Intergenic
988950308 5:36251106-36251128 ATTTTATCAAGTCAGCTTCATGG - Intronic
989748141 5:44857068-44857090 TATTAATTCAGTGAGCTTCAGGG - Intergenic
990580545 5:57163618-57163640 ATTTTCATCAGGGAGAATCATGG + Intergenic
993773157 5:91956944-91956966 AATTAATTCAAGGAGCTACATGG - Intergenic
994106499 5:95955321-95955343 ATTTTATTCATGAATCTTCAAGG + Intronic
994722940 5:103401539-103401561 ATGGTATTCAGAGAGCTTCCAGG + Intergenic
996858006 5:128031504-128031526 ATTTTATTCTAGAAGTTTCATGG - Intergenic
998885999 5:146694077-146694099 ATTTGTTTCTGGCAGCTTCAAGG - Intronic
1003626121 6:7743067-7743089 ATTTTATTCCATGAACTTCAAGG + Intronic
1006899530 6:37490949-37490971 ACCTTATTCTGGGAGCTTTAAGG + Intronic
1010568119 6:77442809-77442831 TTATTATTCAGGGTTCTTCAGGG + Intergenic
1012392230 6:98755327-98755349 AGATTTTTCAGGGAGCTTCTGGG + Intergenic
1012446619 6:99313651-99313673 ATTTTATTCTGGCACCTTTATGG + Intronic
1012502738 6:99907419-99907441 ATTTTATTCTAGTAGTTTCATGG - Intergenic
1013211907 6:107994538-107994560 ATATTCTTCAGGGAGCTCAAAGG + Intergenic
1014005753 6:116415989-116416011 ATTTTATTCTGGAAGCTCTAGGG + Intronic
1014415101 6:121174037-121174059 ATTTTGTGCAAGGAGCTTAATGG - Intronic
1015805635 6:137105556-137105578 TTTTTTTTCAGATAGCTTCAAGG - Intergenic
1015844550 6:137506449-137506471 ATTTTATTCAGAGTGCTTATTGG - Intergenic
1016619086 6:146086880-146086902 ATGTTATTCAGGGAGATAAATGG + Intronic
1018153640 6:160964516-160964538 ATTTTGTTCAGAGATCTTTAAGG + Intergenic
1018473882 6:164121730-164121752 ATTTGACTCAGCCAGCTTCAGGG - Intergenic
1018703494 6:166446436-166446458 ACTTTGTCCAGGGAACTTCAGGG + Intronic
1020638159 7:10721943-10721965 AAATTATTCAGAGACCTTCAAGG + Intergenic
1020828615 7:13064549-13064571 TTTTTATTCAGGGAGTGACATGG - Intergenic
1023091127 7:36618565-36618587 ATTTCATTCAGGGAGATGCTGGG + Intronic
1023586677 7:41738167-41738189 ATTTTCTCCAGGGCGCATCATGG - Intergenic
1024020595 7:45364402-45364424 AGTTTGTTCTGGGAGCTTCCTGG + Intergenic
1024231934 7:47369315-47369337 ATTTCCTTGAGGGAGCTTCCAGG + Exonic
1024683183 7:51715792-51715814 ATTTTAGACAGGGAGCCTCCAGG + Intergenic
1024975622 7:55111471-55111493 ATTTTATTCAGGAAGCCTGGTGG - Intronic
1027347444 7:77275861-77275883 ATTTTTAACAGGGAGCTTCTGGG - Intronic
1027499133 7:78926220-78926242 AATTTCTTCAAGGATCTTCAAGG - Intronic
1027631788 7:80615342-80615364 ATATCATGCAGGGGGCTTCAAGG + Intronic
1027720030 7:81729135-81729157 ATTTTATTCACAGATCTTTAAGG + Intronic
1028781083 7:94737116-94737138 ATGAGATTCAGGAAGCTTCAAGG + Intergenic
1031128676 7:117805604-117805626 ATTAAATTCAGAGAGCTTAAGGG - Intronic
1031369187 7:120943531-120943553 ATTTTCTTCACAGAGCTTAATGG + Intergenic
1032769601 7:135037440-135037462 ATTTTATACTGTGATCTTCATGG + Exonic
1034430406 7:151038525-151038547 ATTTTATTAAGGGAGCCACTGGG - Intronic
