ID: 1122203296

View in Genome Browser
Species Human (GRCh38)
Location 14:100135684-100135706
Sequence CTGGGGAAGGGGAAGGCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 532}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122203296_1122203301 -10 Left 1122203296 14:100135684-100135706 CCTGTAGCCTTCCCCTTCCCCAG 0: 1
1: 0
2: 7
3: 57
4: 532
Right 1122203301 14:100135697-100135719 CCTTCCCCAGCTTTGTCCACTGG 0: 1
1: 0
2: 0
3: 28
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122203296 Original CRISPR CTGGGGAAGGGGAAGGCTAC AGG (reversed) Intronic
900135543 1:1115668-1115690 CTGGGGAGGGGAAAGGTTCCCGG - Intronic
900190871 1:1351706-1351728 CTGGGGAAGAGAAGGGCTGCGGG - Intergenic
900491452 1:2951279-2951301 CTGGGGAGGGGCCGGGCTACAGG + Intergenic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
901238607 1:7680373-7680395 CTGGGGAAGGGGTGGGCGCCAGG + Intronic
902385155 1:16072222-16072244 CTGGGGAAGGGGAAGGTACAGGG - Intronic
902640554 1:17763704-17763726 CTAGGGCAGGGGAAGGCTTATGG + Intronic
902790628 1:18765442-18765464 CTGGGAAAGGGGTAGGGTGCAGG + Intergenic
902841810 1:19079303-19079325 CTGGGGCAGAGGGAGGCCACAGG - Intronic
903556205 1:24195476-24195498 CTGGGGAAAGGGAGGGGTATGGG + Intergenic
903561986 1:24235059-24235081 CTGGAGATGGGGCATGCTACCGG + Intergenic
903594181 1:24481382-24481404 CTGGGGAAAGGAAAGCCTCCAGG - Intergenic
904379453 1:30101252-30101274 CTGGGGAGGGGCATGGCTCCGGG + Intergenic
904551038 1:31318325-31318347 TGGGGGATGGGGTAGGCTACAGG + Intronic
905509946 1:38511278-38511300 CCGGGGATGGGGAAGGTTGCAGG + Intergenic
905709584 1:40089834-40089856 CTGGGGGAGGGGAAGGAAATGGG - Intronic
906382276 1:45340346-45340368 CTGGGAGAGGGGAAGGCCTCGGG + Exonic
906527073 1:46500170-46500192 CTGGGGAGGGGGAGGGCATCAGG + Intergenic
906779467 1:48559761-48559783 CTGGGAAAGGGGAATGGTATAGG - Intronic
907286040 1:53380346-53380368 CTGGGGAATGGGGAGGCAAATGG + Intergenic
907459731 1:54598280-54598302 TTGGGTAAGGGGAGGGCTTCTGG + Intronic
907573683 1:55506819-55506841 CTGAGGAAGGAGGAGGCTTCTGG - Intergenic
909784414 1:79593216-79593238 CTGGAGAAGGGGGATACTACTGG - Intergenic
911747332 1:101454135-101454157 ATAGGGAAGGGGAAGCCTACAGG - Intergenic
911897261 1:103452388-103452410 CTGGTGGAGGGGAAGGTTCCTGG - Intergenic
912720245 1:112013974-112013996 TGGGGGATGGGGAAGGCTGCAGG - Intergenic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
912966300 1:114240122-114240144 CTGGGGAAGGGGGTGGCTGTGGG + Intergenic
913665979 1:121049225-121049247 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914017377 1:143832501-143832523 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914655988 1:149741033-149741055 CTGAGGAAAGGGAAGGCTTCAGG - Intergenic
914750494 1:150531839-150531861 CTGAGGAAAGTGAAGGCTTCAGG - Intergenic
915004416 1:152623246-152623268 CTGGGGAAGGGGAATGCAAACGG + Intergenic
915213024 1:154324220-154324242 CTTGGAGAGGGGAAGGCTAAGGG + Intronic
915365262 1:155311589-155311611 GTGGGGATGGGGAAGGAAACTGG + Intronic
915543411 1:156582656-156582678 GTGGGCAGGGGGAAGGGTACTGG + Intronic
915568705 1:156732094-156732116 CTGGGGAAGGGGAGGTCGTCAGG + Exonic
916091408 1:161310177-161310199 CTGGGGCAGGGGGAGGCCAGTGG - Intergenic
916723616 1:167503790-167503812 CTGGAGGAGGGGTAGGCTACCGG + Intronic
918131745 1:181635449-181635471 CTGGGGAAGGAGAAAGCTTGAGG - Intronic
919090748 1:192976685-192976707 CTGGGGAAGGGGAATGTCAAAGG - Intergenic
919700776 1:200628980-200629002 GTGGGGAAGAGGAAGGTGACTGG + Intronic
919727443 1:200893538-200893560 CTGGGGAAGGGCAGGGCTGCAGG + Intronic
919778302 1:201207901-201207923 CTGAGGAAGGGGGTGGGTACAGG + Exonic
920279129 1:204829699-204829721 ATGGGGAAGGGGCAGGGTCCAGG + Intronic
921100268 1:211922780-211922802 CTTGGGAAGGGGCAGGCTTGGGG - Intergenic
921986188 1:221315533-221315555 CTGGGGGAAGGGAAGGACACTGG + Intergenic
922035838 1:221846935-221846957 CTGGGAGAGGGGAGGGCTATGGG + Intergenic
923081350 1:230658647-230658669 CTGGGGGAAGGGATGGCTGCGGG - Intronic
923248409 1:232156415-232156437 CTGGGGAATGGGAGGACTAGGGG + Intergenic
924169728 1:241326058-241326080 CTGGGGAAGCTGAAAGCCACTGG - Intronic
924589912 1:245393925-245393947 CTGGGGGAGGGGAAGGGGTCAGG + Intronic
924821754 1:247498751-247498773 CTGGGCAGGGGGACGGCTTCAGG + Intergenic
1062838268 10:650498-650520 CTGGGGCAGGGGAAGAGTATAGG - Intronic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1063403944 10:5774886-5774908 CAGGGGAAGGGGAAGGGCAAGGG + Intronic
1064080157 10:12301891-12301913 CTGGGCAAGGAGCAGGTTACAGG + Intergenic
1065151983 10:22831466-22831488 CCAGGGAAGGGGAAGGCTGGGGG + Intergenic
1065570801 10:27069550-27069572 CTTGGGAAGGCGAAGGCTGGTGG - Intronic
1066000908 10:31103347-31103369 CGGGGGAAGGTGAAGCCTGCAGG + Intergenic
1066107037 10:32165356-32165378 TTGGGGAAAGGGAGGGCTAGAGG - Intergenic
1066178692 10:32938795-32938817 CAGGGAAAGGGAAAGGCTAGAGG + Intronic
1066494245 10:35926680-35926702 CTGGGGGAAGGGAAGTCTAGTGG - Intergenic
1066746456 10:38606480-38606502 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1067145087 10:43688889-43688911 CTGGGAAAGGGGGAGGTTGCTGG + Intergenic
1068065545 10:52126181-52126203 GTGGGGCAGGGGAGGGCTACTGG + Intronic
1068783301 10:60944215-60944237 CAGGCGAAGGGGAGGGCTGCGGG - Exonic
