ID: 1122159136

View in Genome Browser
Species Human (GRCh38)
Location 14:99770077-99770099
Sequence CTATCTTAGGGGAAATGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122159136 Original CRISPR CTATCTTAGGGGAAATGGGG GGG (reversed) Intronic
901937321 1:12635782-12635804 CTGTCTTATGGGAAATGGTGCGG + Intergenic
903067725 1:20710098-20710120 CTATCTCATAGGATATGGGGAGG + Intronic
907632176 1:56093673-56093695 TTACCTGAGGGGAAATGGGCTGG - Intergenic
908656979 1:66398411-66398433 CTACCTTAGGGTAAGTGGGAAGG + Intergenic
909395723 1:75168960-75168982 ATATTTTAGGGGGAAAGGGGTGG - Intergenic
910236572 1:85042803-85042825 TTATCTCAGGGAAAATGAGGTGG - Intronic
912049992 1:105517447-105517469 CTATTTTAGGAGAAATGGTGAGG - Intergenic
913678963 1:121170340-121170362 CTATCTCAGTGTATATGGGGTGG - Intronic
914030795 1:143957986-143958008 CTATCTCAGTGTATATGGGGTGG - Intronic
914158654 1:145109976-145109998 CTATCTCAGTGTATATGGGGTGG + Intronic
917515026 1:175700013-175700035 CTATGTGAGAGGGAATGGGGAGG + Intronic
918304244 1:183231465-183231487 CTAAGTTAGGGGACATGGGTGGG - Intronic
920060151 1:203221859-203221881 CTGTCTTGAAGGAAATGGGGTGG + Intronic
920466262 1:206188878-206188900 CTATCTCAGTGTATATGGGGTGG - Intronic
921106766 1:211988638-211988660 CAATAATAGGGGAAATGGTGGGG + Intronic
922033661 1:221827530-221827552 CTATCTTGGGAGATTTGGGGGGG + Intergenic
922750951 1:228069848-228069870 ATATCATAGGGGAAATAGCGTGG + Intergenic
924775068 1:247110984-247111006 CGTTCTTAGGGCAAATGGGAGGG - Exonic
1064149147 10:12848607-12848629 CTTTCTTAGGGGAAATGAGATGG + Intergenic
1064839400 10:19573574-19573596 CTTTTTTAGGGGGAAAGGGGTGG - Intronic
1069645153 10:69991446-69991468 CTATATTTGGAAAAATGGGGAGG + Intergenic
1071971786 10:90915399-90915421 CTGTCCTTGGGGAAATGGGCAGG + Intronic
1072374878 10:94804159-94804181 CAATCTTAGGGGAAAGGCTGAGG + Intronic
1079637399 11:22760940-22760962 CTATCTTCCGGAAAATGGTGGGG + Intronic
1081543748 11:44054963-44054985 CTAGCTTGGGGGTAATGGGAAGG - Intronic
1083478428 11:62928414-62928436 CTATCTCTGTGGAAAGGGGGCGG - Intergenic
1083812103 11:65111935-65111957 CCATCTCCTGGGAAATGGGGCGG + Exonic
1084902619 11:72321166-72321188 CTGTCTTTGAGGAGATGGGGAGG + Intronic
1089533316 11:119145900-119145922 CCATCTTGGGGGATATGTGGTGG + Intergenic
1090065932 11:123503443-123503465 CTATCTTAGGGGTATGGGTGGGG - Intergenic
1090276018 11:125420191-125420213 CTTTTTTGGGGGAAATGTGGTGG - Intronic
1096630820 12:52925811-52925833 CTATCTTAGAGGACAGGAGGTGG + Intronic
1096645343 12:53030998-53031020 AAATCTTAGAGGGAATGGGGGGG - Intronic
1096749450 12:53749403-53749425 CAGACTAAGGGGAAATGGGGAGG + Intergenic
1097246169 12:57608963-57608985 CTCCCTTAGGGGAGGTGGGGAGG + Intronic
1097291995 12:57924937-57924959 CCATCTTAGTGGAAATGAAGTGG - Intergenic
1098741396 12:74178046-74178068 CTGTATTAGGCAAAATGGGGTGG + Intergenic
1101232238 12:102753355-102753377 CTATCTTTGGGGAATTGGAGGGG + Intergenic
1104225572 12:126829563-126829585 CTCTCATAGGCTAAATGGGGTGG - Intergenic
