ID: 1122204857

View in Genome Browser
Species Human (GRCh38)
Location 14:100143283-100143305
Sequence CCTCAGCCTCCACTATGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122204843_1122204857 26 Left 1122204843 14:100143234-100143256 CCAGGGCCAAGATTTCCTGCTGA 0: 1
1: 0
2: 0
3: 24
4: 248
Right 1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 233
1122204853_1122204857 1 Left 1122204853 14:100143259-100143281 CCTGCAGGAGCTGGGAGGGCAGA 0: 1
1: 0
2: 11
3: 59
4: 580
Right 1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 233
1122204852_1122204857 2 Left 1122204852 14:100143258-100143280 CCCTGCAGGAGCTGGGAGGGCAG 0: 1
1: 0
2: 8
3: 64
4: 624
Right 1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 233
1122204846_1122204857 11 Left 1122204846 14:100143249-100143271 CCTGCTGACCCCTGCAGGAGCTG 0: 1
1: 0
2: 1
3: 38
4: 356
Right 1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 233
1122204851_1122204857 3 Left 1122204851 14:100143257-100143279 CCCCTGCAGGAGCTGGGAGGGCA 0: 1
1: 1
2: 3
3: 69
4: 823
Right 1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 233
1122204844_1122204857 20 Left 1122204844 14:100143240-100143262 CCAAGATTTCCTGCTGACCCCTG 0: 1
1: 0
2: 4
3: 21
4: 222
Right 1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG 0: 1
1: 0
2: 0
3: 17
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122204857 Original CRISPR CCTCAGCCTCCACTATGTTG GGG Intronic
900097499 1:945956-945978 CCCCAGGCTGCACTAGGTTGGGG - Intronic
900629033 1:3624214-3624236 CCGCAGCCTCCACCAGATTGCGG + Intergenic
900642286 1:3693548-3693570 CCTCAGTCTCCTCTATGATGAGG + Intronic
901321278 1:8341594-8341616 CCTCAGACTCCAATATGAGGTGG - Intronic
901925015 1:12560588-12560610 CCTCACTCACCACCATGTTGGGG + Intergenic
902872242 1:19321428-19321450 TCTCAGCCTCCAAAGTGTTGGGG + Intronic
903221459 1:21871974-21871996 CCTCAGCCACCATGAAGTTGAGG + Intronic
905017119 1:34785488-34785510 CCCCAGCCTCCACCAGCTTGTGG - Exonic
905653836 1:39673157-39673179 CCTCAGCCTCCACCAGGTCCTGG + Intergenic
907202765 1:52742204-52742226 CCTCAGCCTCCAAAGTGCTGGGG - Intronic
910262633 1:85306934-85306956 CCTCAGCCTCTACTGTCTAGTGG + Intergenic
915673843 1:157512939-157512961 CCTCAGCCTCGAGTATAGTGTGG - Intergenic
916759215 1:167801664-167801686 CCTCAGCCTCCCAAATGCTGGGG + Intergenic
918207118 1:182319347-182319369 CCTCAGCCTCGAAAATGCTGAGG + Intergenic
920431981 1:205924432-205924454 CCTCAGCCTGCCCTATGGTGTGG - Exonic
920441985 1:205986845-205986867 CCTCGGCCTGCACTGTGTTCTGG - Intronic
920569000 1:207002151-207002173 CCTCAGCCTCAACTCCATTGGGG + Intergenic
920869304 1:209780504-209780526 CCTCAGGCTCCACTTCGTTAGGG - Exonic
920914611 1:210250036-210250058 CCTCAGCCTCCAGAGTGGTGGGG - Intergenic
921979542 1:221240920-221240942 CCTCTGTCTCCAATATGTTGTGG + Intergenic
922598500 1:226832443-226832465 CCTCAGCCTCCCCAAAGTTCTGG + Intergenic
922784137 1:228274786-228274808 CCTCAGCCTCCACGGTGATCTGG - Exonic
923066317 1:230520448-230520470 CCTCAGCCTCCAAATTTTTGAGG + Intergenic
924845645 1:247767285-247767307 CCTCCAGCTCCACCATGTTGTGG + Intergenic
1066211302 10:33241498-33241520 CCACAGCTGCCACTATGTTAAGG - Intronic