1069605333 10:69735417-69735439 CTGTGGAAGGGGCTGGCTGCTGG - Intergenic
1069818810 10:71215020-71215042 CTGGGCAATGAGAAGGCTGCAGG - Intronic
1069901745 10:71710494-71710516 CTGGTGAGGTGGATGGCTACAGG + Intronic
1069902458 10:71713836-71713858 CTGGTGAGGTGGATGGCTACAGG + Exonic
1070587548 10:77777993-77778015 CTGGGAAAAGGGGAGGCTTCAGG - Intergenic
1070792498 10:79197643-79197665 CTGGGGAGGGGACAGGGTACAGG - Intronic
1071294841 10:84211920-84211942 CTGGGGAGGGGGCAGGCCATAGG + Intronic
1071754950 10:88527240-88527262 CTGGGGATGGGGAAGGTTGCTGG - Intronic
1071804452 10:89102026-89102048 CTGGGAATCTGGAAGGCTACCGG - Intergenic
1071809317 10:89161374-89161396 CTGGGGAATAGGAAGGATAGAGG - Intergenic
1072463410 10:95641057-95641079 CTGGGGAAGGGACAGGCTCTAGG - Intronic
1073288435 10:102401927-102401949 CTGGGGAGGGGGCAGGGCACAGG - Intronic
1073435322 10:103512738-103512760 GTGGGAAAGGGGAGGGCTTCAGG + Intronic
1073849440 10:107597630-107597652 CTGGGGAATGGGCAGTTTACGGG - Intergenic
1074853122 10:117454550-117454572 CTGGGGAAGGGGATGGCTGTGGG + Intergenic
1075064138 10:119278185-119278207 CTCGGGAAGGGAGAGGCCACAGG - Intronic
1075212610 10:120503689-120503711 CTGGGGAAGGGGAAAGAGACAGG - Intronic
1075724822 10:124605850-124605872 AGGGGGAAGGGGAAGGGAACAGG + Intronic
1075984291 10:126770275-126770297 CTGGGGAAGAGGAAGGAGCCAGG - Intergenic
1076266060 10:129110699-129110721 CAGGAGAAGAGGAAGGTTACTGG + Intergenic
1076409006 10:130232661-130232683 CTGGGGAAGGGGAAGAGACCGGG + Intergenic
1077145230 11:1041561-1041583 CTGGGGTGGGGGCAGGATACGGG + Intergenic
1077237419 11:1488413-1488435 CTGGGGATGGTGGAGGCTTCGGG + Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077255857 11:1582556-1582578 CTGGGGAAGAGGAATTCTACTGG - Intergenic
1078342158 11:10505408-10505430 CTGGGGATGGGAAAGGCAAAGGG - Intronic
1078415383 11:11160644-11160666 ATGGGGAAGGGGCAGGCCATAGG - Intergenic
1078727721 11:13946548-13946570 TTGGGGAAGGGGGATGCTAATGG - Intergenic
1078814068 11:14801729-14801751 CTGGGGGAAGGGGTGGCTACGGG - Intronic
1079035255 11:17014628-17014650 CTGGGGGCGGGGAAGGCTCGGGG - Intergenic
1079226757 11:18613548-18613570 CTGGGGATGGGGGATGCCACTGG - Intronic
1081197472 11:40178850-40178872 CAGAGGAAGGGAAAGGCTACTGG - Intronic
1081994032 11:47352306-47352328 CTGTGGAAGGTGAAGGCAATGGG + Intronic
1081995070 11:47358958-47358980 CTGGGGACAGGGATGGGTACTGG + Exonic
1082017269 11:47499682-47499704 CTGGGGAAGGGGTAGGGAAAGGG + Intronic
1082986729 11:59175481-59175503 CTGGGGAAGGAGAAGGGCCCAGG - Intronic
1083060670 11:59867524-59867546 CTGGGGGCTGGGAAGGCTAGTGG + Intergenic
1083670833 11:64299266-64299288 CTGGTGAAGGGGCAGGTTCCCGG + Intronic
1083929603 11:65833565-65833587 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1083945477 11:65920486-65920508 GTGGGGAAGGCCAAGGCCACAGG + Intronic
1084018859 11:66404990-66405012 TTGGGAAAGGGGAGCGCTACTGG + Intergenic
1084172331 11:67406604-67406626 CTGGGGAAGGGGCAGGGCACAGG - Intronic
1084397154 11:68919293-68919315 ATGGGGATAGGGAAGGCGACGGG - Intronic
1084960327 11:72713050-72713072 TGGGGGAAGGGGAAGCCTCCCGG + Intronic
1085011202 11:73142535-73142557 CAGGGGAAGGGGGAAGCTAACGG + Intergenic
1085244925 11:75093329-75093351 CTGGGGCTAGGGAAGACTACAGG - Intergenic
1085470172 11:76752644-76752666 CTTGGGGAGGGGAAGGCCAGAGG + Intergenic
1085517386 11:77119416-77119438 ATGAGGAAGGGGAAGATTACTGG + Intronic
1085776536 11:79371625-79371647 CTGGGGAGGGGCATGGCTAGGGG - Intronic
1086521409 11:87672361-87672383 CTGGGGTAGGGGAAAGCTGCAGG - Intergenic
1086651993 11:89303082-89303104 CTGGGGAACCTGAAGACTACTGG - Intergenic
1086750229 11:90484462-90484484 CTGGGGAAGAGGAATGCTCTAGG + Intergenic
1087640265 11:100749072-100749094 CTAGGGAAGGGGAAGGAGAGGGG - Intronic
1087953720 11:104257578-104257600 TTGGGGAGGGGTAAGGCTAGAGG + Intergenic
1088630035 11:111765999-111766021 CCCGGGAAGGGCAAGGCTCCGGG + Intronic
1088691721 11:112334236-112334258 CTTTGGAAGAGGAAGGCTATGGG + Intergenic
1089042244 11:115462952-115462974 CTAGGGAAGGGGATGGTGACTGG + Intronic
1089065441 11:115659122-115659144 CAGGGGGAGGGGAAGGACACAGG + Intergenic
1089156973 11:116410053-116410075 CTGGGGCAGGGCCAGGCCACAGG + Intergenic
1089337504 11:117735135-117735157 TTTGGGAAGGGGGATGCTACGGG - Intronic
1089352344 11:117828725-117828747 CTGAGGAAAGGGCAGGCCACAGG - Intronic
1089681674 11:120122193-120122215 CTGGGGAGGGGGAAGCCTCCGGG - Intronic
1090131316 11:124145384-124145406 CCAGGGAAGGGGAAGGAGACAGG - Intronic
1090185233 11:124734694-124734716 CTGGGTAAGAGGAAGGATACTGG + Intergenic
1090186475 11:124742155-124742177 TTGGGGAAGGGCAGGGCTAGGGG + Intronic
1090469522 11:126967811-126967833 CTGGGGAGGGGGCTTGCTACAGG + Intronic
1091710148 12:2734121-2734143 CAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1091740639 12:2958940-2958962 CCGGGGAAGGGGCGGGCTCCCGG - Intergenic
1092700329 12:11221875-11221897 TTGGGGTATAGGAAGGCTACTGG - Intergenic
1094112155 12:26873509-26873531 ATGGGGAATGGGAAAGATACAGG + Intergenic
1095330611 12:40957337-40957359 CTGGGAGAGGTGAAGGTTACTGG + Intronic
1095930978 12:47624699-47624721 CTGGGGAAAGGGATGGCTGTGGG + Intergenic
1096258683 12:50077869-50077891 CTGGGGTGGGGGAAGTCTATAGG - Intronic
1096695663 12:53346507-53346529 CTGGGGTAGAGGAAGGCTGTGGG + Intergenic