1104407203 12:128527740-128527762 CTATGGTAGGGGAAATGGTATGG - Intronic
1110317902 13:74132809-74132831 TTATCTTTGGGGAAAAGGGTGGG - Intronic
1111445142 13:88338017-88338039 CATTTCTAGGGGAAATGGGGAGG - Intergenic
1114389570 14:22292401-22292423 CAATAATAGGGGAAATGGGGAGG + Intergenic
1114392465 14:22325105-22325127 GTATTTCAGGGGAAATGAGGGGG - Intergenic
1118335839 14:64852998-64853020 CTAGCTTGGGGGATGTGGGGAGG + Intronic
1122159136 14:99770077-99770099 CTATCTTAGGGGAAATGGGGGGG - Intronic
1122396164 14:101433666-101433688 TAATCTTAGGGGAAACTGGGTGG + Intergenic
1123462295 15:20484157-20484179 CTACCTACGGGGAAATGGGGAGG + Intergenic
1123655764 15:22516237-22516259 CTACCTACGGGGAAATGGGGAGG - Intergenic
1124272984 15:28300155-28300177 CTACCTACGGGGAAATGGGGAGG + Intronic
1124309674 15:28611414-28611436 CTACCTACGGGGAAATGGGGAGG - Intergenic
1126411114 15:48374111-48374133 CTGTCTGGGGAGAAATGGGGAGG - Intergenic
1129291946 15:74575060-74575082 CTCTCTCAGGGCAAACGGGGAGG - Intronic
1131436724 15:92428666-92428688 ATTTCCAAGGGGAAATGGGGAGG + Intronic
1131856203 15:96598477-96598499 CTATGTGAGGGGAGTTGGGGAGG + Intergenic
1133912981 16:10082698-10082720 TTATCTCATGGGAAATGAGGAGG - Intronic
1137264019 16:46854030-46854052 CAATCTGGGGGGAAATGGGTAGG - Intergenic
1137741542 16:50780874-50780896 CTATCTTATGGGGCATGGTGGGG + Intronic
1139334019 16:66218250-66218272 CTATCTGAGGTGAGATGAGGAGG - Intergenic
1139708404 16:68758170-68758192 CTACCCTAGGCAAAATGGGGTGG - Intronic
1140995267 16:80252785-80252807 CTATTTTAGGGGTGATGGTGGGG + Intergenic
1141423239 16:83930672-83930694 CTCCCTTACGGGAAATGGGATGG + Intronic
1146820307 17:35979351-35979373 CTATCTTAGAGGTATTGGAGAGG + Intronic
1148464538 17:47857131-47857153 CAATCTTAGGCAAAATTGGGAGG + Intergenic
1148715239 17:49711178-49711200 CCATCTCAGGGGACCTGGGGAGG + Exonic
1149998620 17:61417836-61417858 CTATCTGTGGGGAAAAGGGAAGG + Intergenic
1154142678 18:11838890-11838912 CTATCTTTGTGGAAATTGGCAGG + Intronic
1155239613 18:23853123-23853145 CTTTGTTAGGGGACATGGGAGGG - Intronic
1156185790 18:34661718-34661740 CTATCTTGGGGCAAAGAGGGTGG - Intronic
1159138981 18:64369608-64369630 CTATATTTGGGAAAATGGCGGGG + Intergenic
1162668813 19:12237653-12237675 CTATCCTAGGGGTACTGGGCGGG - Intronic
1164260653 19:23566015-23566037 CTATCTTGGGGGCAATGTGGTGG + Intronic
1165220807 19:34315242-34315264 CCATGTTTTGGGAAATGGGGTGG + Intronic
925045805 2:772390-772412 CTGTCCTTTGGGAAATGGGGTGG - Intergenic
926380398 2:12281165-12281187 TTATCTTGAGGGAAATGGGGAGG + Intergenic
929229110 2:39541065-39541087 CAATTGTTGGGGAAATGGGGTGG - Intergenic
931748705 2:65312654-65312676 CTACTTTAGGGGTAATGGGGAGG + Exonic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
935616006 2:105082604-105082626 CTTTCTCTGGAGAAATGGGGAGG + Intronic
937901932 2:127025978-127026000 CTATCTTGCGGGAAATGAGCAGG - Intergenic
938041274 2:128078167-128078189 CTATCTTAGGGGAACTGTCTTGG + Intergenic
