ID: 1122192559

View in Genome Browser
Species Human (GRCh38)
Location 14:100057771-100057793
Sequence GACTCCTAGAACCTCAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 81}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122192559 Original CRISPR GACTCCTAGAACCTCAACTA TGG (reversed) Intronic
904258820 1:29275298-29275320 GACCCCTAGAACATCAAACAGGG - Intronic
908431819 1:64065967-64065989 CACTCCTAGAACTTGAACAATGG + Intronic
911802207 1:102156259-102156281 CCCTCCTAGCACCTCCACTATGG + Intergenic
915641206 1:157228277-157228299 GACTCCTAGAAACATTACTAAGG + Intergenic
915668275 1:157464664-157464686 GACTCCTAGAAACATTACTAAGG - Intergenic
917037375 1:170763571-170763593 GACTCCTAGGAGCTCTACTCTGG + Intergenic
920868667 1:209774848-209774870 TACTACTAGAGCCTGAACTAAGG + Intronic
921889472 1:220339421-220339443 GAGTCCAATAACCTCAATTATGG + Intergenic
1064668291 10:17680718-17680740 TACTCTTAGTACCTCATCTAAGG + Intronic
1068252842 10:54466440-54466462 GACACCAAGAACCTACACTAGGG - Intronic
1075741013 10:124696601-124696623 GACACGAAGAACCTCAAGTAGGG + Intronic
1078580727 11:12537593-12537615 AACGGCTAGAACCTCAACTCTGG - Intergenic
1080377554 11:31731054-31731076 GACTCCCAGAACCTCTAATCAGG + Intronic
1087581840 11:100065707-100065729 GACACTGAGAACCTGAACTAAGG + Intronic
1088323647 11:108579830-108579852 TACTCCTCAAACCTGAACTAGGG - Intronic
1091946885 12:4554154-4554176 GTCTCCTAGAGCCTCCACAAAGG - Intronic
1096138853 12:49225657-49225679 GATTCCTTGAACCTCAACCAAGG + Intronic
1096242037 12:49964767-49964789 GACACCTAGACCCTCAAAGAAGG - Intronic
1099263673 12:80416814-80416836 GACTGCTAAAACATGAACTAAGG - Intronic
1105323764 13:19351858-19351880 AACTCCCAGGACCTCAACAATGG - Intergenic
1105870192 13:24497680-24497702 AACTCCCAGGACCTCAACAACGG + Intronic
1108904224 13:55449536-55449558 GACCCCTAGAAATTTAACTAAGG - Intergenic
1110523642 13:76509907-76509929 GACTCTTAGAACTTGAATTATGG + Intergenic
1111649849 13:91075681-91075703 CTCTACTAGAAGCTCAACTAGGG - Intergenic
1113495022 13:110719994-110720016 CACTCCTTGCACCTCAACAAAGG - Exonic
1122192559 14:100057771-100057793 GACTCCTAGAACCTCAACTATGG - Intronic
1122253154 14:100454812-100454834 GACTCTAAGCAGCTCAACTAAGG + Intronic
1134012346 16:10864405-10864427 GACTCCAAGCAGCTCAGCTAAGG - Intergenic
1134211659 16:12282600-12282622 GAGTCCTAGAACCTCAGATTGGG + Intronic
1139372313 16:66476706-66476728 GCCTCCCAGAACCTCAGCTGTGG + Intronic
1142575600 17:905005-905027 CACTCCTACACCCACAACTACGG + Intronic
1144275075 17:13658784-13658806 GACTCCAAGAAGCCCAGCTAAGG + Intergenic
1149051100 17:52306399-52306421 GAGTCCCAAAACCTCAAGTAGGG - Intergenic
1149795508 17:59515499-59515521 CTCTCTTAGCACCTCAACTAGGG - Intergenic
1150018642 17:61587455-61587477 CTCTCCAAGAACCTCAACAAGGG + Intergenic
1155271072 18:24141702-24141724 GACTCCTAAAAAATCACCTAAGG - Intronic
1157187571 18:45553488-45553510 GACTCTTCAAATCTCAACTATGG - Intronic
1157313243 18:46568139-46568161 GATTCCTAGGACCTGAAATAGGG + Intronic
1161068753 19:2250354-2250376 GGCTCCTGGAACCTCAGCGAGGG - Exonic
1166072074 19:40393663-40393685 GACCCCTAGAACCTCCTCTTTGG + Intergenic
1167512110 19:49900870-49900892 GACTTCTAGAACCACAATGATGG + Intronic