1097200552 12:57274588-57274610 CTGGGGAAGGGCAGTGATACGGG + Intronic
1097735494 12:63177010-63177032 ATGGGGAGGGGGCAGGGTACAGG - Intergenic
1100756678 12:97758918-97758940 GTGGGGAAGGGGAATGATACTGG - Intergenic
1100781092 12:98027378-98027400 CTGGGGTAGGGGGTGGCCACTGG - Intergenic
1100846000 12:98658725-98658747 CTGGTGAAGGGGAATCCTATTGG + Intronic
1100878639 12:98992042-98992064 ATGGGGCAGGGGTAGGTTACAGG + Intronic
1101334755 12:103786479-103786501 CTGGGGAAGGGGAAATCCAGTGG + Intronic
1101845844 12:108362416-108362438 CTGGGGAAGGGCAAGGCCAGAGG + Intergenic
1101910127 12:108855337-108855359 ATGGGGCAGGGGGAGGCTGCAGG + Intronic
1102453403 12:113057197-113057219 CCGGGGGAAGGGAAGGCTCCGGG + Intronic
1102585247 12:113918497-113918519 CTGGTGAAGGGCAAGGATTCGGG - Intronic
1103020272 12:117528432-117528454 ATGGGGAAGGGGGAATCTACTGG - Intronic
1103361920 12:120359613-120359635 CTGGGGGAAGGGAAGGAGACTGG + Intronic
1104585123 12:130042325-130042347 CTGGGGAAGCGCAGGGCTGCGGG + Intergenic
1104756793 12:131274350-131274372 CAGGGGGAGGGGAGGGCTTCAGG - Intergenic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105492486 13:20902457-20902479 CAGGGGAAGGGGACAGCTCCTGG + Intronic
1109182776 13:59233573-59233595 CTGGGGAAGGGGATTTCTAATGG - Intergenic
1109187047 13:59282381-59282403 ATGGACAAGGGGAAGGCTAATGG + Intergenic
1109616546 13:64841379-64841401 CTGGGGAAAGGGAAAGAAACAGG + Intergenic
1109799575 13:67358639-67358661 TTGGGGAAGAGGAGGACTACTGG - Intergenic
1109936443 13:69291692-69291714 TTGGGGGAGGGGGAGGCTTCAGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1114133632 14:19821189-19821211 CCGGGGAAGTGGAAGGGTTCAGG - Intronic
1115243246 14:31270119-31270141 ATGGGGAAGGGGAGGGCCATAGG - Intergenic
1115264582 14:31487787-31487809 CTGGCGCAGGGGAAGGCCACAGG + Intronic
1115813269 14:37133686-37133708 CTGGAGGAGGGGAAGGAGACAGG - Intronic
1117409510 14:55438557-55438579 ATGGGGAAGGGGAAGGGGAAGGG - Intronic
1118277200 14:64395696-64395718 ATGGGGAAGGGGTATGCTATTGG + Intronic
1119435254 14:74594330-74594352 CTGAGGAAGGGAGAGGCTAAAGG - Intronic
1119475633 14:74926006-74926028 ATGGGGATGGGAAAGGCTTCAGG - Intergenic
1121055678 14:90850165-90850187 CTGGGGAAGGAGAAGCTGACGGG - Exonic
1121431461 14:93891246-93891268 CGGGGGAGGGGGAAGCCTGCAGG - Intergenic
1122060522 14:99133963-99133985 CCGGGGCAAGGGAAGACTACCGG - Intergenic
1122143586 14:99676174-99676196 GTGGGGAAGGGAAAGCCTTCTGG + Exonic
1122199348 14:100113052-100113074 GTGGTGAAGGGGAGAGCTACTGG + Intronic
1122203296 14:100135684-100135706 CTGGGGAAGGGGAAGGCTACAGG - Intronic
1122451706 14:101813846-101813868 CTTGGGAAGTGGAAGTCTAATGG + Intronic
1122899184 14:104775125-104775147 CTGGTGAAGGAGAAGGCCACAGG - Exonic
1123063601 14:105605451-105605473 CTGGGAAAGGGAGAGGGTACTGG + Intergenic
1124107513 15:26753832-26753854 CTGGGGCGAGGGCAGGCTACAGG + Intronic
1124486221 15:30119588-30119610 CTGGGGAAGGGAAAGGAAAGGGG - Intergenic
1124541295 15:30588573-30588595 CTGGGGAAGGGAAAGGAAAGGGG - Intergenic
1124757363 15:32419014-32419036 CTGGGGAAGGGAAAGGAAAGGGG + Intergenic
1125522295 15:40354970-40354992 GTGGGGAAGAGGCAGGCTCCAGG - Intronic
1126669579 15:51104081-51104103 CTGGGGAACTGGGAGGCTGCTGG - Intronic
1127228884 15:56967122-56967144 GTGGGGGAGGGGAAGGGCACGGG - Intronic
1127827244 15:62715529-62715551 CTGAAGCAGGGGAAGGCTAATGG - Intronic
1128346336 15:66854744-66854766 CTGGGGAAGGGGGAGGGGCCAGG + Intergenic
1128461332 15:67869981-67870003 ATGGGGGAGGGGCAGGCCACAGG + Intergenic
1128634083 15:69291783-69291805 GTGGGGAAGGGGTCAGCTACGGG + Intergenic
1128755714 15:70182401-70182423 CAGGGGAAGGGGATGGCTCAAGG - Intergenic
1128792540 15:70443692-70443714 CTGGGGGAGGGGAAGAGTGCAGG - Intergenic
1129069352 15:72937920-72937942 CTGTGGAAGAGGAAGGATGCTGG + Intergenic
1129424297 15:75453310-75453332 CTGGGGCAGGGCTTGGCTACTGG - Intronic
1129977104 15:79831539-79831561 CAGGGGAAGGGGAGGACTCCTGG - Intergenic
1130090539 15:80817166-80817188 CTGGGGATGCGGAAGGCTGTGGG + Intronic
1131159518 15:90095757-90095779 ATGTGGAAGGGGAAACCTACAGG + Intronic
1131990498 15:98088644-98088666 CTGGGGGAGGGGAAGGGGCCGGG - Intergenic
1132099646 15:99014653-99014675 CTGGGGGAGGGGAAGGGGCCGGG + Intergenic
1132221385 15:100108085-100108107 CTGGGGAGGGTAAGGGCTACAGG + Intronic
1132753728 16:1471701-1471723 CTGGGCAACAGGGAGGCTACAGG + Intronic
1133210392 16:4260404-4260426 CTGGGGACCGGGAAGGGGACAGG - Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133621596 16:7531895-7531917 CTGGGGAAGGGGATGGGTTAGGG - Intronic
1134149443 16:11794879-11794901 CTGGGGAATGGGAAGGAAAGAGG + Intronic
1134480525 16:14614981-14615003 CCGGGGATGGAGAAGGCTACAGG + Intronic
1135299753 16:21315318-21315340 ATGGGGATTGGGAAAGCTACTGG + Intergenic
1135856878 16:26019908-26019930 CTGGGGATGGGGTAGGCAGCTGG - Intronic
1136178412 16:28534306-28534328 CAAGGGAAGGGGATGGATACAGG + Intronic
1136235793 16:28912870-28912892 CTGAGGAACAGGAAGGCCACCGG - Intronic
1136736605 16:32473162-32473184 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
1137673883 16:50294323-50294345 ATGGGAAAGGGGAAGGCTCCGGG + Intronic
1138279051 16:55759091-55759113 CTGGGGAAGGGGAAAGAGACGGG - Intergenic
1138289489 16:55834590-55834612 CTGGGGAAGGGGAAAGAGACGGG + Intergenic
