ID: 1122193661

View in Genome Browser
Species Human (GRCh38)
Location 14:100068361-100068383
Sequence CAGCTCGCAGGCTTTGCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122193661_1122193666 25 Left 1122193661 14:100068361-100068383 CCAACGGCAAAGCCTGCGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1122193666 14:100068409-100068431 ATTTAGTTAGGGGAAGCCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 109
1122193661_1122193667 28 Left 1122193661 14:100068361-100068383 CCAACGGCAAAGCCTGCGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1122193667 14:100068412-100068434 TAGTTAGGGGAAGCCTTTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1122193661_1122193663 13 Left 1122193661 14:100068361-100068383 CCAACGGCAAAGCCTGCGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1122193663 14:100068397-100068419 GCGTATGTCAGAATTTAGTTAGG 0: 1
1: 0
2: 0
3: 9
4: 77
1122193661_1122193665 15 Left 1122193661 14:100068361-100068383 CCAACGGCAAAGCCTGCGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1122193665 14:100068399-100068421 GTATGTCAGAATTTAGTTAGGGG 0: 1
1: 0
2: 1
3: 17
4: 182
1122193661_1122193668 29 Left 1122193661 14:100068361-100068383 CCAACGGCAAAGCCTGCGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1122193668 14:100068413-100068435 AGTTAGGGGAAGCCTTTGGAGGG 0: 1
1: 0
2: 2
3: 26
4: 201
1122193661_1122193664 14 Left 1122193661 14:100068361-100068383 CCAACGGCAAAGCCTGCGAGCTG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1122193664 14:100068398-100068420 CGTATGTCAGAATTTAGTTAGGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122193661 Original CRISPR CAGCTCGCAGGCTTTGCCGT TGG (reversed) Intronic
900119012 1:1040800-1040822 CAGCTCGCATTCGTTGCTGTAGG - Exonic
900119858 1:1043937-1043959 TAGCTCGCAGGCACTGCCGTAGG - Exonic
900789723 1:4671903-4671925 CTGCTCTCAGGCGTTGCAGTAGG + Intronic
901278880 1:8015957-8015979 CAACTCTCAGGCTGTGCAGTAGG - Intronic
905648539 1:39640804-39640826 CAGCAAGCAGGCCTTGCTGTGGG - Intergenic
907660084 1:56383861-56383883 GAGCTGGCAGGCTTTGCTGACGG - Intergenic
914256441 1:145963881-145963903 AAGCTCCCAGTCTTTGCCATAGG - Intronic
915911622 1:159919007-159919029 CAGAGCACAGGCTTTGCTGTTGG + Intronic
916495419 1:165342432-165342454 CAGCTCCCAGGGTTTGCTATTGG - Intronic
918378519 1:183932696-183932718 CAGCCTGCAGGCTTTGCAGTGGG + Intronic
919808683 1:201396029-201396051 AGGCTCCCAGGCTTTGCCCTGGG - Intronic
922741739 1:228017979-228018001 CAGCACGGGGGCTTTGCCATTGG + Intronic
1067532337 10:47083313-47083335 CAGCAGGCAGGCTTTTCAGTGGG + Intergenic
1071431997 10:85613524-85613546 CAGCTTGAGGGATTTGCCGTCGG + Exonic
1072944883 10:99800780-99800802 CAGCTTGCAGGCTTCTCCCTGGG - Intronic
