ID: 1122185149

View in Genome Browser
Species Human (GRCh38)
Location 14:99986724-99986746
Sequence CAATTCAGCATGTCTACAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122185148_1122185149 3 Left 1122185148 14:99986698-99986720 CCAAGGAGATAGAGCATAAGTAC 0: 1
1: 0
2: 1
3: 8
4: 160
Right 1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG 0: 1
1: 0
2: 0
3: 11
4: 119
1122185147_1122185149 10 Left 1122185147 14:99986691-99986713 CCTAGTTCCAAGGAGATAGAGCA 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG 0: 1
1: 0
2: 0
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122185149 Original CRISPR CAATTCAGCATGTCTACAAC TGG Intronic
900786083 1:4651497-4651519 CATTTCAGCATTTCTAGAACTGG - Intergenic
904145735 1:28389844-28389866 CAATTCAGCAATTCCACTACTGG + Intronic
905272400 1:36795739-36795761 AAATTCTGCATGTCCACAAAGGG + Exonic
905333253 1:37223842-37223864 CAATTCAGCATTCATACTACTGG + Intergenic
905736462 1:40330745-40330767 CATTTCAGCATGGCTACTATTGG + Intergenic
906395227 1:45457236-45457258 CAATTCAGTATGTATACTTCTGG - Intronic
908807841 1:67949227-67949249 CAATACAGCATGTGTAAAAGGGG - Intergenic
910260653 1:85290626-85290648 CAATTTAGGATGTCTACTTCAGG + Intergenic
913155398 1:116092292-116092314 CAGTTCATCACATCTACAACTGG - Intergenic
913333778 1:117689154-117689176 CAATCCAGCATTCCTACTACTGG + Intergenic
917697488 1:177541209-177541231 CAAAACAGCATGGCTACTACAGG + Intergenic
919012180 1:191979322-191979344 CAATTCAGCAATTCCACTACTGG - Intergenic
919279987 1:195477089-195477111 CAATTCAGCAGTTCCACTACTGG + Intergenic
922204344 1:223433502-223433524 CACTTCCGCATGTCTACCACTGG + Intergenic
1062795874 10:344828-344850 GACTTCAGCGTGTCCACAACTGG - Exonic
1065607952 10:27440482-27440504 TAATTCAGCATTTCTATAACTGG - Intergenic
1067993530 10:51242968-51242990 AAATCCAGTATGTCTACACCGGG - Intronic
1070832355 10:79425989-79426011 CAATTCTGAATGTCAACAAAGGG - Intronic
1072682896 10:97519465-97519487 CAATACAGAATGTGTAGAACAGG - Intronic
1074225267 10:111478691-111478713 ATATTCAGCATCTCTACAAAGGG - Intergenic
1080079269 11:28195229-28195251 CAATTCAGCAATCCTACTACTGG - Intronic
1087584567 11:100102089-100102111 CAATTCAGCAATCCTACTACTGG - Intronic
1089945468 11:122467534-122467556 CAATCCAGCAATTCCACAACTGG + Intergenic
1091076285 11:132620640-132620662 CCATGCAGGATGTCTACAAAGGG + Intronic
1091658789 12:2365550-2365572 CTAGTCAGCATGTCTACCACTGG + Intronic
1093351638 12:18109586-18109608 AAATTTAACATGTCTAAAACTGG - Intronic
1093532334 12:20182037-20182059 GCTTTCAGCATGTCTACAGCTGG + Intergenic
1095200379 12:39377546-39377568 CAATTCAGCAAGTCCACAAATGG - Intronic
1096099140 12:48958233-48958255 CAGTTCTGCATGTCTAGACCAGG - Intergenic
1097400274 12:59119773-59119795 CAATCCAGCATGTGTTCAGCTGG - Intergenic
1098495803 12:71134616-71134638 CAATTAATCATGTCTACCATGGG - Intronic
1099034467 12:77568067-77568089 CAATTCAGTATCTATAAAACTGG - Intergenic
1100670377 12:96805716-96805738 GGATTCAGCAGTTCTACAACTGG + Intronic
1101467588 12:104963396-104963418 CAATTCCGCATCTATAAAACAGG - Intergenic
1104741318 12:131176901-131176923 CAGTTCATTATGACTACAACTGG + Intergenic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109856991 13:68143726-68143748 CAATCCAGCAATTCTACACCTGG + Intergenic