1138724346 16:59119666-59119688 CCTGGGAAGGTGAAGGCTAGAGG - Intergenic
1139356812 16:66371630-66371652 GTGGGGCAGAGGAAGGCTCCAGG - Intronic
1139398720 16:66662650-66662672 CAGGGGAAGGGGAAAGCAAGGGG - Intronic
1139632017 16:68236644-68236666 CTGGGAAAGGGGAGGGCGGCGGG + Intronic
1140384373 16:74521573-74521595 GTGGGGATGGGGAAGACTACAGG + Intronic
1140619596 16:76713193-76713215 CTTGGGAAGGGGTAGGTTGCTGG - Intergenic
1141621467 16:85238642-85238664 CTGGGGTAGAGGAAGGCTCCAGG + Intergenic
1141638502 16:85328330-85328352 CTGGGGAAGGGGAACCCTACAGG - Intergenic
1142273022 16:89100899-89100921 CTGGGACAGGCGAAGGCTGCGGG - Exonic
1142292979 16:89201218-89201240 CTGGGGGCGGGGAGGGCTGCGGG + Intronic
1142388820 16:89784707-89784729 TTGGGGAAGGGGAAGGGGAAGGG + Intronic
1203016463 16_KI270728v1_random:356415-356437 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1203034798 16_KI270728v1_random:629573-629595 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1142674875 17:1507458-1507480 CTGGGGATGGGAAAGACGACAGG + Intronic
1142983093 17:3682542-3682564 CTGGAGAAGGGGATGGGGACTGG + Intronic
1143328852 17:6119569-6119591 TGGGGGAAGGGGAAGACTAGAGG - Intronic
1143329409 17:6122240-6122262 CTGGGGAAGGGCAGCTCTACTGG - Exonic
1143513452 17:7408034-7408056 GTGGGGAAGGGGAAGGAAATGGG - Intronic
1143541835 17:7573654-7573676 CTGGGGGAGGGGAACGCCTCAGG - Intronic
1143727635 17:8860420-8860442 CTGGGGATGGGGATGGATTCGGG - Intronic
1143872546 17:9967410-9967432 CTGGGGAGGGGGGGTGCTACTGG - Intronic
1143958824 17:10697550-10697572 CGGAGGAAGCGGAACGCTACCGG - Exonic
1144732608 17:17537305-17537327 CAGGGCAAGGGGAAGGCAAAGGG - Intronic
1145904904 17:28510963-28510985 CTGGAGAAGGGGCAGGCTCTGGG - Intronic
1145975411 17:28981317-28981339 ATGGGGATGGGGGAGGCTGCGGG - Intronic
1146087025 17:29839069-29839091 CTGGGGAACGTGATGGCTCCTGG - Intronic
1147429142 17:40361153-40361175 CTAGGGGAGGAGAAGGCTGCAGG + Intronic
1147558004 17:41491815-41491837 CTGGGGCAGGGGGTGGCTACTGG - Intronic
1147615100 17:41822871-41822893 CTAGGGAAGGGGAAGGCTCCTGG + Exonic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1148537683 17:48454403-48454425 GAGAGGAAGGGGAAGACTACTGG + Intergenic
1148591124 17:48817320-48817342 CTGGGCAAGGGTAGGGCTGCGGG - Intergenic
1148741932 17:49897915-49897937 CTAGGGAAGGGGAAGGTGAGAGG + Intergenic
1148861201 17:50605106-50605128 GTGAGGAAGGGGAAGGGCACTGG - Intronic
1149114857 17:53081068-53081090 CTGGGGAATGGGAACCCTAGAGG + Intergenic
1150255694 17:63742332-63742354 CTGTGGATGAGGAAGGCTTCGGG - Intronic
1150266652 17:63836539-63836561 ATGGGGAAGGGGAAGGAGAAAGG + Intronic
1151202484 17:72478823-72478845 ATGGGGAAGGTGTACGCTACTGG + Intergenic
1151823410 17:76509715-76509737 CTGGGGAAGTGGCTGGCTCCAGG + Intergenic
1151833586 17:76569540-76569562 AGGGGGAAGGGGCAGGCTGCTGG + Intronic
1151878474 17:76880703-76880725 CTGGGGAGGGGCAAGGGGACTGG - Intronic
1152336151 17:79701140-79701162 GTGGGGAAGGGGAGGGGCACAGG + Intergenic
1152392816 17:80012848-80012870 CCAGGGAAGGGGACGGCAACAGG + Intronic
1154070019 18:11145933-11145955 CTAGGGCAGGGGAAAGCAACAGG + Intronic
1155399594 18:25423318-25423340 CTAGGGAACGGGAGGGATACAGG + Intergenic
1155858550 18:30866847-30866869 CTGGGGAAGGGGAGTGGTAGAGG + Intergenic
1156483531 18:37450718-37450740 ATGGGGGAGGGGAAGGCATCTGG - Intronic
1157476278 18:48025506-48025528 ATGGAGAAGGGGAAGGGAACTGG - Intergenic
1157496150 18:48158875-48158897 TGGGGGAAGGGACAGGCTACAGG + Intronic
1157615911 18:48987619-48987641 CTGGGGAACGTGCAGGCTGCAGG - Intergenic
1157812012 18:50704020-50704042 GTGGGGAAGGAGGAGGCTCCTGG - Intronic
1157905296 18:51564174-51564196 CTGGGCAAGGAGGAGGCTGCAGG + Intergenic
1158259708 18:55592958-55592980 CTGGGGAAGGGGAACATTGCAGG - Intronic
1158527306 18:58226634-58226656 CTGGGGACAGGGAAGGCTTTGGG + Intronic
1158958884 18:62571035-62571057 CTGGGGAATAAGATGGCTACAGG - Intronic
1160051009 18:75433357-75433379 CTGGGGAAGGAGGAGGACACGGG + Intergenic
1160075740 18:75674871-75674893 CATGGGAAGGGAAAGGCAACAGG - Intergenic
1160707573 19:536619-536641 CTGGGTAAGGAGAAGGCCCCAGG - Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1160990415 19:1858068-1858090 TTTGGAAAGGGGAAGTCTACTGG - Intronic
1161310251 19:3589941-3589963 CTGGGGGGAGGGAAGCCTACGGG + Intronic
1161698194 19:5782015-5782037 CTGGGGAAGGGGTAGGCTGAAGG + Intergenic
1162332160 19:10037017-10037039 CTGGCGGAGGGGAAGGCTTTAGG + Intergenic
1162562519 19:11425894-11425916 CTGAGTAAGGGGAAGGCTGGAGG + Intronic
1163156476 19:15442578-15442600 CTGGGGAATGAGAAGGGGACAGG - Intronic
1163470194 19:17492107-17492129 TGGGGGAAGGGGACTGCTACTGG - Intronic
1163740429 19:19008537-19008559 GTGACGAAGGGCAAGGCTACAGG - Intronic
1163766854 19:19168189-19168211 CTGGGGAAGGGCAGGGCCCCTGG - Intronic
1163782162 19:19256335-19256357 CTGGGGAAGGGGCAGCCATCAGG + Exonic
1164783660 19:30912785-30912807 CTGGGGAAGTCGCAGCCTACAGG - Intergenic
1165258701 19:34595822-34595844 CTGGGGGTGGGGAAGGCAGCAGG + Exonic
1165364753 19:35358701-35358723 CTGGGGAAGGGACAGGGGACAGG + Intronic
1165366571 19:35371170-35371192 CTGGGGAAGGGACAGGGGACAGG + Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1166300045 19:41908081-41908103 CTGGGGCTGGGGAAGGAGACTGG + Intronic