939664867 2:144938540-144938562 GTATCTTAGGGGATCTGGAGTGG + Intergenic
940044027 2:149390397-149390419 CTGGTTTAGGGGATATGGGGAGG + Intronic
941972360 2:171365417-171365439 CGTTCTTAGGGCAAATGGGAGGG - Intronic
943466503 2:188235548-188235570 CTAACTTTGGGTAAATGGTGGGG + Intergenic
943642961 2:190379107-190379129 CTCGCTTAAGGGAAATGGAGTGG + Intergenic
944054263 2:195506857-195506879 CTATCTTAGGAAAAAGGAGGAGG - Intergenic
947846085 2:233244766-233244788 CTACCTTAAGGGAAAAAGGGGGG - Intronic
948467020 2:238157554-238157576 ATATCCTATGGGAAAAGGGGTGG + Intergenic
1171430509 20:25081026-25081048 ATTTCTTTGGGGAAATGGGTAGG + Intronic
1172044969 20:32073827-32073849 CTGTCTTAGGGGGAGTGGGATGG - Intronic
1181599117 22:23938542-23938564 CTTTCTTATGGGAAATTGTGTGG + Intergenic
949923170 3:9020368-9020390 CTGTCTTAGTTGAACTGGGGTGG + Intronic
950218313 3:11175391-11175413 ATATCCCAGGGGAAATGGGATGG + Intronic
950687504 3:14629013-14629035 GTATCTGAGGGGAAAGGGAGTGG + Intergenic
953663154 3:44905732-44905754 TTATCTTTGGAGAAATGTGGAGG - Intronic
956064533 3:65383267-65383289 CTCCCTTGGGGGAAAAGGGGTGG + Intronic
956721319 3:72120516-72120538 CTATCCCAGGGGATGTGGGGAGG + Intergenic
960592093 3:119376491-119376513 CTTGCTTAGGGGACATGTGGAGG - Intronic
960592221 3:119377515-119377537 CTTGCTTAGGGGACATGTGGAGG + Intronic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
966874816 3:184315701-184315723 CAAGCTTAAGGCAAATGGGGCGG - Exonic
967478178 3:189944719-189944741 CCATTTTAGGGCAAAGGGGGAGG - Intergenic
972848925 4:43024412-43024434 CCTTCCTAGGGGAAAGGGGGTGG + Intronic
975386125 4:73762505-73762527 GTATGTGAGAGGAAATGGGGAGG + Intergenic
975647106 4:76555912-76555934 CTATCTTGTGGGATGTGGGGAGG + Intronic
975698742 4:77041447-77041469 CTATCTTAGGGGAATTGAGATGG - Intergenic
976225235 4:82790562-82790584 CCAGCTTAGGGGGAATTGGGAGG - Intronic
982148455 4:152425405-152425427 CTATCAGAGGGGACCTGGGGTGG - Intronic
987144723 5:14981111-14981133 TTATGTTAGAGGCAATGGGGAGG - Intergenic
988867853 5:35354923-35354945 CTGTCTTAGGGGAAGGGTGGAGG + Intergenic
990631985 5:57680407-57680429 GTATCTTTGGGAAAATGTGGGGG + Intergenic
991500256 5:67269512-67269534 CTATCCTAGGGGACATGGAATGG + Intergenic
991609963 5:68439911-68439933 CTATCTTGGGGGAATTGAGGGGG + Intergenic
996148115 5:119999974-119999996 CTTTCTTTGGGGGAATGTGGGGG + Intergenic
998037788 5:138931454-138931476 CTATTTCAGGGAAAATGGTGGGG - Intronic
998342008 5:141426669-141426691 CTATTTTGGGGAAAATGAGGTGG - Intronic
999138479 5:149340178-149340200 TGATTTTAGGGGATATGGGGAGG + Exonic
1000561622 5:162796376-162796398 CTATCTTAGGAGAAAAGAGTTGG + Intergenic
1001783404 5:174390689-174390711 TTATCCTAGGAGAAGTGGGGTGG - Intergenic
1001905636 5:175470459-175470481 CTATTTTAGAGGAGATGTGGAGG - Intergenic
1002992870 6:2254229-2254251 CTCTCTTAGTGGGAATGAGGGGG - Intergenic
1003026499 6:2559682-2559704 CTAACTTGGAGGGAATGGGGAGG + Intergenic
1003684694 6:8290375-8290397 GTATCTTGGGGGAAAAGGGGTGG - Intergenic
1004938688 6:20533055-20533077 AGATCTTGGGGGAAAAGGGGTGG + Intergenic
1005019518 6:21404295-21404317 ATTGCTTAGGGGAAATGGAGAGG + Intergenic
1005312024 6:24567898-24567920 GTTTCTAAGGGGAAATTGGGAGG - Intronic
1006396483 6:33790550-33790572 CTAAGTCAGGGGAGATGGGGAGG - Intergenic
1010015980 6:71105300-71105322 CAAGCTTAAGGGAAATGTGGAGG - Intergenic
1010387851 6:75303005-75303027 CCATGGTAGGGGAAATGGAGAGG + Intronic
1011493833 6:87919659-87919681 CTATCTGAGGGGAATAGGCGGGG + Intergenic
1011731154 6:90265269-90265291 CTATTTTAGAGCAAATGGGAAGG - Intronic
1012299147 6:97563219-97563241 CATTCCTAGGGGAAAGGGGGTGG - Intergenic
1012864551 6:104602409-104602431 ATATCTTTGGGGAAGTGGGTAGG - Intergenic
1014943380 6:127469704-127469726 CTATCTTAGGGGACATGCTGGGG - Intronic
1016490795 6:144599226-144599248 GTGTATTTGGGGAAATGGGGTGG + Intronic
1016806737 6:148219397-148219419 TGATCATAGGGGAAATGGGGAGG - Intergenic
1018995758 6:168709475-168709497 CAATCTTTGGGGAAATGTGTGGG + Intergenic
1021616489 7:22507539-22507561 CCAGCTTAGAGGCAATGGGGAGG - Intronic
1022537613 7:31107617-31107639 TTGACTTAGGGGAAATGGGGAGG - Exonic
1022837361 7:34130890-34130912 CTGTCTTAGGGGAGAGGGTGAGG + Intronic
1022926290 7:35058748-35058770 CCAGCTTAGAGGCAATGGGGAGG - Intergenic
1023619859 7:42059787-42059809 TTATCTTAGGGGAAGAGGAGAGG - Intronic
1023819841 7:43974577-43974599 CTATCCTGGGGGTAAAGGGGTGG - Intergenic
1025260647 7:57415429-57415451 GCATCTGAGGGGCAATGGGGAGG - Intergenic
1026140188 7:67699065-67699087 CTCTGTTGGGGGAAGTGGGGTGG + Intergenic
1028375968 7:90146798-90146820 CCAGCTTAGAGGCAATGGGGAGG + Intergenic
1030316221 7:108117059-108117081 CTATCATTTTGGAAATGGGGAGG + Intronic
1030974312 7:116102270-116102292 CTATGTCAGCTGAAATGGGGTGG - Intronic
1031227696 7:119061368-119061390 TTAGCTTAGGGGAAATTTGGGGG + Intergenic
1031492606 7:122407500-122407522 CTTTCATATGTGAAATGGGGAGG - Intronic
1032573141 7:133022736-133022758 ATATCTCAGGTGGAATGGGGTGG - Intronic
1032720477 7:134547202-134547224 CCATCTTAGGGATTATGGGGAGG - Intergenic
1032758945 7:134919621-134919643 CTATGTATGGGGAGATGGGGTGG + Intronic
1046645023 8:116776637-116776659 CCATCTTAGGTGAAAGAGGGAGG + Intronic
1048637560 8:136314298-136314320 CTAGCTTATGGGAAATGCAGAGG + Intergenic
1055080641 9:72265075-72265097 CTACCTCAGGGGAGATGGGTGGG + Intergenic
1057467151 9:95324535-95324557 CCAAATTAGGGAAAATGGGGGGG + Intergenic
1057791938 9:98130434-98130456 CTGTCTTAGAGGAAAAAGGGTGG - Intronic
1187684733 X:21804956-21804978 CTTTCTAATGGGAAATGGTGGGG - Intergenic
1188137303 X:26505196-26505218 CTCTCTCAGGTGAAATGGGAGGG - Intergenic
1190773832 X:53536939-53536961 CTTGCTTAGGTGAAGTGGGGAGG + Intronic
1197808279 X:130417639-130417661 CTCCCATAGGGAAAATGGGGAGG + Intergenic
1198181375 X:134212875-134212897 CTATCTTAGTTGGAATGAGGAGG - Intergenic
1199324142 X:146476930-146476952 CTATCTTTGGGTCAATGGCGAGG + Intergenic
1199879843 X:151965144-151965166 CCATCTCAGGGGAGCTGGGGGGG + Intronic