1037044369 8:14278946-14278968 AATTTATTCAGAGAGATACATGG - Intronic
1037488091 8:19367972-19367994 ATTTTCTTTTGGTAGCTTCATGG + Intronic
1037650703 8:20835844-20835866 ATTTTCTCTATGGAGCTTCAGGG + Intergenic
1039406413 8:37316632-37316654 ATTTTATTCAGCAAACTTGAAGG + Intergenic
1040665395 8:49625502-49625524 CTTTCATTCAAGGTGCTTCAAGG + Intergenic
1041089692 8:54290681-54290703 ATTTTAAAAAGGGAGCTTAAAGG - Intergenic
1041856914 8:62467699-62467721 ATTTTATTTATTGAGCATCATGG - Intronic
1044000571 8:86874661-86874683 ATTTTATTCAAAGAGTTTTAAGG + Intronic
1044351484 8:91171424-91171446 ATTTTAATCAGGGAGCAGGAGGG - Intronic
1046180292 8:110636242-110636264 GTTTTATTCTGGGAGTTGCAGGG - Intergenic
1046186345 8:110725740-110725762 ATTTTATTCACAGATCTTAAAGG - Intergenic
1046715420 8:117561589-117561611 ACTTAATTCAGGCAGCTGCAGGG - Intergenic
1047401495 8:124552303-124552325 AATTTCTTCTGGTAGCTTCATGG - Intronic
1047855288 8:128902744-128902766 ATTTTCTTCACTGAGCTTCCAGG + Intergenic
1048190376 8:132282756-132282778 ATTCTATTTTGGTAGCTTCATGG - Intronic
1048289935 8:133173450-133173472 CATTTATTGAGGAAGCTTCAAGG + Intergenic
1051228509 9:14928594-14928616 AATATATTCACGGAGTTTCAAGG + Intergenic
1053490587 9:38498227-38498249 ATGATATTCAGAGAGCTTCTGGG + Intergenic
1055113624 9:72584690-72584712 ATTTTTTTAAGGGAACTTCTGGG + Intronic
1057670910 9:97087480-97087502 ATGATATTCAGAGAGCTTCTGGG + Intergenic
1057753352 9:97809949-97809971 CCTTTCTTCAGGGAGCTTGATGG - Intergenic
1058541205 9:106014316-106014338 ATTTTATTCAGAGAACTGGAGGG - Intergenic
1058653625 9:107199953-107199975 ATTTGCTTCATGGAACTTCATGG + Intergenic
1059557065 9:115292126-115292148 ATTTCATTCTCTGAGCTTCAGGG + Intronic
1060949972 9:127595234-127595256 ATTAGATCCAGGGAGCATCATGG + Intergenic
1062085556 9:134646246-134646268 ATTTTACTCAGGGCCCTCCATGG + Intronic
1062620608 9:137419717-137419739 ATTTTCTTCAAGGAAATTCATGG + Intronic
1062728156 9:138090440-138090462 ATTTTATTCTAGTAGATTCATGG - Intronic
1187980235 X:24748752-24748774 TTTTTATTCAGGGATATTGAGGG + Intronic
1188957667 X:36453063-36453085 TTTTTCTTCAAGGAGATTCATGG - Intergenic
1191643860 X:63457448-63457470 ATTTTAATTAGGGTGGTTCATGG - Intergenic
1191743552 X:64462757-64462779 ATCTTATTCAACGACCTTCAGGG + Intergenic
1193319109 X:80099016-80099038 ATTTTTTTAAGGGAGCTCGACGG + Intergenic
1193905126 X:87233232-87233254 ATTTTATTCAGATAGATTGAGGG + Intergenic
1194693595 X:97017060-97017082 ATTTTCTTCAGGCAGCTCCAAGG - Intronic
1195129839 X:101841025-101841047 ATTTCTTTCAGTGATCTTCAGGG + Exonic
1197012855 X:121588276-121588298 ATTTAATACAAGGAGCTTCTTGG + Intergenic
1197916215 X:131538771-131538793 ATTATCTTCTGAGAGCTTCAGGG - Intergenic
1199766581 X:150945883-150945905 TTCTTATTCAAGGAGCTTCCTGG + Intergenic
1200287460 X:154837463-154837485 AGTTAATTCAGGAGGCTTCAAGG + Exonic