1166301181 19:41913008-41913030 CTGGGAGAGGGGAAGGCCCCGGG - Intronic
1166702807 19:44891734-44891756 CGGGGGAAGGGGGAGGACACTGG + Intronic
1167134733 19:47609656-47609678 TCGGGGAAGGCGAAGGCCACCGG + Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167494592 19:49810154-49810176 CTGGGGGAGGTGGAGGCTGCCGG + Intronic
1167627718 19:50603788-50603810 CAGGGGATGGGGATGGCGACAGG - Intergenic
1167628077 19:50605682-50605704 CAGGGGATGGGGATGGCGACAGG - Intergenic
1168482156 19:56730012-56730034 CTGTGGAAGGCTAAGGCTAGTGG + Intergenic
1168525865 19:57088462-57088484 CTTGGGAAGGTGAAGTCCACAGG + Intergenic
1168553456 19:57318831-57318853 CTGGGGGATGGGGAGGCCACAGG + Intergenic
1168641497 19:58034369-58034391 GGAGGGAAGGGGAAGGCTAGAGG + Intronic
925185940 2:1846489-1846511 CTGGGGGAGGGAAAGGCTGGGGG + Intronic
925704061 2:6667305-6667327 CTGGGCATGGGTAAGGCTGCTGG + Intergenic
925943767 2:8842408-8842430 ATGGGGGAGGCGAAGGCTTCAGG - Intergenic
926034208 2:9622208-9622230 ATTGGGAAGGGGCAGGCTTCTGG - Intronic
926552973 2:14322503-14322525 CTGGGGAAGGGGAACAAGACGGG - Intergenic
926823538 2:16879733-16879755 CTGGGGAAGGGGATGGTTTTGGG + Intergenic
927104225 2:19810125-19810147 CTGGGAAAGGGCAAGGCTGGAGG + Intergenic
927181370 2:20448504-20448526 CTGCGGGAGGGGAGGGCTGCTGG + Exonic
927333744 2:21896343-21896365 CTGGGGAGGGGGAAGGTTGGGGG + Intergenic
928377774 2:30789956-30789978 CTGGGGGAAGGGAAGGCTTGGGG + Intronic
929033912 2:37672647-37672669 CTGGGGAAGGAGTAGGCGACAGG + Intronic
929111350 2:38407650-38407672 CAGGAGAAAGGGAAGGCTTCAGG - Intergenic
929248945 2:39731877-39731899 CTGGGGAAAGGGTAGGGCACTGG + Intergenic
929668814 2:43853470-43853492 CTGAGGAAGGGCATGGCTGCTGG + Intronic
931195685 2:60050504-60050526 CTTGGGATGGGGAAGGGGACTGG + Intergenic
931377291 2:61718865-61718887 GTGGGGTAGGGGAAGGTTTCAGG - Intergenic
931458435 2:62430546-62430568 CTGGGGCAGGGGAAGGAGAATGG + Intergenic
932050753 2:68395657-68395679 CTGGGGAAAGAGAAGGCAAATGG - Intronic
932413164 2:71559091-71559113 CTGGGGAAGGGGGAGGCTCCCGG - Intronic
933078044 2:77954293-77954315 CAGGGGATGGGGATGGCGACAGG + Intergenic
934187759 2:89762279-89762301 CTGGGGCAGGGGAAGGAAAATGG - Intergenic
934308858 2:91845669-91845691 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
934514536 2:94977881-94977903 ATGGGGAAAGGGAAGGCCTCGGG + Intergenic
934890133 2:98060410-98060432 CTAGGGATGGGTAAGGCCACCGG - Intergenic
935141390 2:100355960-100355982 ATGGGGAGGGGGAAGGGGACAGG - Intergenic
935472779 2:103479802-103479824 CTGGGGAAGGAGAAGAGTTCAGG + Intergenic
935572679 2:104678148-104678170 CTGGGGAAGGGGATGACAGCAGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
937985027 2:127634573-127634595 CTGGGGAAGGGGAAGGTACAGGG - Intronic
939202992 2:139062665-139062687 CTGAAGAAGGGGAAGTCTTCTGG - Intergenic
941216469 2:162715518-162715540 CTGGTGAAGGGCATAGCTACAGG - Intronic
941845341 2:170126449-170126471 CTGGGGAAAGGGGAGGCTGTGGG + Intergenic
942079239 2:172384903-172384925 TTGGGAAAGGGGAAGGCTCGGGG + Intergenic
942423792 2:175837842-175837864 ATGGGGAATGGAAAGGGTACTGG - Intergenic
943408709 2:187519741-187519763 CTGGGGAAAGGGGAGGCTGTGGG - Intronic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
945321544 2:208429989-208430011 CTGGGGAAGTGGAAGGGCAGAGG - Intronic
946686687 2:222278277-222278299 CTGGGGGTGGGGGAGGCTTCTGG - Intronic
947744896 2:232502485-232502507 TTGGGGAAGGGGCAGGATAGGGG - Intergenic
948513921 2:238491042-238491064 AAGGGGAAGGGAAAGGGTACAGG - Intergenic
948556253 2:238813519-238813541 GTGGGGAAGGGGAAAGCAGCAGG - Intergenic
948585427 2:239016021-239016043 CAGGGGACGGGGGAGGCTGCCGG - Intergenic
1168786389 20:543545-543567 TGGGGGCAGGGGAAGGCGACGGG + Intronic
1168906604 20:1408982-1409004 CTGGGGAAGGGGAAAAGTTCTGG - Intergenic
1169006897 20:2215083-2215105 CTGGCCAAGTGGAAGGCTGCTGG - Intergenic
1169072145 20:2739192-2739214 CTGGGTGATGGGAAGGCTACAGG - Intronic
1170933908 20:20793485-20793507 TAGGGGCAGGGGAGGGCTACTGG - Intergenic
1171958442 20:31476613-31476635 CTGGGGCAGGTGAAGGTTTCTGG - Exonic
1172991435 20:39040041-39040063 CGGTGGAAGGGGAAAGGTACAGG + Intergenic
1173006919 20:39146997-39147019 CTGGGGAAGGGGGAGACCAGCGG - Intergenic
1173380054 20:42532041-42532063 CTGGGGATAGGCAAGGCTATGGG + Intronic
1173461283 20:43245269-43245291 ATGGGGATGGGGAAGGGGACAGG - Intergenic
1173640950 20:44601453-44601475 CTGGGAAAAGGGAGGGCTGCCGG - Intronic
1174423392 20:50415537-50415559 CAGGGGAAGGGAAAGGCGAGTGG + Intergenic
1174572074 20:51509022-51509044 CAGGGGAAGGGGAAGGATAGGGG - Intronic
1175133527 20:56806876-56806898 GTGGGGAAGGAAAAGGCTAGAGG - Intergenic
1175201990 20:57284323-57284345 CTGGGGAAAGGGGGTGCTACTGG + Intergenic
1176073741 20:63239263-63239285 CTGGGGCAGGGGAGGGCTGAGGG + Intronic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1178480328 21:32974644-32974666 TTGGGGAAGGGGAAGGCTGAAGG + Intergenic
1178680423 21:34669304-34669326 CTGGGCAAGGGGCGTGCTACGGG - Intergenic
1179624630 21:42641883-42641905 CTGAGGCACGGGAAGGCTAAGGG + Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179805949 21:43837006-43837028 CTGGGGAATGGGATGTCCACAGG + Intergenic
1179913503 21:44462237-44462259 CTGGGGGAGGGGGAGGCTCGGGG - Intergenic