1066562352 10:36684097-36684119 CCTCAGCCTACTCAATGTGGAGG + Intergenic
1067713780 10:48671600-48671622 CCTCAGCCTCCACGGTGGAGAGG - Intergenic
1068823967 10:61412021-61412043 CCTCACCCTCCCATATCTTGTGG - Intronic
1070014555 10:72512953-72512975 CCTCAGCCTCCAGAGTGCTGGGG + Intronic
1071314768 10:84384231-84384253 CCTCCGCCTCCTCCATGTTTTGG - Intronic
1072926707 10:99622065-99622087 CCTCGGCCTTCACAGTGTTGGGG - Intergenic
1075065731 10:119287830-119287852 CCTCAGCGTCCTCTATGGTATGG - Intronic
1075664470 10:124220895-124220917 CCTCAGACTACACTATATTGTGG - Intergenic
1076513004 10:131025552-131025574 CCTCAGCCTCTACTTTGAGGAGG - Intergenic
1076546940 10:131251528-131251550 CCTCAGCTTCTACTGTGTTCCGG + Intronic
1078596619 11:12692724-12692746 CTGAAGCCTCCACTATGTTAGGG - Intronic
1079189508 11:18266000-18266022 CCTCAGCCCCCTCAATGCTGAGG + Intergenic
1079441153 11:20516176-20516198 CCTCAGCCTCCCCAAAGTTCTGG - Intergenic
1079558710 11:21794282-21794304 CCTCATGCTCTATTATGTTGTGG + Intergenic
1080316796 11:30958872-30958894 CCTTTGCCTCCACTGTGTAGGGG - Intronic
1081018077 11:37907753-37907775 CCTGTGCCTCCGCTAAGTTGTGG - Intergenic
1081870115 11:46379520-46379542 CCCCGGCCTCCACGATGTAGTGG - Exonic
1082639644 11:55642426-55642448 TTTCAACTTCCACTATGTTGTGG - Intergenic
1084626608 11:70312640-70312662 ACGCAGGCTCCACGATGTTGAGG - Intronic
1087818907 11:102689280-102689302 CCTCAGCCTCCAAAGTGCTGGGG - Intergenic
1089338735 11:117743513-117743535 GCTCAGCATCCTGTATGTTGGGG - Intronic
1092430045 12:8400977-8400999 CCTCAGCCTCCTGCATTTTGAGG - Intergenic
1094458597 12:30668012-30668034 CCTCAGCCTCCAAGTAGTTGGGG - Intronic
1095717479 12:45363312-45363334 CCTCAGCCTCCCAAAAGTTGTGG - Intronic
1096251184 12:50033433-50033455 CCCCAGCCTCCTCCCTGTTGGGG - Intergenic
1097532626 12:60824066-60824088 CCTCAGCCTCCAAAGTGCTGTGG + Intergenic
1098608965 12:72431670-72431692 CCTAAGAATCCACTATGATGAGG - Intronic
1099782435 12:87214416-87214438 TCTCTCCCTCCACCATGTTGAGG + Intergenic
1102061393 12:109934629-109934651 CCTCAGCCTCCAAAGTGCTGGGG + Intronic
1102901251 12:116639106-116639128 CCTCAGCCTCCAAAGTGCTGGGG + Intergenic
1103162994 12:118745769-118745791 CTTCAGTTTCCACTAGGTTGGGG - Intergenic
1104866199 12:131956178-131956200 CCTGAGACTCAACTGTGTTGTGG + Intronic
1105603023 13:21903766-21903788 CCTGAGCATTCACTATGTTCAGG + Intergenic
1105907890 13:24832270-24832292 CGTTAGCATCCACTATGTTAAGG - Intronic
1106512607 13:30424200-30424222 CCTCTGCCTTCACTCTGTTAAGG + Intergenic
1106778213 13:33028602-33028624 CATGAGCCTCCAATATTTTGGGG - Intronic
1107787607 13:43971048-43971070 CCCCGGCCTCCACGATGTAGTGG - Intergenic
1108783550 13:53867137-53867159 CCTCAGTCCACAGTATGTTGGGG + Intergenic
1112601586 13:100860868-100860890 CTTCAGCCTCATCCATGTTGTGG + Intergenic
1117023980 14:51601137-51601159 CCCCAGCATCCACTATGCTTTGG + Intronic
1117670799 14:58103460-58103482 CCTCAGCCTCCAGAACGATGAGG + Intronic
1118104551 14:62642747-62642769 CCTCAGCCTCCCCAAAGTTCTGG - Intergenic
1119507320 14:75184085-75184107 CCTCAGCCTCCCCAGTGCTGGGG + Intergenic
1120239705 14:81935779-81935801 CCTCAGCTTCTACCATGTTTTGG - Intergenic
