ID: 1122168487

View in Genome Browser
Species Human (GRCh38)
Location 14:99850559-99850581
Sequence CGGTATCGCTGAAAACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122168483_1122168487 -2 Left 1122168483 14:99850538-99850560 CCTTCCACTGCTAAGGTTCTCCG 0: 1
1: 0
2: 3
3: 8
4: 82
Right 1122168487 14:99850559-99850581 CGGTATCGCTGAAAACAAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 28
1122168482_1122168487 -1 Left 1122168482 14:99850537-99850559 CCCTTCCACTGCTAAGGTTCTCC 0: 1
1: 0
2: 1
3: 13
4: 162
Right 1122168487 14:99850559-99850581 CGGTATCGCTGAAAACAAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 28
1122168485_1122168487 -6 Left 1122168485 14:99850542-99850564 CCACTGCTAAGGTTCTCCGGTAT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1122168487 14:99850559-99850581 CGGTATCGCTGAAAACAAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122168487 Original CRISPR CGGTATCGCTGAAAACAAGT TGG Intronic
900729256 1:4242073-4242095 CGCTATCCTTAAAAACAAGTTGG + Intergenic
908832865 1:68198135-68198157 AGGTTTAACTGAAAACAAGTAGG + Intronic
1072445728 10:95497110-95497132 GGGTACCGCAGTAAACAAGTTGG - Intronic
1074406376 10:113183523-113183545 CAATATCCCTGAAAAAAAGTGGG - Intergenic
1084796333 11:71507137-71507159 CAGAATCACTGAGAACAAGTAGG + Intronic
1086750019 11:90480773-90480795 AGGTATAACTGAAAACAATTCGG - Intergenic
1090990991 11:131816675-131816697 TGGTATGGCTGAAAGAAAGTGGG - Intronic
1092944788 12:13442728-13442750 AGGTAAGGCAGAAAACAAGTGGG + Intergenic
1098700245 12:73614871-73614893 GGGTATCCCTAAAAATAAGTAGG - Intergenic
1104510451 12:129373026-129373048 CGGTCTCTCTAACAACAAGTGGG - Intronic
1122168487 14:99850559-99850581 CGGTATCGCTGAAAACAAGTTGG + Intronic
1140237022 16:73168784-73168806 CGGTATTGCTGAAACCCAGAGGG - Intergenic
1159186416 18:64981587-64981609 CTGTATGGGTGAAAACAAGGAGG - Intergenic
1167346901 19:48951878-48951900 CTGAATCGCTGGAAACAAGAAGG - Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
1184225600 22:43127504-43127526 GGGTATCTCTGAATCCAAGTGGG + Intronic
950077928 3:10200354-10200376 CGGTTTCCCTGAAAACAAGGTGG - Exonic
950501670 3:13367855-13367877 CGGTATTGCTGTAAACATCTGGG + Intronic
968782241 4:2591908-2591930 CAGTATTGCTGAAAACACTTTGG - Intronic
986666321 5:10107995-10108017 CAGTGTGGCTGAAAACAGGTTGG - Intergenic
994024987 5:95071649-95071671 CTGTATCCCTGAATGCAAGTGGG + Intronic
996544687 5:124665567-124665589 CGATATAGCTGTAAACAATTTGG + Intronic
1002512615 5:179732859-179732881 CGGTAGCGCGGAAAACAATGGGG + Exonic
1018184446 6:161253905-161253927 CTGTAGCACTGAAAACAAATTGG - Intronic
1044962965 8:97548915-97548937 CTGTATCTCTGAAATCCAGTGGG - Intergenic
1051121204 9:13754257-13754279 CGTCGTCCCTGAAAACAAGTTGG + Intergenic
1056630736 9:88291011-88291033 CGGGATTGCTGAAGACAGGTGGG - Intergenic
1187509660 X:19906286-19906308 AGCTACCACTGAAAACAAGTTGG + Intergenic
1196885831 X:120244704-120244726 CGGACTCGCTGAAGGCAAGTGGG + Intergenic
1201056635 Y:9999846-9999868 CGGGGTCTTTGAAAACAAGTCGG + Intergenic