1179980773 21:44894626-44894648 CTGGGGCAGGAGGAGGCCACAGG - Intronic
1180535941 22:16392757-16392779 CTGGGGCAGGGGAAGGAAAATGG + Intergenic
1181019191 22:20089790-20089812 CTTGGGAACGGGAAGCATACGGG + Exonic
1181309588 22:21937415-21937437 CTGGGGACTGGCAAGGCTATGGG + Intronic
1181867979 22:25874263-25874285 CTGGGGAGAGGGAAGGTTTCAGG - Intronic
1181977111 22:26737882-26737904 CTTGGGAAGGGGAAAGCACCTGG + Intergenic
1182031047 22:27159715-27159737 CTGGAGAAGGTGAAGTCCACCGG + Intergenic
1182340598 22:29617460-29617482 ATGGGGTGGGGGAATGCTACTGG - Intronic
1182570658 22:31235255-31235277 GTGGGGAAGGGGAAGGGGAAGGG - Intronic
1183072110 22:35403391-35403413 CTGGAGAAAGGGAAGGGCACAGG - Intronic
1183316395 22:37139268-37139290 CAGGGGAAGGGGGAGGCCACCGG + Intronic
1183337955 22:37261402-37261424 CTGGAAAAGGGGAAGGGTCCAGG + Intergenic
1183427632 22:37747905-37747927 CTGAGCAAGGGTAAGGCTGCCGG + Intronic
1183571561 22:38656858-38656880 CTGGGGAAGGGGACGGAGGCCGG + Intronic
1184404304 22:44291553-44291575 CTGGGGAAGGGCAAAGCTTTGGG + Intronic
1184443790 22:44535471-44535493 CTGGGGAAGGGAAGGCCTGCGGG + Intergenic
1184770563 22:46594494-46594516 CTGGGGTAGGGGGAGGCTCCTGG + Intronic
1184857955 22:47156773-47156795 CCGGAGAAGGGGAGGGCTGCCGG - Intronic
1185246706 22:49776649-49776671 CTGGGGGAGGGGGAGGCCCCAGG - Intronic
949395303 3:3608476-3608498 CTGGGGAGGGGGATGGTTTCAGG - Intergenic
950424832 3:12919463-12919485 CAGGGGAAGGGGAGGGCACCTGG + Intronic
950950465 3:16992972-16992994 CTGGACAAGGTGAAGCCTACAGG + Intronic
952635363 3:35522823-35522845 TTGGGGTAGGGGAAGGCTGAGGG + Intergenic
952888109 3:38024285-38024307 CGGGGGAATGGGAAGGCAGCTGG - Intronic
953031393 3:39182175-39182197 CTGGGCTAGGGGTAGGCTAGGGG + Intergenic
953210705 3:40872585-40872607 CGGGGAAAGAGGAAGGCCACAGG + Intergenic
953696594 3:45164723-45164745 CTGGGGAAGGGGAGGACAACAGG + Intergenic
954303375 3:49713157-49713179 CTGGGCAGGGGGCAGGCTAGGGG - Intronic
954614864 3:51964370-51964392 CCGGGGGAGGGGAGGGCTCCTGG + Intronic
954952921 3:54490813-54490835 CTGGGAAGGGGAAAGGCTTCAGG + Intronic
955101574 3:55854838-55854860 CTGGGGATGGGGAAGGAGGCTGG + Intronic
955326169 3:58010444-58010466 TTGGGGAGGGGGAGGGCTGCTGG - Intronic
955626059 3:60920626-60920648 CTGGGGAAGAGGAAACCTCCTGG + Intronic
955936731 3:64109547-64109569 CTGGGGAAGGGAAAGGGAAAGGG + Intronic
955983470 3:64549742-64549764 CTGGGGAAAGGGGACCCTACTGG - Intronic
956044401 3:65179924-65179946 GTGGGGAAAGGGAAGGCCAGAGG + Intergenic
956059547 3:65335770-65335792 CTGGGATAGGGGATTGCTACTGG - Intergenic
956155174 3:66288468-66288490 GAGGGGTAGGGGATGGCTACAGG - Intronic
956308300 3:67850663-67850685 CTGGGGCAGGAGAAGACTCCAGG - Intergenic
956581702 3:70820878-70820900 CTGGTGCAAGGGAAGGCCACAGG - Intergenic
956711727 3:72044192-72044214 GGGGGCAAGGAGAAGGCTACTGG - Intergenic
956728880 3:72178370-72178392 CTGGGGAAGGGGTAGGGTGGGGG + Intergenic
959513458 3:107240234-107240256 CTGGGGGAGGGGGTTGCTACTGG + Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
961076965 3:123991781-123991803 CAGGGCAAGGGGAAGGCAAGGGG - Intronic
961320382 3:126069008-126069030 CTGAGGAAGGGGATGTCAACAGG + Intronic
961568924 3:127784605-127784627 CTGTGGAAGGCTAAGCCTACAGG - Intronic
961691995 3:128676683-128676705 CTGGGGCAGTGCAAGGCTCCAGG + Intronic
961906712 3:130270363-130270385 GTGGAGAAAGGGAACGCTACTGG - Intergenic
962413896 3:135165360-135165382 CAGTGGAATGGGAAGCCTACGGG - Intronic
963305521 3:143648314-143648336 TTGGGGGAGGGGATGGCTTCGGG + Intronic
964819463 3:160755015-160755037 CTCGGGAGGGAGAAGGCTGCTGG + Intergenic
964833299 3:160910172-160910194 AAGGGGAAGGGGAAGGGGACAGG - Intronic
964833351 3:160910293-160910315 GAGGGGAAGGGGAAGGGAACGGG - Intronic
964970853 3:162558406-162558428 CTGAGGAAGGGGAGTGCTAATGG - Intergenic
965384473 3:168029760-168029782 TTAAGGAAGGGGAAGGCTACCGG + Exonic
965541317 3:169874360-169874382 ATGGGGAAGGGGTAGCCTCCTGG - Intergenic
966022124 3:175226762-175226784 CTGTTGCAAGGGAAGGCTACGGG + Intronic
967037008 3:185655508-185655530 CTGGGGAAGTAGAAGGTTGCTGG + Intronic
967185759 3:186943243-186943265 TTGAGGCAGGGGAAGGCTGCAGG + Intronic
967270697 3:187729728-187729750 TTGGGGAAGGGGTTGGCCACAGG + Exonic
967557673 3:190877306-190877328 CAGGGGATGGGGATGGCGACAGG + Intronic
968720159 4:2196712-2196734 CTGGGGAAGGGGGAGAGGACTGG - Intronic
968747498 4:2367915-2367937 CTGGGTAAGGGGAGGGCACCTGG - Intronic
969121328 4:4913498-4913520 CTGGGGAAGGGGGAGGGAAAGGG + Intergenic
971305123 4:25473307-25473329 AAGGGGAAGGGGAAGGGGACGGG + Intergenic
973634071 4:52845795-52845817 CTGGGGAAGGGGCTGGCTCCTGG + Intergenic
974214938 4:58832955-58832977 AAGGGGAAGGGGAAGGCGAAGGG - Intergenic
975399153 4:73914469-73914491 TTAGGGAAGGGGGATGCTACTGG - Intergenic
977767544 4:100817575-100817597 CTGGTGAAGGTGAAGTCTATGGG + Intronic
980223621 4:129951948-129951970 GTGGGGAAGAGGAAAGATACTGG - Intergenic
981379853 4:144060087-144060109 CTGGTGAACGGGAACACTACAGG + Intergenic
981781704 4:148438248-148438270 CTGGGGAGGTGGAATGCTACTGG - Intronic
982102734 4:151984075-151984097 CTGGGGAAAGGGAAGGCCATTGG - Intergenic
982364359 4:154559161-154559183 AAGGGGAAGGGGAAGGGAACTGG - Intergenic
985628344 5:1001747-1001769 CTGGAGAAGGGGAAGCCCGCGGG + Intergenic
