ID: 1122188063

View in Genome Browser
Species Human (GRCh38)
Location 14:100017062-100017084
Sequence CAGAGTAATGACATGGATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122188063_1122188068 23 Left 1122188063 14:100017062-100017084 CCGGAATCCATGTCATTACTCTG 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1122188068 14:100017108-100017130 GACAAGTTACTTAACCACTTTGG 0: 1
1: 4
2: 36
3: 200
4: 790
1122188063_1122188065 1 Left 1122188063 14:100017062-100017084 CCGGAATCCATGTCATTACTCTG 0: 1
1: 0
2: 1
3: 15
4: 171
Right 1122188065 14:100017086-100017108 TACTTATAGCTGTATGACCCTGG 0: 1
1: 2
2: 2
3: 41
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122188063 Original CRISPR CAGAGTAATGACATGGATTC CGG (reversed) Intronic
900877507 1:5354688-5354710 CAGGGGAATGACATGAATTATGG - Intergenic
904326239 1:29728413-29728435 CAGAGTAAGGACTTGAACTCAGG + Intergenic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
908822170 1:68099789-68099811 CAAGGTAAGGACATGGATTCTGG + Intronic
911475847 1:98371328-98371350 CAGAGGAATGAGATGGACACAGG + Intergenic
912623293 1:111187491-111187513 CAGAGTGAGGATATGGATTTTGG + Exonic
916375808 1:164152166-164152188 CAAAGTAATCATATGTATTCTGG - Intergenic
916597321 1:166257146-166257168 CAAAGTAATGGCATTGATCCAGG + Intergenic
917021502 1:170593424-170593446 CAGTGTAATAAAATGCATTCAGG - Intergenic
918944668 1:191047991-191048013 AAGAATAATATCATGGATTCTGG - Intergenic
919537751 1:198809641-198809663 TAGAGAAATAACTTGGATTCAGG - Intergenic
919862861 1:201753626-201753648 CACAGAAATGACAAGGCTTCAGG + Intronic
920837266 1:209522767-209522789 CAGAGTAATGAAGTTTATTCTGG - Intergenic
922361311 1:224824289-224824311 CAGAGTGATGTCATGGACTGTGG - Intergenic
923707473 1:236356223-236356245 CAGAGCTCTGACATGAATTCTGG + Intronic
1067492801 10:46728037-46728059 CAGAGGGATGACATGAATTTGGG - Intergenic
1067601863 10:47612358-47612380 CAGAGGGATGACATGAATTTGGG + Intergenic
1068249781 10:54423708-54423730 CAGAGGGATGACATGAATTTGGG + Intronic
1068467105 10:57408664-57408686 CTGAGAAATAAAATGGATTCTGG + Intergenic
1071276082 10:84056428-84056450 CAGAGAAATGAGATAGATACTGG - Intergenic
1071653389 10:87419946-87419968 CAGAGGGATGACATGAATTTGGG + Intergenic
1072215267 10:93282455-93282477 CAGAGGAATGACATTGTTACAGG + Intergenic
1072587019 10:96791708-96791730 CAAAGTAAAGATAAGGATTCAGG + Intergenic
1073784615 10:106875136-106875158 CAGAGTGATAAAATGGACTCTGG - Intronic
1076237502 10:128876726-128876748 CAGAGGAATGACATGTTTTGTGG - Intergenic
1076299601 10:129415001-129415023 CAGCGTATTGACATGGTGTCTGG + Intergenic
1077392480 11:2306603-2306625 CTGAGGAATGAAATGGTTTCTGG + Intronic
1077934549 11:6769834-6769856 CAGAGCTATCATATGGATTCAGG - Intergenic