1120516934 14:85482007-85482029 CCACAGGCTTCCCTATGTTGAGG + Intergenic
1122204857 14:100143283-100143305 CCTCAGCCTCCACTATGTTGGGG + Intronic
1122687778 14:103518219-103518241 CCTCAGCCTCCCCTTTCTGGAGG + Intergenic
1127477673 15:59350010-59350032 CCTCAGCCACAACCAGGTTGTGG + Intronic
1128785842 15:70396344-70396366 CCCCAGCCTCCACTCAGATGTGG - Intergenic
1132053931 15:98634925-98634947 CCCCAGCCTCCACTGTCCTGAGG + Intergenic
1132665247 16:1078525-1078547 CCTCAGACTCCAGGATGCTGCGG + Intergenic
1133906654 16:10028579-10028601 AGTCAGTCTCCACTATCTTGTGG - Intronic
1135779434 16:25287196-25287218 CCTCAGCCTCCAAAGTGCTGGGG + Intergenic
1137436303 16:48456490-48456512 CCTCAGCCTCCAAAAGGTTTGGG + Intergenic
1140253470 16:73315285-73315307 CCTCAGCTTCCCCTATGTGGTGG + Intergenic
1143660385 17:8320983-8321005 CCTCAGCCTGCATTAGGGTGGGG - Exonic
1143803005 17:9400349-9400371 CCTCAGCCTCCAAAGTGCTGGGG + Intronic
1144406514 17:14957522-14957544 ACTCAGCCTCCTCTTTGTTACGG - Intergenic
1145722906 17:27089767-27089789 CTTCAGCCTCCAGCATGTGGTGG - Intergenic
1146727427 17:35167682-35167704 CCTCAGCCTCCAAGAAGTTCTGG - Intronic
1147171714 17:38623971-38623993 CCTCAGCCTCCAGAGTGTTTAGG - Intergenic
1147189942 17:38732519-38732541 CCTCAGCCTCCAGTATGGCTGGG - Intronic
1148048895 17:44759626-44759648 CCTCATCCCCCACTCTGGTGTGG - Intronic
1150868069 17:68875657-68875679 CCTCAGCCTCTGCCATGTAGTGG + Exonic
1150877281 17:68984099-68984121 CCTCAGCCTCTGCCATGTAGTGG + Exonic
1152055141 17:78018746-78018768 GCTCAGCCTCCTCTAGGCTGGGG - Intronic
1154159627 18:11971596-11971618 CCTCAGCCTCCACAGTATTTGGG - Intergenic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1156800683 18:41109560-41109582 CCTCAGCTGCCTCTAAGTTGGGG + Intergenic
1156966070 18:43094148-43094170 CCTCAGGCTCCAATATGATTCGG + Intronic
1159113040 18:64082401-64082423 CCTCAGTCTCCACATTTTTGGGG + Intergenic
1160006412 18:75072258-75072280 TCTCAGCCTTCACTCTGTAGAGG - Intergenic
1160969426 19:1760809-1760831 CCCCAGACTCCTCTGTGTTGGGG - Intronic
1162311420 19:9909674-9909696 CCTCAGCCTCCCCGACGTTGGGG + Intronic
1162673647 19:12281292-12281314 CTTCAATCTCCACTTTGTTGAGG - Intronic
1163354429 19:16800593-16800615 TCCCAGCCTCCAGAATGTTGAGG - Intronic
1163721718 19:18901041-18901063 CCTCAGTCTCCACCATGAAGGGG + Intronic
1166789266 19:45388457-45388479 CCTCAGCCTCCCCTATGGCTGGG - Intronic
1166901943 19:46071282-46071304 CCTCTCCCTTGACTATGTTGGGG + Intronic
1166993768 19:46709222-46709244 CCTCAGCCTCCAAAGTGCTGGGG + Intronic
1167912471 19:52715337-52715359 CCTCAGCCTCCCCAGTATTGGGG - Intronic
1168625978 19:57918195-57918217 CCTCACCCTCCAATGTGTTGGGG + Intergenic
924967407 2:91261-91283 CCTGAGCCTCCCCAATGCTGTGG + Intergenic
925157989 2:1661943-1661965 CCCCAGCCTCCCCTCTGCTGTGG - Intronic
931516472 2:63053113-63053135 CCTCAGCCTCTCAAATGTTGGGG + Intronic
932202489 2:69843672-69843694 CCTCAGCCTCCAGAATAGTGGGG - Intronic
932224613 2:70029804-70029826 CCTCAGCCTCCTCTAGGGAGGGG - Intergenic
932325286 2:70855457-70855479 CCTCAGCCTCCACAGTGTCTGGG - Intergenic
932639998 2:73435705-73435727 CCTCAGCCTCCTCTGTTGTGAGG + Intronic