1111078370 13:83268654-83268676 CAATTCAGCATTCTTATAACAGG - Intergenic
1111495308 13:89040571-89040593 CAATTCAGTATTTACACAACTGG + Intergenic
1112390342 13:98977925-98977947 CAAGTCAGAAAGTCTGCAACTGG + Exonic
1122185149 14:99986724-99986746 CAATTCAGCATGTCTACAACTGG + Intronic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1135781390 16:25304567-25304589 CAATTCACCCTTTCTACAACAGG - Intergenic
1138984889 16:62316480-62316502 CAATTAATGATGTCTACTACGGG - Intergenic
1143071817 17:4301817-4301839 CAATTTAGCATGGCTAGAATTGG + Intronic
1148749379 17:49935753-49935775 CACTCCACCATGTCTACACCTGG - Intergenic
1153920848 18:9788529-9788551 CAATCCAGCAGTTCTACTACTGG + Intronic
1155448094 18:25934041-25934063 CAATCCAGCAATTCTACTACTGG - Intergenic
1155785022 18:29884999-29885021 CAATTAAGCATCTATTCAACAGG - Intergenic
1156107009 18:33675460-33675482 TAATTCAGCATGGTTTCAACAGG - Intronic
1159669824 18:71209634-71209656 ATATTCAGCATGTCTACAGTGGG + Intergenic
1160428626 18:78796057-78796079 AAAATCAGCATGACTACAGCGGG - Intergenic
1162634849 19:11959584-11959606 CAGAGCAGCATGTCTACAACAGG - Intronic
1164091835 19:21961057-21961079 CAATTCAGAACATCTACAAAAGG - Intronic
1164196097 19:22961082-22961104 CAATTCAGAACATCTACAAAAGG - Intergenic
1164798898 19:31059361-31059383 CAATTCAGCAATCCTACTACTGG + Intergenic
925582788 2:5428887-5428909 CAATTAAGCATACGTACAACCGG - Intergenic
930470844 2:51810636-51810658 CAAATATGTATGTCTACAACAGG - Intergenic
935802529 2:106713247-106713269 CAATTCAGAAAGACTTCAACAGG - Intergenic
939098081 2:137859122-137859144 CGATTCAGCAATTCTACTACTGG - Intergenic
941415462 2:165215664-165215686 CAGTTGAGCATGTCTATAATAGG - Intergenic
1169788927 20:9389083-9389105 CAAACCAGCACTTCTACAACCGG - Intronic
1170386630 20:15825464-15825486 CATTTTATCATGTCTACAATTGG - Intronic
1173281143 20:41629074-41629096 CAATCCAGCAATTCTACTACTGG - Intergenic
1177606014 21:23378834-23378856 CACTTCAGCATGGCTAAAAGGGG + Intergenic
1182032566 22:27171028-27171050 TGATTCAGCAGGTCTACAATGGG - Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952849218 3:37713947-37713969 CAATGCAGCATTTCTACCAGGGG - Intronic
953629477 3:44600835-44600857 CAAATCAGCATATCTACAGTGGG + Intronic
959558726 3:107754294-107754316 GAATTCAGCATGTCTAGAAAAGG + Intronic
959641187 3:108638230-108638252 TAATCCAGCATGTCCAAAACTGG + Intronic
963635313 3:147787491-147787513 CAAATCAGCATCTCTAACACAGG - Intergenic
963946978 3:151156335-151156357 CAACTCTGCATGTCTTCAAAAGG - Intronic
963990666 3:151649726-151649748 AAATTCAACATGTCTGAAACAGG + Intergenic
967057708 3:185844160-185844182 CACTTCAGCATTGCTACAATGGG + Intergenic
967184622 3:186933890-186933912 CTATTCAGCATACCTACTACTGG - Intronic
972179987 4:36452192-36452214 CAATCCAGCAATTCTACTACTGG + Intergenic
974066190 4:57079935-57079957 CAATTCCTCATCTCTACAATGGG - Intronic
976303956 4:83540995-83541017 CATTTCATCATCTCTAAAACAGG - Intronic
981361652 4:143852726-143852748 CAATCCAGCAATTCTACTACTGG - Intergenic
981372380 4:143973625-143973647 CAATGCAGCAGTTCTACTACTGG - Intergenic
981381467 4:144076824-144076846 CAATCCAGCAGTTCTACTACTGG - Intergenic
981699050 4:147588282-147588304 TCATTAAGCATGTCTATAACTGG + Intergenic
982367719 4:154598436-154598458 CATTTAATCATGTCTACAGCTGG - Intergenic
