ID: 1122198320

View in Genome Browser
Species Human (GRCh38)
Location 14:100106577-100106599
Sequence TCTCCTTTGCAGTACATGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122198319_1122198320 27 Left 1122198319 14:100106527-100106549 CCTTTATGTGTTGTAATGCACAT 0: 1
1: 0
2: 1
3: 16
4: 192
Right 1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG 0: 1
1: 0
2: 1
3: 27
4: 171
1122198318_1122198320 28 Left 1122198318 14:100106526-100106548 CCCTTTATGTGTTGTAATGCACA 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG 0: 1
1: 0
2: 1
3: 27
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122198320 Original CRISPR TCTCCTTTGCAGTACATGTA AGG Intronic
905154545 1:35964428-35964450 TGTACTCTGCAGAACATGTATGG - Intronic
906020290 1:42622240-42622262 TGTCATTTGCAATACATGGATGG - Intronic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907875893 1:58488205-58488227 TCTCTTTTGCTTTACATGTGCGG + Intronic
908249371 1:62253025-62253047 TCTCCTCTTCAGTAAATGCAGGG - Intronic
909893515 1:81037042-81037064 TCTTAATAGCAGTACATGTAGGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913416653 1:118616734-118616756 TCTCTTTAGCATTTCATGTAGGG + Intergenic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
917696316 1:177527876-177527898 GCTCCTTTGAAGTGCATGTTAGG + Intergenic
917721244 1:177788639-177788661 TCTTTTTTCCAGTACATTTATGG + Intergenic
919204586 1:194405750-194405772 TGTTCTTTGCAGGACATGGATGG + Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
922337566 1:224630288-224630310 GCTCCTCTGCAGCACAGGTAAGG - Intronic
922595898 1:226812638-226812660 TCTTCTTTGCAGTACCTGCTAGG + Intergenic
1063146974 10:3304045-3304067 CCTCCTTTGCATTTCAAGTAAGG - Intergenic
1063539422 10:6917462-6917484 TCTCCTTTGCAGTGAAATTAGGG - Intergenic
1064238526 10:13601920-13601942 TCACCTTAGCACTGCATGTAAGG - Intronic
1066283308 10:33939642-33939664 TCTACTTTACATTACATGTTTGG - Intergenic
1068032059 10:51716653-51716675 CCTCCTTTGAAGTGAATGTAGGG + Intronic
1070739857 10:78895667-78895689 TCTCATTTGCAGGACAAGAAGGG - Intergenic
1071951152 10:90703707-90703729 TCTTCTTTGCTGTAGATATAGGG - Intergenic
1072614521 10:97040453-97040475 TCTCCTTAACAGTACAGTTAGGG + Intronic
1073952948 10:108831848-108831870 TGTCCTTTCCAGGACATGGATGG + Intergenic
1074534713 10:114320533-114320555 TCTCCTTGGCAGGACAGGCAGGG + Intronic
1074594671 10:114850775-114850797 TCTACTATGCAGAATATGTAAGG - Intronic
1075036846 10:119076613-119076635 TCTCCTATATAGTGCATGTAAGG + Intronic
1075187598 10:120277033-120277055 TGTCCTTTGAAGGACATGGATGG + Intergenic
1078517753 11:12039156-12039178 TGTCCTTTGCAGCACATGGATGG + Intergenic
1078941470 11:16011250-16011272 GCTCCTATGTAGGACATGTAAGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079868929 11:25771055-25771077 TCTCCTTAGCACTCCATCTAAGG - Intergenic
1081402831 11:42662464-42662486 TCTCCTTTGAAGTGCATGGTGGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1086530457 11:87778686-87778708 GCCCCTTTGCAGCACATGAAAGG - Intergenic
1087585311 11:100112035-100112057 TATCCTTTCCAGCACATGGAGGG + Intronic
1089004738 11:115082007-115082029 GCTCCTTTGCACTCCATGCAGGG - Intergenic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1091371425 11:135063005-135063027 GTTCCTTTGCTGTATATGTAGGG - Intergenic
1093446215 12:19262142-19262164 TCTCTTTTTCAGTATATTTATGG + Intronic
1094677868 12:32638763-32638785 CCTCTTGTGCTGTACATGTATGG + Exonic
1095204426 12:39423327-39423349 TATTCTTTGAAGCACATGTAAGG + Intronic
1097905285 12:64913205-64913227 TCTCCTTTGTATTACAGTTAAGG - Intergenic