1078552227 11:12288732-12288754 CAAAGGGAGGACATGGATTCAGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1079934742 11:26602858-26602880 CACAGTAATTACATGGGTTGGGG - Intronic
1080679047 11:34456718-34456740 CAAAGTAATTAACTGGATTCCGG - Exonic
1082161310 11:48891963-48891985 CAGAGTAAGCAAATGAATTCAGG + Intergenic
1084921508 11:72474445-72474467 GAGTGTACTTACATGGATTCAGG + Intergenic
1086092364 11:83017556-83017578 CATAGGAATGACATGGACTTTGG - Intronic
1090974791 11:131671790-131671812 CAGAGTAATGACCTGGACGCTGG + Intronic
1095315260 12:40753112-40753134 CAGAGTATTCACATGGTTGCAGG - Intronic
1095821162 12:46479934-46479956 AAGAGAAATAACTTGGATTCAGG + Intergenic
1095902056 12:47338428-47338450 CAGAGAGATGACAAGGATACTGG - Intergenic
1096829022 12:54300431-54300453 CAGAGTAATGGAATGGAGTTGGG + Intronic
1097162717 12:57060179-57060201 CAGAGTAAGGACAAGGATGTTGG - Intronic
1098769003 12:74528654-74528676 CACAGAAATGATATGGATTGAGG - Intergenic
1099386924 12:82025461-82025483 AATAGTAAAGACATGGAATCAGG + Intergenic
1104753308 12:131253507-131253529 CAGAGTAAAGACATGAGCTCAGG - Intergenic
1107310348 13:39070864-39070886 CAGAGACTTGACATGGATTTTGG + Intergenic
1108951879 13:56104817-56104839 CAGAGTCATAAAATGGATACTGG - Intergenic
1108978834 13:56483898-56483920 CAGAGGAAGGACATAGACTCTGG - Intergenic
1109611261 13:64767765-64767787 CAGCCTAAAGACATGGATTCAGG - Intergenic
1110137161 13:72082130-72082152 CTGAGGAATGACACAGATTCTGG - Intergenic
1110373998 13:74771388-74771410 CAGTGTAATAAAATGAATTCAGG - Intergenic
1116669712 14:47825286-47825308 TAGACTAATAACATGGATTTTGG - Intergenic
1119546488 14:75475705-75475727 CAAAGTAATGAGATTGATGCAGG + Intergenic
1120459610 14:84777941-84777963 CAGTGTAACTGCATGGATTCTGG + Intergenic
1120581209 14:86252146-86252168 CAGAGTAATCCCAGGGCTTCAGG - Intergenic
1122188063 14:100017062-100017084 CAGAGTAATGACATGGATTCCGG - Intronic
1123634723 15:22292677-22292699 CAGAGTAATGAGATAGCTGCTGG + Intergenic
1124951568 15:34326983-34327005 CAGTGTAATGACAAAAATTCTGG + Intronic
1127914543 15:63444668-63444690 CAGAGCAATGAAATGAATCCAGG + Intergenic
1128452914 15:67817319-67817341 CAGAGGAAGGACTTGAATTCTGG - Intergenic
1129597142 15:76973983-76974005 CAGAGTCATGCCATGGGTTAAGG - Intergenic
1131580807 15:93641176-93641198 CAAAGTGTTAACATGGATTCTGG - Intergenic
1133161752 16:3916447-3916469 CAGAGAAAGGACATGGGCTCTGG + Intergenic
1133386060 16:5371351-5371373 CAGAGTGATGCCAGGGATGCCGG + Intergenic
1135660559 16:24292829-24292851 CTGAAAAATGACATGGATTAGGG + Intronic
1138409663 16:56828893-56828915 CAGTGTAATGTCATGGATATGGG + Intronic
1141288946 16:82699521-82699543 CAGAGTTATGACACGCATTAAGG - Intronic
1142283842 16:89162985-89163007 CTGAGTGATGTCATGGATTTAGG + Intergenic
1144261152 17:13522208-13522230 CAGATAAATAACATGGATTATGG + Intronic
1148985932 17:51621456-51621478 CTGAGTGATGACATGGACTATGG + Intergenic