1076188675 10:128467973-128467995 CAGCTCACAGGCTTTGCCTCAGG + Intergenic
1079336935 11:19578193-19578215 CAGCTCGCAGGCAGAGCCGGAGG - Intronic
1081642568 11:44766340-44766362 CAGCTGGCAGGGTGAGCCGTGGG - Intronic
1083157329 11:60832195-60832217 CAGCTGGCAGCCTCTGCAGTGGG - Intergenic
1083949759 11:65947470-65947492 CAGCACCCAGGCTTTGCAGCTGG - Exonic
1083961046 11:66015303-66015325 CAGCTCCCAGGCCCTGCTGTCGG + Intergenic
1084083897 11:66845955-66845977 CTGCTGGCAGGCTATGCCCTGGG + Exonic
1084888244 11:72224220-72224242 CTCCCCGCAGGCTTTGCCGGGGG + Intronic
1091933329 12:4414896-4414918 CAGCTCTCCGGCCTTGCCTTGGG + Intergenic
1111406600 13:87814511-87814533 CATCCCTCAGGCTTTGCCATGGG + Intergenic
1122193661 14:100068361-100068383 CAGCTCGCAGGCTTTGCCGTTGG - Intronic
1122577501 14:102751378-102751400 CATCGTGCAGGCTTTGCCGGCGG - Intergenic
1128223079 15:65982322-65982344 CAGCTGGCATCCCTTGCCGTGGG + Exonic
1128325765 15:66723049-66723071 CAGCTCCCAGGCCTTGGGGTGGG + Intronic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1136547572 16:30964350-30964372 CAGCTCCCAGACTTTGCGGGCGG - Intronic
1141677557 16:85525512-85525534 CAGCCGGCAGGCTTTCCTGTGGG + Intergenic
1142181492 16:88673049-88673071 CTGCTCTCAGGCATTGCCGTGGG + Intergenic
1143525333 17:7468634-7468656 CAGCTCCCAGGCTTTGTGGAGGG - Intronic
1147402960 17:40191910-40191932 CAGGTCGCAGACTTGGCTGTGGG + Intronic
1151321020 17:73352417-73352439 CAGCCCCCAGGCTCTGCTGTGGG + Intronic
1152369621 17:79878251-79878273 CAGCTCCCAGGCAATGACGTTGG - Intergenic
1155165363 18:23227781-23227803 CAGCTTTCAGGCTTTGCTTTAGG + Intronic
1157076536 18:44473407-44473429 CTGCTTACAGGCTGTGCCGTTGG - Intergenic
1160864319 19:1250340-1250362 CAGCTCGCAGGCGCCGCCGGGGG - Exonic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161583022 19:5090994-5091016 CAGCAGGCAGGCTTTGTAGTGGG + Intronic
1162910575 19:13845949-13845971 CAGTGCACAGGCTTTGCGGTAGG + Intergenic
1166768455 19:45266105-45266127 CAGATCTCAGGCTGTGCCTTGGG + Intronic
925406872 2:3611655-3611677 CAGCCCACAGGCTTTTCAGTAGG + Intronic
929922257 2:46180984-46181006 CATCTCTCAGGCTCTGCAGTGGG + Intronic
935657950 2:105441021-105441043 CAGCCTGCAGGCTCTGCCCTGGG - Intergenic
940385342 2:153064783-153064805 TAACTCCCAGGCTTTTCCGTGGG + Intergenic
948053128 2:234993011-234993033 CACCTGGCAGGCTTTGGAGTAGG + Intronic
1170677684 20:18497333-18497355 AAGCTCGCAGGCTTTGTTCTTGG - Intergenic
1174509915 20:51043163-51043185 CAGATCTCAGGGTTTGCCTTGGG - Intergenic
1178351255 21:31874094-31874116 CATCTCGCAGCCTTTCCCGAAGG + Intronic
1180214951 21:46317956-46317978 CAACTCGCAGGCTGTGGCGTTGG - Intronic
1180827242 22:18872842-18872864 CAGCTCGTTGGCGATGCCGTGGG + Intergenic