1098845925 12:75535703-75535725 TCTTCTTGTCAGTAAATGTAGGG - Intergenic
1099166909 12:79318059-79318081 TTCCCATTGCAGTACATTTAGGG - Intronic
1102806916 12:115790120-115790142 TGTCATTTGCAGAACATGGATGG - Intergenic
1104449304 12:128856117-128856139 TCCCCTTTCCAGAACATATAGGG + Intronic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1104827594 12:131724703-131724725 ACTCCTTAGCAGCACATGAAGGG + Intronic
1106553287 13:30789544-30789566 ACTCCGGTGCAGTTCATGTAGGG + Intergenic
1108266240 13:48711808-48711830 CCTCATTTGCAGTACATATGTGG - Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1116035544 14:39622798-39622820 TGTCCTTGGCAGGACATGGATGG - Intergenic
1117585049 14:57192840-57192862 TCTCCTTTGCTCTCCATGGAAGG - Intergenic
1118281448 14:64432719-64432741 TCTCCTTTGCTGTTCCTTTATGG - Intronic
1119578512 14:75751978-75752000 TCTCCTTTTTAGACCATGTAGGG + Intronic
1122198320 14:100106577-100106599 TCTCCTTTGCAGTACATGTAAGG + Intronic
1125260044 15:37813132-37813154 TCTACATTCCAGTGCATGTAAGG + Intergenic
1126571130 15:50152431-50152453 TCTCCTTTCAATTACATTTATGG - Intronic
1128499197 15:68215462-68215484 TCTCCATGTCAGTACATATAAGG - Intronic
1132245293 15:100291679-100291701 TGTCCTCTGCAGCACATGGATGG + Intronic
1133281532 16:4668253-4668275 TCTCCCCTGCAGCACATGGACGG + Exonic
1134371774 16:13632673-13632695 TCTCCTTTGAAGACCATATAGGG + Intergenic
1136061594 16:27730423-27730445 TCTCATTTGCAGTACTTGTCTGG + Intronic
1138405042 16:56785407-56785429 TCTCCTTTCTGGTACTTGTAGGG + Intronic
1139494536 16:67306719-67306741 TCTCCTTTGCATTGCACATAGGG + Intronic
1141023292 16:80518886-80518908 TCTCCTTTATACTACATTTAGGG + Intergenic
1141419860 16:83906975-83906997 TCTCCTTTTCAGGAAATGAATGG + Exonic
1143234469 17:5387250-5387272 TCTCCTCTGAAGTATATGTTGGG - Intronic
1143358422 17:6348107-6348129 TCAGCTTTGCAAGACATGTAGGG - Intergenic
1144467465 17:15507936-15507958 ACTCCTTTCGAGTTCATGTAAGG + Intronic
1145939650 17:28736077-28736099 TGTCCTTTGTAGGACATGGATGG - Intronic
1146694801 17:34900329-34900351 TCTCTTTTCTAGTACATTTATGG - Intergenic
1150144372 17:62755375-62755397 TCTCCTTTCCAGGACACGAAGGG - Intronic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1153474841 18:5488260-5488282 TGTCCTTTTCAGGACATGGATGG + Intronic
1153779241 18:8479482-8479504 TCTCCTTTGCACCACATGCAGGG + Intergenic
1158075820 18:53527717-53527739 TCTCCTTTACAGTGCATTTTCGG - Intronic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1161243569 19:3236325-3236347 TGTCCTTTTCAGTGCATGTGTGG + Intronic
1161814753 19:6493234-6493256 TCCCCTTTTTAGAACATGTAGGG - Intergenic
1161846875 19:6716770-6716792 TCTCATTTGCAGGACATGGCAGG + Intronic
1163681794 19:18686932-18686954 CATCCTGTGCACTACATGTAGGG - Intronic
1166901073 19:46063504-46063526 TCTCTTTTAAAGTGCATGTAGGG - Intronic
1167003750 19:46761812-46761834 TCTCCTTTTTATTACATTTAGGG + Intronic
926347129 2:11957636-11957658 GCTCCTTTGCAGCACAGGTCAGG - Intergenic
927325818 2:21803730-21803752 TCTCCTGTGCAGTATAAATAGGG + Intergenic
928494932 2:31821936-31821958 TGTTATTTGCAGAACATGTATGG - Intergenic
929987808 2:46753790-46753812 TCCCCTTTTCAGACCATGTAAGG + Intronic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931502148 2:62881080-62881102 TGTTCTTTGCAGCACATGGATGG + Intronic
932647463 2:73518268-73518290 TGTCTTTTGCAGAACATGGATGG - Intronic
932977293 2:76618693-76618715 TGTCATTTGCAGTACATGGGTGG - Intergenic
936856723 2:116967046-116967068 TCTCCTTTCCTCTACATATAGGG - Intergenic
937735966 2:125289750-125289772 TGTCCTTTGCGGGACATGGATGG - Intergenic