1149188104 17:54026108-54026130 CAGAGTAAAGACAGGAATCCTGG + Intergenic
1152148831 17:78586333-78586355 CAGAGTAGTGATAAGGCTTCAGG - Intergenic
1153694565 18:7627195-7627217 CAGAGTAATGACAGGGTGGCTGG - Intronic
1153774163 18:8438206-8438228 CAGAGTAAAGACATGGCCTTGGG - Intergenic
1155373746 18:25134001-25134023 CAGAGTAATGACATTTAATCAGG + Intronic
1155504911 18:26523883-26523905 CGGAATGATGACCTGGATTCTGG + Intronic
1156032090 18:32724423-32724445 AAGAGTAAAGACATGTATTGAGG - Intronic
1159942627 18:74420136-74420158 CCAAGTGAGGACATGGATTCTGG - Intergenic
1162484217 19:10948902-10948924 CTGATTAAGAACATGGATTCTGG - Intergenic
1164505261 19:28854885-28854907 TTGACTAATGACATGGATTTTGG + Intergenic
1166148750 19:40855433-40855455 CAGATTGATGACAAGGATTTGGG + Intronic
1166152890 19:40887218-40887240 CAGATTGATGACAAGGATTTGGG + Intronic
1166162204 19:40962690-40962712 TAGAGTGATGACAAGGATTAGGG - Intergenic
1166171689 19:41032158-41032180 CAGAGTGATGACAAGGATAAAGG + Intergenic
1166177330 19:41083683-41083705 CAGAGTGATGACAAGGATTAGGG - Intergenic
1168525316 19:57084044-57084066 CAGACAAATGACCTGGATTGTGG - Intergenic
926287308 2:11499833-11499855 TACAGTAATGACATGGGTACAGG - Intergenic
927067612 2:19489641-19489663 CTGAGAAATGACAGGGAATCAGG + Intergenic
929256995 2:39822839-39822861 GTGATTAATGACATAGATTCTGG + Intergenic
930605422 2:53488221-53488243 AAAAGTAATGACAAGTATTCTGG + Intergenic
933249664 2:80015099-80015121 GACAGTAATGACATGCTTTCTGG + Intronic
934589944 2:95539323-95539345 CAGAGTAAACAAATGAATTCAGG + Intergenic
935079631 2:99779870-99779892 CAGAGCCACGACCTGGATTCAGG + Intronic
935224254 2:101039326-101039348 CAGAATAATAACATGGAGTTAGG + Intronic
938573183 2:132581405-132581427 CAGAGCCATCACATGGTTTCTGG - Intronic
939028709 2:137044860-137044882 CAGAATAGTGACATGGATTCAGG - Intronic
939423448 2:142003640-142003662 CAGAGTAATGAAATGCAGGCAGG + Intronic
939818643 2:146928252-146928274 CTGTGTAATGACATGGAGCCAGG + Intergenic
943093914 2:183405475-183405497 CAAAGCAAAGACATGGATGCTGG - Intergenic
943581288 2:189686102-189686124 CAAAGAAATGAAAGGGATTCTGG - Intronic
944684627 2:202107155-202107177 ATGAGTAAGAACATGGATTCTGG - Intronic
946445794 2:219738863-219738885 CAAAAAAAGGACATGGATTCTGG + Intergenic
947677495 2:231996159-231996181 CAGAGTAATCCCATGGAATTGGG + Intronic
1170389071 20:15852332-15852354 CAGAGTAATGACAGATATACTGG + Intronic
1170448402 20:16455416-16455438 CAGAGGACTGACATGGACTCTGG + Intronic
1170546713 20:17440895-17440917 CAGGGCAATGAGATAGATTCAGG + Intronic
1170793516 20:19526951-19526973 CATAGTCATCACATGGATTATGG - Intronic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1176880879 21:14191661-14191683 AAGAGAAATGAGATGGATTCAGG - Intronic