1181195801 22:21184342-21184364 CAGCTCGTTGGCGATGCCGTGGG - Intergenic
1181213728 22:21308782-21308804 CAGCTCGTTGGCGATGCCGTGGG + Intergenic
1183041599 22:35183292-35183314 AAGCTTGGAGGCTTTGCTGTTGG - Intergenic
1185003314 22:48259921-48259943 CAGCACCCAGGCTTGTCCGTGGG + Intergenic
1185044726 22:48523242-48523264 GTGCTCCCTGGCTTTGCCGTGGG + Intronic
1185204789 22:49531689-49531711 CAGCTCGGAGGCTGTGCGGCTGG - Intronic
1203231000 22_KI270731v1_random:110499-110521 CAGCTCGTTGGCGATGCCGTGGG + Intergenic
955076308 3:55616998-55617020 CAGCCTGCAGGCTTTGCCGATGG + Intronic
960915220 3:122688151-122688173 CAGCTCCCAGTGTTTGTCGTTGG + Intronic
968509732 4:990286-990308 CTGCTCGATGGCTTTGCCATGGG - Exonic
968976511 4:3824895-3824917 GAGCTAGCAGGCTTTGCTGATGG - Intergenic
969247626 4:5945755-5945777 CAGCTGGCAGGCTGGGCCCTGGG + Intronic
969291406 4:6242411-6242433 CAGCAAGCAGGCTTTGTCCTTGG + Intergenic
969613875 4:8241312-8241334 CTGCTCGGAGCTTTTGCCGTAGG + Intronic
975523652 4:75326689-75326711 CAACTCTCAGGCTGTGCCTTGGG - Intergenic
985421033 4:189785418-189785440 CTGCTGGCAGGCTCTGCGGTGGG - Intergenic
986410690 5:7475752-7475774 CAGCTCCCAGGCTTTGGAGGAGG + Intronic
994078974 5:95685082-95685104 CACTTACCAGGCTTTGCCGTGGG + Intronic
994404911 5:99333269-99333291 CTGCTAGCAGGCTTTGCTTTTGG - Intergenic
1001130450 5:169059405-169059427 CACCTGGCAGGCTGTGCTGTAGG - Intronic
1002184734 5:177448852-177448874 CAGCTTGCAGTCTTGGCTGTGGG + Intronic
1007975834 6:46100405-46100427 CAGCTCCCTGACTTTGCCCTGGG + Intergenic
1014039306 6:116806437-116806459 CAGCTTGCAGTGTTTGCCCTTGG - Exonic
1017440225 6:154457992-154458014 CAGCTGGCAGGATTTGGCCTGGG - Intronic
1019707067 7:2501996-2502018 CAGCTCCCTGGCTGGGCCGTGGG + Intergenic
1024215616 7:47245925-47245947 CAGCTGACAGGGTGTGCCGTTGG + Intergenic
1024678612 7:51660705-51660727 CCGCTGGCAGTCTTTGGCGTTGG + Intergenic
1024695108 7:51847836-51847858 CAGCTCCAAGCCTTTGCAGTAGG + Intergenic
1027593727 7:80146273-80146295 AAGCTTGCAGGCTCTGCCATGGG + Intronic
1037647329 8:20804465-20804487 GAGCTCTCAGGACTTGCCGTAGG + Intergenic
1038192899 8:25339992-25340014 GAGCTCGTAGGATTTGCTGTTGG + Intronic
1056738767 9:89234701-89234723 CAGCCCGCAGGGTTTACCCTTGG - Intergenic
1058661998 9:107275061-107275083 CAGCTGACAGGCTTTGCTGATGG - Intergenic
1060543658 9:124448199-124448221 CAGCCTGCAGGCTTTGTCCTTGG + Intergenic
1061420744 9:130471866-130471888 CAGCTCCCAGGCTGTGCTGCTGG + Intronic
1061921381 9:133784325-133784347 CATTTTGCAGGCTTTGCAGTTGG + Exonic
1188034850 X:25305920-25305942 CAGCTGGCAGTCTTTGCTATAGG + Intergenic
1193162223 X:78240863-78240885 GAGCTCTCATGCTATGCCGTTGG - Intergenic
1195793629 X:108619427-108619449 CAGCTGGTAGGCTTTGGAGTGGG + Intronic