938624000 2:133088725-133088747 TCTCCTTTGTATTACAGTTAGGG - Intronic
940974137 2:159924665-159924687 TTTCCTTAGCAGTACTTGCATGG - Intergenic
944922814 2:204433325-204433347 TCTCCCTTGCAGCCCATGTGGGG + Intergenic
946110099 2:217407569-217407591 TATCCTTGGAAATACATGTAGGG + Intronic
948074329 2:235154153-235154175 TCTCCATTGCTGTAGATGTTGGG - Intergenic
1170743213 20:19075762-19075784 TCTCCTTTGCAATGCCTGGAAGG + Intergenic
1173890785 20:46508355-46508377 TCTTCTTTGCATTACATGTAGGG - Intronic
1174031666 20:47633290-47633312 ACTCCTTAGCAGAACATGTAGGG + Intronic
1175058202 20:56217429-56217451 TCTCCTTTTTAGACCATGTAGGG - Intergenic
1179106724 21:38407239-38407261 TCTCTTTTGCTGGACATTTAGGG - Intronic
1182557856 22:31138718-31138740 TCACCCTTGCAGTACAACTATGG - Exonic
1182839394 22:33374728-33374750 TCTTCTTTGCATTACATTTATGG + Intronic
949822095 3:8126500-8126522 TCTCTTTTGCAGCACAAGGAAGG + Intergenic
951656457 3:25014349-25014371 TCTACTTTGAACCACATGTAAGG + Intergenic
959366661 3:105468583-105468605 CCTGGTTGGCAGTACATGTAAGG + Intronic
959773740 3:110132074-110132096 TGTCCTTTGCAGGACATAGATGG + Intergenic
959871654 3:111335650-111335672 CCTCCTTTGCAGTTAATTTAGGG + Intronic
960026383 3:113015556-113015578 TGTTCTGTGGAGTACATGTAGGG - Intronic
960175350 3:114511184-114511206 TATCTTATGCAGTAAATGTAAGG + Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
965295383 3:166938716-166938738 TGTTTTTTGCAGAACATGTATGG - Intergenic
965993851 3:174854218-174854240 TATCTTTTGCAGTACATGGATGG + Intronic
966654800 3:182343833-182343855 TGTTCTTTGCAGCACATGGATGG - Intergenic
967787605 3:193514384-193514406 TGTCCTTTTCAGGACATGGATGG - Intronic
970789190 4:19836393-19836415 TCTCCATTGTTATACATGTAAGG + Intergenic
971620199 4:28845786-28845808 TGTTCTTTGCAGGACATGGATGG - Intergenic
972204672 4:36757822-36757844 TCTCCTTTTCAGACCATATAGGG + Intergenic
972273717 4:37537245-37537267 TTCCTTTTGCATTACATGTATGG + Intronic
973588247 4:52413676-52413698 TCTCCTTTGCCACACATGTATGG - Intergenic
973681235 4:53322397-53322419 TCTCCTTTGTAGACCATATAGGG - Intronic
974495436 4:62620198-62620220 TCTCCTTGGCAGAACATAGAAGG + Intergenic
976518989 4:86004766-86004788 TATCCTTTGGAGAACATTTAAGG + Intergenic
977520153 4:98072248-98072270 TGTCCTTTGCGGGACATGAATGG + Intronic
980282758 4:130741797-130741819 TATCCTTTGGAGAACATGGATGG - Intergenic
980987682 4:139711486-139711508 TCTCCTTTTTAGAACATATAGGG + Intronic
983904778 4:173170574-173170596 TTTCCTTTTCAGTACATTTGCGG + Intronic
986700059 5:10397963-10397985 TCTCCTTTCCAGAAGAGGTAAGG + Intronic
990636659 5:57735626-57735648 TCTCCTTTTTAGAACATATAGGG - Intergenic
991463167 5:66880707-66880729 TCTCCTTAGAATTACTTGTATGG - Intronic
992440388 5:76792979-76793001 TCTCCTTTTTAGACCATGTAGGG + Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993247684 5:85471655-85471677 TGTCCTTTGCAAAACATGGATGG + Intergenic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
995059044 5:107794179-107794201 TGTCCTTTGCAAAACATGGATGG + Intergenic
995357641 5:111257835-111257857 TGTCCTTCGCAGGACATGGATGG + Intronic
995377153 5:111487912-111487934 TCTCCTCTGAAGTAAATGAATGG - Exonic
995621904 5:114034868-114034890 TGTTCTTTGCAGAACATGGATGG - Intergenic
996219331 5:120910407-120910429 TCTGCTTTGAAGAACATGAAGGG + Intergenic
997785989 5:136714456-136714478 TGTCCTTTGCAGAAAATGGATGG - Intergenic
998046909 5:138995012-138995034 TGTCCTTTGCAGGACATGAATGG - Intronic
998209129 5:140180700-140180722 TCTCCTTTGCTTTAGATGTGAGG - Intronic
998604717 5:143621948-143621970 TGTCTTTTGCAGAACATGGATGG + Intergenic