1177097310 21:16852369-16852391 CAGAGTAATGATAAGGGCTCAGG + Intergenic
1178481956 21:32987204-32987226 AAGAGTAAAGACATGGTTTTGGG + Intergenic
1179014176 21:37581113-37581135 CATAATTATGACAAGGATTCTGG - Intergenic
1181010422 22:20037101-20037123 CAGAGGAGTGACATGGGTCCAGG + Intronic
950135518 3:10578003-10578025 CAGAGTAGAGACTTGGACTCTGG - Intronic
951144842 3:19214586-19214608 CTGAGAAAAGACATGGTTTCTGG - Intronic
953838795 3:46371677-46371699 CAGATGAATGTCATGCATTCTGG - Intronic
962330342 3:134472638-134472660 CAGAGTCCTGACAGGGGTTCAGG - Intergenic
962933054 3:140055214-140055236 CAGAGTAAGAAAATGGTTTCTGG - Intronic
963450094 3:145468390-145468412 CAGAAGAAAGATATGGATTCTGG + Intergenic
965291347 3:166885840-166885862 CAGAGTAATATAATGGATTTTGG + Intergenic
965353942 3:167650303-167650325 TAGAGAAATGACATGGTCTCTGG - Intronic
968241856 3:197096424-197096446 CAGGGTAATGCCTTGGTTTCAGG - Intronic
968585195 4:1413109-1413131 CAGAGGAAGGCCATGGATTGCGG - Intergenic
969273419 4:6118408-6118430 CAGACAAATGACATGGAGGCTGG + Intronic
971828199 4:31655494-31655516 CAGAGGAAAGACAAGTATTCAGG - Intergenic
971847378 4:31936991-31937013 CAGAGTGATGTAATGGACTCTGG + Intergenic
972693292 4:41420417-41420439 CAGAGCCATGCCTTGGATTCAGG + Intronic
972950530 4:44316883-44316905 CAGAAGAATGACATGAACTCAGG + Intronic
975494631 4:75024294-75024316 CTGATTAATGACATGGAGTAAGG + Intronic
975682192 4:76887668-76887690 CAGATTGATGACCTGGGTTCAGG - Intergenic
976214641 4:82704771-82704793 AAGAGCAATGACTTGGAGTCAGG + Intronic
977330691 4:95633771-95633793 TAAAGTAGTGACATGGATTTTGG + Intergenic
977460224 4:97315805-97315827 ATGAGTAATGACATTGATTAAGG + Intronic
977732718 4:100373398-100373420 CAGGGAAATGAAATGGGTTCAGG + Intergenic
978162344 4:105564009-105564031 CAGAGTACTTACCTGGATTAGGG + Intronic
981909150 4:149957993-149958015 CAGAGTAATTGCATGGACTAAGG - Intergenic
984531975 4:180927456-180927478 CAGAATAGTGACATTGATTGTGG - Intergenic
987143764 5:14971154-14971176 CAGAGTAAAGACCTGGACACAGG + Intergenic
989439271 5:41451074-41451096 CAGAGGAAATAAATGGATTCTGG + Intronic
989692165 5:44157828-44157850 CAGAGGAATCCCAGGGATTCAGG - Intergenic
989692276 5:44158687-44158709 CAGAGGAATCCCAGGGATTCAGG - Intergenic
992639551 5:78757348-78757370 CAGAGTGATGACTCGGCTTCTGG - Intronic
994577418 5:101595875-101595897 CAGAGAATTTACATGAATTCAGG + Intergenic
996914488 5:128695821-128695843 AAGTGTAATGAGATTGATTCTGG + Intronic
997801181 5:136864119-136864141 TAGAGTAAGGATGTGGATTCTGG + Intergenic
998265691 5:140665906-140665928 CAGAAGAATCACTTGGATTCGGG + Intronic
999054283 5:148557161-148557183 CAGAGTAATGACATGGGGGCAGG + Intronic
1002669860 5:180857833-180857855 CAGTGAAATGGCATGGAATCTGG + Intronic
1004019459 6:11763552-11763574 CAGAGTAATGACGGGCAGTCCGG - Intronic
1005287125 6:24339720-24339742 CAGAGTAATTACATGGTGCCTGG + Intronic