985311816 4:188609961-188609983 CTGTTCAGCATCTCTACAAATGG - Intergenic
992242013 5:74781518-74781540 AAATTCCGCCTGTCTACCACAGG + Exonic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
997128300 5:131250930-131250952 GAATCCAGCATGTCAACAAAAGG + Intronic
997310797 5:132879929-132879951 AAATTCATCATCTCTACATCAGG + Exonic
998242344 5:140458719-140458741 CAATTCAACATGTCCTCCACAGG - Exonic
1000432841 5:161170664-161170686 CAATTCAGAAATTCTACTACTGG - Intergenic
1001883176 5:175262976-175262998 CACTTCTGGATGTCTACCACAGG + Intergenic
1008255625 6:49296290-49296312 CATTACAGCATTTCTACAAGAGG + Intergenic
1008882464 6:56394838-56394860 CAGTTCATCATGACTACAACTGG + Intergenic
1009582399 6:65552540-65552562 AAATTCAGCAGGTCTTCAAATGG - Intronic
1017105743 6:150886019-150886041 AAATTGAGCATGTTTAAAACAGG - Intronic
1018089599 6:160334168-160334190 AATTTCAACATGTCTAAAACTGG + Intergenic
1019891356 7:3949625-3949647 CAATCCAACATTTCTAGAACAGG - Intronic
1021685967 7:23186280-23186302 TGACTCAACATGTCTACAACTGG - Intronic
1022050378 7:26662757-26662779 CAATTCAGGATGCTTATAACAGG + Intergenic
1024025323 7:45405166-45405188 CAATTCACCATCTCCACCACAGG - Intergenic
1028393920 7:90346730-90346752 CAATGCACCATGGCTGCAACAGG - Exonic
1031735321 7:125352369-125352391 CAATTCAGCATTTCTTAAATTGG - Intergenic
1032752735 7:134858159-134858181 CTCTGCAGCATGTTTACAACTGG + Intronic
1032989432 7:137375617-137375639 TAATTCAGCAGGTCTAGAATAGG + Intergenic
1033186870 7:139234729-139234751 CAATTAAGCATGTTCACAAATGG - Intronic
1034698897 7:153079696-153079718 CAATCCAGCACTTCTACTACTGG - Intergenic
1035009312 7:155698927-155698949 CTATTCAGGATCACTACAACTGG - Intronic
1041136648 8:54766173-54766195 TAAGTCAGCCTGTCTACAAATGG + Intergenic
1048048918 8:130798806-130798828 CATCTCAGCATGTTCACAACAGG + Intronic
1048335521 8:133499462-133499484 AAATTTAGCATTTTTACAACAGG - Intronic
1050152320 9:2629115-2629137 TGATTCAGCAGGTCTAGAACAGG - Intronic
1050650675 9:7772805-7772827 CAATTCAGCCTAGCTACAAGTGG + Intergenic
1050715326 9:8517993-8518015 CCACTCAACATGTCAACAACTGG - Exonic
1052491177 9:29170077-29170099 CAATTCAGCAATCCTACTACTGG + Intergenic
1058070071 9:100592663-100592685 CAATTCAGTGTGTCCACAACAGG - Intergenic
1059013852 9:110493024-110493046 CACTTCACCATGCCAACAACTGG - Intronic
1061525333 9:131156930-131156952 CAATTAAGTATGTCTACAAATGG - Intronic
1061655774 9:132088914-132088936 CAAATTAGCATGTCCACAGCTGG - Intergenic
1187288718 X:17931627-17931649 CAAATCAAAATGTCTGCAACTGG - Intergenic
1188143405 X:26580401-26580423 CAATTCTGCATGTCTAAATGAGG + Intergenic
1188575671 X:31646765-31646787 CAATTCAGCGTGTCTCTAAAGGG + Intronic
1188910029 X:35835457-35835479 CAATCCATGATGTCTTCAACTGG + Intergenic
1190517825 X:51243251-51243273 CAACTCACCCTGCCTACAACTGG - Intergenic
1191667521 X:63718630-63718652 CCATTCAGAATGTCTCCTACTGG + Intronic
1192105086 X:68307692-68307714 CAATGCAACATGTATAGAACAGG + Intronic
1193456725 X:81740489-81740511 TAACTCAGCATGTCCACTACTGG - Intergenic
1196771829 X:119302128-119302150 TAATTCAGCAGGTCTAGATCAGG - Intergenic
1196783287 X:119401126-119401148 CAATTCTGCATCTGTAAAACAGG - Intronic
1201668983 Y:16493898-16493920 CAATTTAGCATGTTTATGACAGG - Intergenic