985790890 5:1926387-1926409 CAGGGGAAGGGGAAGGCGCAGGG - Intergenic
986242675 5:5975246-5975268 GTGGGGGATGGGAAGGCTGCAGG + Intergenic
986313285 5:6570772-6570794 CTGGGGGAGGGGAACTGTACAGG + Intergenic
986838785 5:11672377-11672399 CTGGGGGAAGGGGTGGCTACAGG - Intronic
989475660 5:41870250-41870272 CGGGGGAAGAGGAAGGCCATGGG - Intronic
990316653 5:54589291-54589313 CTCTGGAAGGGAAAGGCCACAGG - Intergenic
990446235 5:55896684-55896706 CTGGGGAGGGGGAAGGGGAGTGG - Intronic
990861422 5:60331677-60331699 GTGGGGAAGGGGAAGGCAAGAGG + Intronic
990948429 5:61273411-61273433 ATGGGGGAGGGGAAGGCTGGAGG - Intergenic
992398115 5:76386399-76386421 ATGGGGAAGGGGAATGGCACAGG + Intergenic
992754665 5:79893106-79893128 CTGGGTACGGGGAAGGGTAAAGG - Intergenic
996766500 5:127039598-127039620 CTGGGGATGGGGAAGGATGGAGG + Intergenic
997435681 5:133873165-133873187 CAGGGGAAGGGGAAGATTGCGGG + Intergenic
998020590 5:138766681-138766703 GCGGAGAAGGGGAAGGCCACAGG + Intronic
998160591 5:139810792-139810814 GTGGGGAAGGGGCAGGGGACTGG + Intronic
998189062 5:140007074-140007096 CGGGGGAAGGTGGATGCTACTGG + Intronic
998377068 5:141698273-141698295 CTGGGGGAAGGGGAGGGTACTGG - Intergenic
998848572 5:146334054-146334076 AGGGGGAAGGGGAGGGCTCCTGG + Intronic
999125921 5:149245681-149245703 GTGGGGAGGTGGAAGGCTCCTGG + Intronic
1001084523 5:168691033-168691055 CTGAGGAAGGAAAAGGCTGCTGG - Intronic
1001216096 5:169857370-169857392 CTTGGCAGGGGGAAGGGTACTGG + Intronic
1001288402 5:170439727-170439749 CTGGGGAAGGGGAATGTTGCTGG - Intronic
1001378499 5:171285591-171285613 CTGGGGCATTGGAAGGCTGCAGG - Intronic
1001824597 5:174734913-174734935 ATGGGGTGGGGGAAGGCTAGGGG + Intergenic
1002061876 5:176630186-176630208 CTGGGGAAGGGGATGGAAAATGG - Intronic
1002281909 5:178135648-178135670 CTGAGGAAGGAGATGGGTACGGG - Intronic
1002302192 5:178263403-178263425 CTGGGGAAGGGGATGGCGTGGGG - Intronic
1002575378 5:180171106-180171128 CTGGGCTGGGGGAAGGCCACAGG - Intronic
1004000706 6:11594455-11594477 CTGGGGAAGGTGAAAGGTCCAGG - Intergenic
1004045505 6:12019139-12019161 ATGGGGAAGGGGAAGACTTCAGG + Intronic
1004347438 6:14861756-14861778 CTTGGGGAGGGGAAAGCTATTGG - Intergenic
1004375843 6:15090046-15090068 CCCGGGAGGGGGAAGGCTTCAGG + Intergenic
1006365783 6:33614373-33614395 CTGGGGCCGGGGAAGGGGACTGG - Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006567661 6:34973959-34973981 AAGGGGAAGGGGAAGGCAAGGGG - Intronic
1006630836 6:35428436-35428458 CTGGGGAAGGGGAAGGCCCCTGG + Intergenic
1006830355 6:36964466-36964488 CTCCGGAAGGGAAAGGCTACGGG + Exonic
1007264323 6:40585750-40585772 CTGGGGGAGGGGGAAGCTTCAGG - Intronic
1007719210 6:43875480-43875502 ATGGGGAAGGGGATGGCTGTGGG + Intergenic
1007790246 6:44304559-44304581 CAAGGGGAGGGAAAGGCTACAGG - Intronic
1007827758 6:44613908-44613930 CTGAGGAAGGGGAAGGTTTTGGG + Intergenic
1010402663 6:75464800-75464822 ATGGGGGTGGGGAAGGCTACAGG - Intronic
1010461577 6:76119868-76119890 CTGGGGAAGGTCAAGACTAAGGG + Intergenic
1012244130 6:96907601-96907623 CTGGTGAAAGGGAAGCCCACAGG - Intergenic
1012977415 6:105794871-105794893 CTGGGAAAAGGGAAGGGAACTGG + Intergenic
1014814963 6:125925161-125925183 CAGGGGAAGAGGCAGGCCACAGG + Intronic
1017073230 6:150595082-150595104 CTGTGGAAGGGGGAGCCTACTGG - Intergenic
1018186963 6:161273806-161273828 CTCTGGAAGGGGTAGGCTCCGGG - Intronic
1018501894 6:164420228-164420250 GAGGAGAAGGAGAAGGCTACAGG - Intergenic
1018607958 6:165618453-165618475 CTGGAGAAGAGGAAGGCTGATGG - Intronic
1018887030 6:167948314-167948336 GTGGGGATGGGGTAGGCTTCAGG - Exonic
1019026359 6:168967443-168967465 GTGGGGAAGTGGAAGGCTTGAGG - Intergenic
1019115221 6:169755299-169755321 CTGGGGAAGCGTGAGGCTGCTGG + Exonic
1019327520 7:445682-445704 GTGGGGAAGGGGCAGGCCAGGGG - Intergenic
1019429913 7:993956-993978 CTGGGGCAGGGGACGGTTTCCGG + Intergenic
1019948304 7:4348139-4348161 CTGGGGCAAGGGCTGGCTACAGG - Intergenic
1020212562 7:6167205-6167227 GTGGGGAAGGTGAAGGCCAAGGG - Intronic
1020803172 7:12756842-12756864 CTGGGAAAGGAGAAGGAAACTGG + Intergenic
1022511222 7:30935880-30935902 CTGGGGAAGGGGAGGGTTGGTGG + Intergenic
1024017381 7:45329343-45329365 CTGGGGGTGGGGAATGCTCCTGG + Intergenic
1024393660 7:48842861-48842883 CTGGGAAAAGGGAGGGCTCCAGG + Intergenic
1024577089 7:50773399-50773421 AAGGGGAAGGGGAAGGGGACGGG + Intronic
1025057161 7:55774514-55774536 ATGGGGGAGGGGAAAGCCACGGG + Intergenic
1025092882 7:56077982-56078004 CTGGGGAAGGGGAAGGGCACGGG - Intronic
1025797932 7:64757388-64757410 CTGTGGAAGGGGACGGCAGCAGG + Intergenic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026474840 7:70726041-70726063 CTGGGAGAAGGGAAGGCTAGAGG + Intronic
1027910667 7:84245949-84245971 CTGGGGAAAGGGGCGGCTATGGG - Intronic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1030044343 7:105481636-105481658 CTGGGGAAAGGGTAGGGTAGGGG - Intronic
1030109405 7:106013671-106013693 CTGGGTGAGGGGAAGGGTAGCGG - Intronic
1033523258 7:142183364-142183386 CTGGGGAAAGGTAAGGCTTGGGG + Intronic
1033583898 7:142760280-142760302 CCTGGGAAGGGGAAAGCTGCAGG + Intronic
1034412091 7:150947117-150947139 GTGGGGAAGGGGAAGGGGAGGGG + Intronic
1035076608 7:156181862-156181884 CTGGGAAAGGGGAAGAGCACTGG - Intergenic
1035676950 8:1462693-1462715 CTGGGGAAGGGGAAGGGACCAGG + Intergenic