1009621828 6:66087227-66087249 CACAGTACTGGCATGGATTGAGG + Intergenic
1009683457 6:66926976-66926998 AAGAGTAATGGCATGGACACAGG + Intergenic
1014808310 6:125856811-125856833 CAGAGTAATGACACTTGTTCTGG + Intronic
1016873214 6:148839068-148839090 CAGAGTAATCACCTGGAATCTGG + Intronic
1019911864 7:4105684-4105706 CAGAATTAGGACATAGATTCTGG + Intronic
1021936713 7:25638605-25638627 CAGAGTGATGACAAGGAGACTGG - Intergenic
1024663027 7:51517523-51517545 AAGTGTAATGAGATGGATTAAGG + Intergenic
1026619274 7:71936070-71936092 TAGAGTTCTGACATGGCTTCTGG - Intronic
1029195465 7:98802417-98802439 GAGAGTAATGACATGGCTCGGGG + Intergenic
1033573528 7:142657374-142657396 CAGAGTCATCACATGGCTTGGGG - Intergenic
1034116683 7:148589729-148589751 CAGAGTAATCTTAGGGATTCTGG + Intergenic
1034189541 7:149203281-149203303 CAGAATAATGAAATGGTTTTGGG + Intronic
1038764254 8:30412903-30412925 CAGTATAATGACATCGATTTAGG + Intronic
1039703511 8:39984764-39984786 CAGAGAAATGACATCAATGCAGG + Intronic
1042381419 8:68118623-68118645 CACAGTGATGAAATGGACTCAGG + Exonic
1046725643 8:117670718-117670740 CAGAGTATTGAGATGGTTGCAGG + Intergenic
1046928358 8:119817617-119817639 AAGTGTAATGACAGGGATCCTGG - Intronic
1046974548 8:120259222-120259244 CAGAGTAGTTACCTGGATGCTGG + Intronic
1047145265 8:122191575-122191597 CAGAGTAATGACATCCATTAGGG - Intergenic
1048612842 8:136042453-136042475 CAGAATAATTTGATGGATTCTGG + Intergenic
1049023107 8:139971049-139971071 CAGAGAAAAGAGGTGGATTCCGG - Intronic
1051973319 9:22918239-22918261 CAGTGAAATGACATGCAATCAGG + Intergenic
1055993970 9:82137435-82137457 CAGAGTGATAAAATGAATTCTGG - Intergenic
1059624179 9:116043554-116043576 CATAGTAAAGTCATGGACTCAGG + Intergenic
1061100529 9:128488441-128488463 CAGAGTAAGGACTTGAATCCAGG - Intronic
1187001395 X:15182912-15182934 CAGAGTAATGTAATGGACACTGG - Intergenic
1187389380 X:18875806-18875828 CAGAAAAATGACATGAATTAGGG + Intergenic
1189012314 X:37058935-37058957 CAGGGTAATCACATGGTTTCTGG + Intergenic
1189036398 X:37497317-37497339 CAGGGTAATCACATGGTTTCTGG - Intronic
1192180141 X:68911125-68911147 CAGAGTAAGGACAGGGCTACTGG + Intergenic
1194354412 X:92863930-92863952 CACGTTAAAGACATGGATTCAGG - Intergenic
1194416165 X:93615050-93615072 CAGAGGAATAACAGGGAGTCTGG + Intergenic
1195327656 X:103771105-103771127 CAGAGAAATGAGATGGTTTCCGG - Intergenic
1195425394 X:104723644-104723666 CAGAGAAATGACAAGGAATTTGG + Intronic
1196614739 X:117755192-117755214 CAGAGTAATAAAATGGAGTGGGG + Intergenic
1200096526 X:153667136-153667158 AGGAGTAATGAGATTGATTCTGG - Intergenic
1200662771 Y:5980958-5980980 CACATTAAAGACATGGATTCAGG - Intergenic
1201787499 Y:17801821-17801843 ATGAGCAATGACATGGCTTCTGG + Intergenic
1201814054 Y:18104167-18104189 ATGAGCAATGACATGGCTTCTGG - Intergenic