927166462 2:20327942-20327964 GACTCCAAGGAGCTCAATTAAGG + Intronic
930315038 2:49787010-49787032 GTCTCCTCGAAGCTCAAGTAGGG + Intergenic
932330982 2:70898155-70898177 GACACCTAGGACCTCATCCATGG + Intergenic
942418307 2:175781550-175781572 GCCTCGTAGAACCTGTACTATGG - Intergenic
1170819665 20:19745867-19745889 GATGGCTAGAGCCTCAACTAGGG + Intergenic
1170977155 20:21175708-21175730 GCCTCCTAGAGACTTAACTAAGG - Intronic
1175631382 20:60540112-60540134 TACTCCTCCAACCTCCACTAGGG - Intergenic
1177945197 21:27459731-27459753 GTCTCCTAAAACCTAAAATAGGG - Intergenic
1180853851 22:19034528-19034550 GACTCCCAGGACCTCAAGTATGG - Intergenic
1184853854 22:47136070-47136092 GGTTCCTAGAACCTCACGTACGG + Intronic
950740891 3:15051123-15051145 GACCCCTAGAAACTCAGCCAAGG - Exonic
951994811 3:28715110-28715132 GTCTCCTAGACCCTCACCTAGGG - Intergenic
952053293 3:29412785-29412807 GTCTCCTAGAACCTTAAGCAGGG + Intronic
963080238 3:141385026-141385048 GAAACCTAGTACCTCAGCTAAGG + Intronic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
982029404 4:151284834-151284856 GACTCCAAGCAGCTCAGCTAAGG - Intronic
982372754 4:154651912-154651934 GACTCTTAGTTCCTCAACTCGGG + Intronic
986302512 5:6489544-6489566 GACTCCTGACTCCTCAACTATGG + Intronic
992457269 5:76927338-76927360 GACACCTGGAACCTCAAAAAGGG - Intergenic
995213802 5:109571830-109571852 GACTCCTAGAACCTAAATATTGG + Intergenic
996300149 5:121972162-121972184 CCTTCCTAGAACCTCTACTATGG - Intronic
996515650 5:124366428-124366450 AACTCCTTGATCCCCAACTATGG - Intergenic
998186187 5:139981644-139981666 AACTCCTAGAACTCCATCTAGGG + Intronic
1002831618 6:826980-827002 TACTCCTAGAAACTTCACTAAGG - Intergenic
1005081566 6:21961536-21961558 GACTCCTAGAACGCCCATTATGG - Intergenic
1010369005 6:75085758-75085780 GGCTCCTAGAAACTGAACTCGGG + Exonic
1010408420 6:75532854-75532876 GACTCTAAGTACCTCAGCTAAGG + Intergenic
1011007878 6:82668173-82668195 GACTCCTAGCAGCTCAGCTATGG - Intergenic
1015961824 6:138658094-138658116 GACTCCTATAGCCTCATTTATGG - Intronic
1017053016 6:150410782-150410804 TACTCATAGTACCTCAAGTATGG - Intergenic
1021584781 7:22196316-22196338 CATACCCAGAACCTCAACTATGG - Intronic
1024310339 7:47963282-47963304 AACTTCTTGAATCTCAACTAAGG + Exonic
1029045368 7:97622189-97622211 GACTCCCAGAACCCCAGCTTAGG + Intergenic
1030989119 7:116279036-116279058 GACCCCTAGAACATAAACTCTGG - Intergenic
1033836787 7:145323433-145323455 GATTCCTAGTATCTCAAATAAGG + Intergenic
1039166028 8:34680905-34680927 TATTTCTAGAACCTCAAGTAGGG + Intergenic
1040444948 8:47484082-47484104 TACTCCTACAACCCCAGCTATGG - Intronic
1040489670 8:47907932-47907954 GCCACCCAGTACCTCAACTATGG + Intronic
1046848611 8:118947461-118947483 GATTCCTAGAACTTCTCCTAAGG - Intronic
1047794389 8:128239369-128239391 GACTACAAGAACCTGAATTAGGG - Intergenic
1054843928 9:69772432-69772454 GACTCCTAGAAACTTCACTAAGG + Intergenic
1059623222 9:116032268-116032290 AAGTTCTAGAACCTCACCTAAGG - Intergenic
1185919387 X:4073302-4073324 GAATCCTAGAACCTCAAAGCTGG - Intergenic
1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG + Intergenic
1197336287 X:125213013-125213035 AGCACCTAGAACTTCAACTAAGG - Intergenic
1199310490 X:146314853-146314875 GACTCCTAGAAATTTTACTAAGG + Intergenic