ID: 1122182017

View in Genome Browser
Species Human (GRCh38)
Location 14:99962264-99962286
Sequence CGGGCTCTCTCTGGAACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122182017_1122182020 -5 Left 1122182017 14:99962264-99962286 CCATCAGTTCCAGAGAGAGCCCG No data
Right 1122182020 14:99962282-99962304 GCCCGTTGTCAAAAGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122182017 Original CRISPR CGGGCTCTCTCTGGAACTGA TGG (reversed) Intergenic
No off target data available for this crispr