1000189600 5:158897255-158897277 TGTCCTTTGCGGGACATGGATGG + Intronic
1000588463 5:163129143-163129165 TGTCCTTTGCAGAACATGGATGG + Intergenic
1001448862 5:171808654-171808676 TGTCCTTTGCAGAACGTGGATGG + Intergenic
1002210386 5:177595507-177595529 TCTCCCTTCCAGAACAGGTATGG - Exonic
1002589009 5:180275318-180275340 TCTCATTTGCTGAACTTGTATGG - Intronic
1003455032 6:6274321-6274343 CCTCTTTTGGAGTAAATGTAAGG + Intronic
1003945080 6:11067730-11067752 TCTCCTTTCTAGTACTTGGAGGG + Intergenic
1005797603 6:29383242-29383264 TCTCCATTGCAGGACATTTGGGG - Intronic
1005919240 6:30384100-30384122 TGTCCTTTGCGGAACATGGATGG - Intergenic
1008208558 6:48692786-48692808 TGTCCTTTGCAGGACATAGATGG + Intergenic
1010464094 6:76146560-76146582 TCTCCTTTGTATTGCATATATGG + Intergenic
1010802081 6:80188165-80188187 TGTCCTTTGCAGGACATATCTGG + Intronic
1011048777 6:83118925-83118947 CCTCCTTAGCACTACATGAAGGG - Exonic
1012005113 6:93704112-93704134 TCTGCTGTGCACTACATGCAGGG + Intergenic
1013466215 6:110419155-110419177 TCACCTCTGCAGCACATTTAGGG + Intergenic
1014375300 6:120664774-120664796 TGTCCTTTGCAGGGCATGGATGG - Intergenic
1017180599 6:151548169-151548191 TGACCTTTCCAGTCCATGTAGGG + Intronic
1019098427 6:169607465-169607487 TGTCTTTTGCAGCACATGGATGG + Intronic
1020101543 7:5396948-5396970 TCTTCTTTGGGGTACATGTGGGG + Intronic
1020563800 7:9770759-9770781 TCTCCTTTGAGTTACATGCATGG + Intergenic
1022663177 7:32385613-32385635 TCTCCTTTACAGTGCATTTGAGG + Intergenic
1025719460 7:63996831-63996853 TCTCCTTTTTAGACCATGTAAGG + Intergenic
1026250363 7:68664666-68664688 TCTTCTTTGCACCACATGTTTGG - Intergenic
1029676194 7:102070696-102070718 TCTTCTCTGCAGTACGTGCAGGG - Intronic
1031280466 7:119794075-119794097 TCTCTTTAGCATTACTTGTAGGG + Intergenic
1035379471 7:158428413-158428435 TCTCCTTTGCAGTTTCTGTGCGG - Intronic
1035557905 8:580130-580152 TCTCCTTTGCAGTAACTTTGAGG + Intergenic
1036061806 8:5331078-5331100 TCTCCTTAACAGTTCTTGTATGG + Intergenic
1037194353 8:16169760-16169782 ACTCCATTGTAGTATATGTATGG + Intronic
1038298543 8:26320135-26320157 TATCCTGTACAGCACATGTAAGG - Intronic
1040627780 8:49171350-49171372 TCTCCTTTGAATTTCTTGTAGGG + Intergenic
1041572043 8:59348747-59348769 TGTCCTTTGCAGAACATGGATGG + Intergenic
1048109350 8:131450838-131450860 TGTCTTTTGCAGGACATGGATGG - Intergenic
1050069782 9:1798553-1798575 ACACCTTTGCAGTGCATGTGAGG - Intergenic
1050786815 9:9413732-9413754 TCTCCTGTGCTTTACAAGTAAGG - Intronic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1052618782 9:30878104-30878126 TGTCCTTTGCAGAACATGGATGG - Intergenic
1055449074 9:76414635-76414657 TCGCCTTTTTAGAACATGTAGGG + Intergenic
1057983328 9:99684042-99684064 TCACCATTGCATTTCATGTAAGG + Intergenic
1058228045 9:102391221-102391243 TCTCTTTTCCAGAACATGTCTGG + Intergenic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1187640241 X:21279763-21279785 TGTCTTTTGCAGGACATGAATGG - Intergenic
1189926742 X:45962709-45962731 TGTACTTTGCAGCACATGCATGG + Intergenic
1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG + Intergenic
1193641808 X:84018453-84018475 ACTCCTTTTCAGTTCATATAAGG - Intergenic
1193667186 X:84335503-84335525 TCTCCTTTGCAGCAGATATTTGG - Intronic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1196486568 X:116217303-116217325 TGTCTTTTGCAGAACATGGATGG + Intergenic
1198998341 X:142602866-142602888 TGTCCTTTGCAGAACATGGATGG - Intergenic
1199318918 X:146415331-146415353 TTTCTTTTGGGGTACATGTAGGG - Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic