ID: 1122162177

View in Genome Browser
Species Human (GRCh38)
Location 14:99792986-99793008
Sequence GCCCGGGGTAACCTCCGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122162177_1122162185 6 Left 1122162177 14:99792986-99793008 CCGTGGCGGAGGTTACCCCGGGC 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1122162185 14:99793015-99793037 CGCCCGCTCTCTCCCGGCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 184
1122162177_1122162183 0 Left 1122162177 14:99792986-99793008 CCGTGGCGGAGGTTACCCCGGGC 0: 1
1: 0
2: 1
3: 2
4: 68
Right 1122162183 14:99793009-99793031 CCCACGCGCCCGCTCTCTCCCGG 0: 1
1: 0
2: 1
3: 8
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122162177 Original CRISPR GCCCGGGGTAACCTCCGCCA CGG (reversed) Intronic
903707621 1:25298464-25298486 GCCCGGGGGAACCAGAGCCAGGG + Intronic
907488173 1:54791386-54791408 GCCAGGGGTAACATCCCCCAAGG - Intronic
923497438 1:234537694-234537716 CCCCGGGGAAACCTCCCCAAGGG + Intergenic
1077408351 11:2392497-2392519 GCCCAGGGAAACCACAGCCAAGG - Intronic
1081483390 11:43508736-43508758 GCCAAGGGTCACCTCCTCCAAGG + Intergenic
1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG + Intergenic
1084223213 11:67697533-67697555 GCCCTGAGGAACCTCTGCCATGG - Intergenic
1103764548 12:123271315-123271337 GCCCGGGGTGACCCCCGCGCCGG - Intronic
1104120650 12:125795947-125795969 TCCGGTGGTTACCTCCGCCAAGG - Intergenic
1104929367 12:132329766-132329788 GCGCGGGGTAGCCTGGGCCAAGG + Intergenic
1113579693 13:111420313-111420335 CCTCTGGGCAACCTCCGCCATGG + Intergenic
1113949100 13:114061233-114061255 GCGCGGGGCTCCCTCCGCCATGG + Intronic
1118607741 14:67515578-67515600 GCCCGGGGTCGGCCCCGCCACGG + Intronic
1122162177 14:99792986-99793008 GCCCGGGGTAACCTCCGCCACGG - Intronic
1122288422 14:100666565-100666587 GCCCAGGGACACCTCCCCCATGG + Intergenic
1122854324 14:104552913-104552935 GCCCTGGGTAACCTCCCTCTGGG + Intronic
1123058616 14:105584280-105584302 GCCGGGGGTCTCCTCCTCCAGGG + Intergenic
1123082947 14:105704514-105704536 GCCGGGGGTCTCCTCCTCCAGGG + Intergenic
1128506752 15:68278112-68278134 GCCCGGGGCGGCGTCCGCCATGG + Exonic
1132305623 15:100810049-100810071 GCCAGGCATAACCTCCACCATGG + Intergenic
1132896245 16:2230644-2230666 CCCCGGGTTGGCCTCCGCCACGG - Intronic
1141972441 16:87492730-87492752 GCCCGGGGTAACGGCCGGCCTGG - Intergenic
1142030111 16:87834369-87834391 GCCCGTGGTACCCTCTGCCCTGG - Intronic
1142264685 16:89058320-89058342 ACCCGGGCTAACCACTGCCAGGG + Intergenic
1143188034 17:5022359-5022381 GCCCTGGCTGACTTCCGCCACGG + Exonic
1145062013 17:19739474-19739496 GCCTGGGGTGCCCTCTGCCAGGG - Intronic
1147743150 17:42679997-42680019 GCCCAGGGCCACCTGCGCCACGG + Exonic
1150562092 17:66302850-66302872 GCCCGGGAAAACGTCAGCCATGG - Exonic
1154358867 18:13642654-13642676 GCCCCGGGCCACCTCTGCCAGGG + Intronic
1160524475 18:79526844-79526866 GCCCGGGCTTCCCTCTGCCATGG - Intronic
1161399032 19:4059477-4059499 GCCCGGGGTGATGTCAGCCAAGG + Intronic
1162440667 19:10690240-10690262 GGCCTGGGTAACCCCAGCCATGG + Exonic
1163462694 19:17448459-17448481 GCCCGCAGGAACCCCCGCCATGG - Exonic
925017936 2:545914-545936 CCCCGGGGAAACAACCGCCAGGG + Intergenic
927692644 2:25219282-25219304 GCTTGGGGTAACCTCAGCTATGG - Intergenic
938066255 2:128283515-128283537 GCCCGGGGTCACCTCCTCCATGG - Intronic
947913984 2:233820064-233820086 GGCCGGGGCCACCTCCTCCAGGG - Intronic
1172219298 20:33261881-33261903 GCCCAGGGTAACTTCCGGAATGG - Intergenic
1179972357 21:44843199-44843221 GCCCTGGGTAGCCACCTCCACGG + Intergenic
1180282461 22:10715373-10715395 GCCCTGGGTAACCTTGGCAAGGG + Intergenic
1181758114 22:25039659-25039681 TCCCGGGGCCACCTCCGTCAGGG + Exonic
1182977443 22:34636715-34636737 GACCAGGGTAAACTCAGCCACGG + Intergenic
1183323487 22:37179019-37179041 CCCCGGGGTAGCCTCTGACATGG + Intergenic
1184383990 22:44163938-44163960 TCCCGGGGGAACCTGAGCCAGGG - Intronic
1184838855 22:47040676-47040698 GCACGGGGTAACCTCCCACAGGG - Intronic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
966207315 3:177418296-177418318 CCCCGGGGTAATCACCACCACGG - Intergenic
968456907 4:704852-704874 GACCTGGGTGCCCTCCGCCAGGG - Intergenic
969366036 4:6694697-6694719 GCCCGGGGCAGCCTCCGGCTGGG + Intronic
985523292 5:389146-389168 CCCCGGGCTCCCCTCCGCCAGGG - Intronic
989195996 5:38716841-38716863 GCCCAGGGTAACAAACGCCAGGG - Intergenic
1001979977 5:176031345-176031367 GCCCGGGGAAACTTCTGCCTTGG + Intronic
1002237405 5:177812318-177812340 GCCCGGGGAAACTTCTGCCTTGG - Intergenic
1002276027 5:178104887-178104909 GCCCGGGGAAACTTCTGCCTTGG + Intergenic
1002640399 5:180628005-180628027 GCCCAGGGTTTCCTCAGCCAGGG - Intronic
1006319802 6:33313731-33313753 GACCGGGGGAACCGCCGCCCCGG - Exonic
1007352573 6:41284561-41284583 GCCTGGGGTACCTTCCCCCATGG + Intronic
1024630443 7:51242902-51242924 GCCCAGGGTAACCGCTACCAAGG + Intronic
1028925715 7:96355212-96355234 GCATGGGGTAACCACCCCCATGG + Intergenic
1033780171 7:144659394-144659416 GCACGGGGGAACCGCCCCCACGG + Intronic
1035023804 7:155814016-155814038 GCCCGGGTCAACCTCCCCAAAGG - Intergenic
1053312145 9:37026858-37026880 GCCCGGGGTAGCTGCGGCCAAGG + Intronic
1056147962 9:83752985-83753007 GCTCGGTGCAACCTCCGCCTGGG - Intronic
1060967620 9:127720687-127720709 GCCCAGGGACACCTCCCCCAGGG - Intronic
1061493268 9:130957733-130957755 GGCAGGGGTAGCCTCCTCCATGG + Intergenic
1062563320 9:137151322-137151344 GCCCAGGGAAAGCTCCGCCCAGG + Intronic
1185894137 X:3843432-3843454 GTCCGGGGTCTCCTCTGCCACGG + Exonic
1185899256 X:3881856-3881878 GTCCGGGGTCTCCTCTGCCACGG + Intergenic
1185904373 X:3920285-3920307 GTCCGGGGTCTCCTCTGCCACGG + Intergenic
1186836567 X:13444274-13444296 GCCCAGGGTAAACTCTGCTATGG + Intergenic
1189318730 X:40074388-40074410 GCCCAGGGTTCCCTCTGCCAAGG - Exonic
1194786112 X:98086234-98086256 GCATGGGGTAACCACCTCCATGG + Intergenic