1036543389 8:9741436-9741458 CTGTGAAAGGTGAAGGCTAATGG - Intronic
1037817293 8:22118915-22118937 GGGGGGAAGGGGAGGGCTCCCGG + Intronic
1038728618 8:30105150-30105172 GAGGGGAAGGGGCTGGCTACGGG + Intronic
1038990292 8:32860004-32860026 CTCCGGCAGGGGAAGGCTGCTGG - Intergenic
1039382333 8:37097917-37097939 CTGGGTAAGGGCAAGGCCATTGG - Intergenic
1041360579 8:57049430-57049452 ATGGGGAAGGGGCAGGCCATAGG - Intergenic
1042216868 8:66436522-66436544 ATGGGGATGGGGAAGGCTGTGGG + Intronic
1042255202 8:66795659-66795681 CTGGGTAAGAGAAATGCTACAGG - Intronic
1043850135 8:85206448-85206470 GTGTGGAAGGGGAAGGGGACAGG + Intronic
1044387329 8:91604500-91604522 ATGGGGAAGAGGGAGGCTTCTGG - Intergenic
1044581708 8:93832140-93832162 CTGGTGAAGGAGAAAGGTACAGG - Intergenic
1044603282 8:94026783-94026805 CTGGGGAAGGGGTAGGGGAATGG - Intergenic
1044743811 8:95353329-95353351 CTGGTGCAGGGGAAGGGTCCTGG + Intergenic
1045766061 8:105670589-105670611 CTGGGGAAGGGAAAGTTTACTGG - Intronic
1048222537 8:132555122-132555144 CTGAGGAAGAGGAAGGAGACAGG - Intergenic
1049000545 8:139823179-139823201 CTGGGCACTGGGAAGGGTACTGG - Intronic
1049404337 8:142444991-142445013 CTGGGCAAGGGCAAGGCCTCGGG + Intergenic
1049461604 8:142732069-142732091 CAGGGGAAGGGGAAGGAGAGGGG - Intronic
1049524224 8:143113128-143113150 CTGCTAAAGGGGAAAGCTACTGG - Intergenic
1049556701 8:143286091-143286113 CTGGGGGAGGGGAAGGGAAAGGG - Intergenic
1050460045 9:5869832-5869854 CTGGAGAAAGGGAAGGCTCATGG + Intergenic
1050565209 9:6875124-6875146 CTGGAGAAGAGGAAGGAAACGGG - Intronic
1051608951 9:18942954-18942976 CAAGGGAAGGGGAAGGTTTCCGG + Intronic
1052790829 9:32874137-32874159 CTGGGGAGGGGGAAGGAGAGTGG - Intergenic
1052981001 9:34449258-34449280 CTGGGGAAGGTCAAGGCTGTAGG + Intronic
1053393277 9:37751441-37751463 CTGGGGAAGGGCAAGGCTGTGGG + Intronic
1056104049 9:83329308-83329330 CTTGGGAAGGGAAATGATACAGG + Intronic
1056621756 9:88220820-88220842 CTGGAGCTGGGGAAGGCAACTGG + Intergenic
1057453077 9:95182879-95182901 CTGGGACAGGGGAAGGTGACTGG + Intronic
1058458840 9:105163801-105163823 GAGGGGATGGGGAAGGCTAAAGG - Intergenic
1058482515 9:105411344-105411366 CAGGGGAAGGGGAAGGAGAAGGG - Intronic
1058549784 9:106102309-106102331 CTTGGGAAGGAGAAGGCTGGAGG - Intergenic
1058736595 9:107899705-107899727 CAGGGAAAGGGGCTGGCTACAGG + Intergenic
1058928825 9:109698237-109698259 CAGGTGAAGGGTAAGGCCACTGG - Intronic
1059259575 9:112962861-112962883 GTGGGGAGAGGGAAGGCTGCAGG - Intergenic
1059326630 9:113507654-113507676 GTGGGGAAGGTGAAGGGTACTGG + Intronic
1059414269 9:114153825-114153847 CTGGGGAACTGGCAGGCTGCTGG - Intergenic
1059705540 9:116820094-116820116 CTGGAGGAGGGGAGGGCTAAAGG - Intronic
1059941303 9:119362405-119362427 TTGGGTAAGGGGAAGTCTAAAGG - Intronic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060938250 9:127528191-127528213 CTGGGGATGGGGAAGGAGAAGGG + Intronic
1061503216 9:131015431-131015453 CTGGGGAAGGGCATGGCTGCTGG - Intronic
1061755484 9:132809388-132809410 CTGGGGAAGAGGGAGGCCACAGG - Intronic
1062077036 9:134595132-134595154 CTGGGGCAAGGGGAGGCTTCAGG - Intergenic
1062197669 9:135283140-135283162 CTGGGGAAGGGGCAGGGTCAGGG + Intergenic
1062254213 9:135613514-135613536 GTGGGGAAGGGGTAGACCACAGG + Intergenic
1062335116 9:136061517-136061539 CTGGGGTAGGGGAAGGCGGATGG + Intronic
1062396712 9:136355540-136355562 CTGGGGGAGGGGTAGCCGACAGG + Intronic
1062448365 9:136605096-136605118 CTGGGGCAGGGGAGGGCGGCAGG + Intergenic
1062588823 9:137263817-137263839 CTGGGGAAGGGGAGGGCCACAGG - Intronic
1185739067 X:2515978-2516000 CTGGGGACTGGGAAGGTTAGTGG - Intergenic
1186354260 X:8773485-8773507 CTGGGGGAAGGGATGGCTATGGG + Intergenic
1186842164 X:13495103-13495125 CTGGGGAAGTGGGGTGCTACTGG + Intergenic
1187214305 X:17261327-17261349 TTTTGGAAGGGGAAGGGTACAGG + Intergenic
1187913208 X:24129484-24129506 CTGAGGAAGGGGAGGGGTGCTGG + Intergenic
1187971572 X:24664098-24664120 TTGGGGAAGGGGAGTACTACTGG + Intronic
1188757049 X:33975068-33975090 CTGGAGTAGGGGGAGGCTGCAGG + Intergenic
1189117026 X:38353398-38353420 AAGGGGAAGGGGAAGGGAACAGG + Intronic
1189988777 X:46575483-46575505 CTGGGGAGGGGGAAGTGTAGGGG + Intronic
1190049670 X:47140391-47140413 CTGGGGCAGGGGAAGCCCTCAGG + Intergenic
1190210641 X:48443921-48443943 CTGGGGAAGGGAAAGGCAGAGGG + Intergenic
1190561947 X:51694974-51694996 ATGGGGAAGGGGAAGGAGAAGGG + Intergenic
1190681335 X:52829781-52829803 CTGGGAACTGGGAAGGCTGCGGG - Intergenic
1193404521 X:81084449-81084471 CTGGGGAAAGGGGTGGCTATGGG + Intergenic
1194628286 X:96251584-96251606 GGTGGGAAGGGGAAGGCTACTGG - Intergenic
1194703381 X:97143986-97144008 CTGGGAAAGGTGAAGGGTAGGGG + Intronic
1195065034 X:101232750-101232772 CCGGGGAAGGGGTAGGTTAATGG - Intronic
1195086283 X:101417470-101417492 CTGGAGCAGGGGAAGGCAAAGGG - Intergenic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1196133445 X:112181726-112181748 CTGGGGAAAGGGGTGGCTATGGG + Intergenic
1196520653 X:116667517-116667539 CTACGGAAGGGGAAGGCGCCTGG + Intergenic
1197325606 X:125089832-125089854 CTGGGGAAGATGTAAGCTACTGG + Intergenic
1198254618 X:134914537-134914559 CTGGGGAGGGGGAAGGATACAGG + Intronic
1200124657 X:153807609-153807631 CTGGGGGACGGGAACGCTAGAGG - Intronic
1200228610 X:154432854-154432876 CTGGGGTCGGGGAAGGGTAGTGG + Intronic