932696925 2:73964713-73964735 CCTCAGCCTCTCCTATGTGGAGG + Intergenic
934146746 2:89102162-89102184 CCCCAACCTCCACGTTGTTGAGG - Intergenic
934222518 2:90098430-90098452 CCCCAACCTCCACGTTGTTGAGG + Intergenic
934844409 2:97653198-97653220 CCTCAGCCTCCAAGGTGCTGGGG - Intergenic
936020384 2:108990043-108990065 CCTCAGCCTCCAAAGTGCTGGGG - Intergenic
937649394 2:124303100-124303122 CACCAGCTTCCACTGTGTTGTGG + Intronic
938025726 2:127946244-127946266 CCACAGCCTCCACTGTTATGGGG - Intronic
938393767 2:130926533-130926555 CCTCTGACTCCACTTTGGTGTGG + Intronic
938943816 2:136192695-136192717 TCTCAGCCTCCATAATCTTGCGG - Intergenic
940306782 2:152235350-152235372 CCTCAGCCTTCACTATGGGCTGG + Intergenic
942129779 2:172866672-172866694 CCTCAGACTGCACCATTTTGGGG - Intronic
944666673 2:201964729-201964751 GCTGAGCGTCCACCATGTTGAGG - Intergenic
944978604 2:205088580-205088602 CCTCAACTTTCACTATGTTCGGG + Intronic
946332537 2:219018467-219018489 GCCCAGCCTCCACTAAGCTGGGG + Intronic
948867881 2:240784604-240784626 CCTCAGCCACCACCTGGTTGGGG - Intronic
1169332729 20:4729549-4729571 GCTCAGACACCACTCTGTTGAGG + Intergenic
1170879263 20:20280225-20280247 CCTCTGCCTCCACTGTCGTGAGG - Intronic
1172039194 20:32031639-32031661 CCTCAGCCTCCAGAAAGCTGCGG - Exonic
1175283238 20:57819535-57819557 CCTCAGCCTCCACTCAGATGAGG + Intergenic
1175333087 20:58177962-58177984 CCTCAGCCACCACTACCATGTGG + Intergenic
1176013689 20:62915741-62915763 CCTCAGCCTCCAGAGTTTTGGGG + Intronic
1176380832 21:6111427-6111449 CCTCGGGCTCCCCTTTGTTGGGG + Intronic
1176722932 21:10406435-10406457 CCTCAGCCTCCACAAAGTGTTGG - Intergenic
1176784467 21:13238273-13238295 CCACAGCCATCAGTATGTTGTGG - Intergenic
1177104368 21:16936513-16936535 CCTCAGCCTCCAGAGTGGTGGGG + Intergenic
1177197929 21:17922447-17922469 CTTCAGCCTCATCTATTTTGTGG - Intronic
1177982517 21:27932125-27932147 CCACAGCCATCAGTATGTTGTGG - Intergenic
1178702081 21:34842053-34842075 AATCACCCTCCACTAGGTTGTGG + Intronic
1179742640 21:43426813-43426835 CCTCGGGCTCCCCTTTGTTGGGG - Intronic
1180304092 22:11059169-11059191 CCTCAGCCTCCACAAAGTGTTGG - Intergenic
1181032685 22:20155904-20155926 CCTCAGCCTCCCGTGTATTGGGG + Intergenic
1181510745 22:23387703-23387725 CCTCAGCCTCCTGTGTATTGGGG - Intergenic
950118585 3:10467157-10467179 CCTCAACCTCTACTTTGATGGGG + Intronic
951005619 3:17612375-17612397 CCTCGGCCTCCAAAATGCTGGGG - Intronic
951567104 3:24021489-24021511 CCTCAGCCTCCTAAATGCTGGGG + Intergenic
951608436 3:24463505-24463527 CCTCAGCCTCCACAAAGTGCTGG + Intronic
952924444 3:38310831-38310853 CCCCAGCCTCCACCCTGTTGTGG + Intronic
953659005 3:44877052-44877074 CCTCAGCCTCCCAAATTTTGGGG - Intronic
954665781 3:52251065-52251087 CCTCAGCCTCCAAAGTGCTGGGG + Intergenic
954796002 3:53161610-53161632 CCTCAGCCCCCACTGTCTAGCGG - Intronic
955787782 3:62558213-62558235 CCTCAGCCCCCACAATGGCGTGG + Intronic
955916946 3:63915934-63915956 CCTCAGCCTCCACGAAGTGCTGG + Intronic
961041349 3:123680631-123680653 ACTCAGCCTTCAGTATGTTGGGG - Intronic
961155824 3:124678701-124678723 CCTCAGCCTTCACAGGGTTGGGG - Intronic
961622429 3:128235178-128235200 CCTCAGCCTCCCATATGTCTGGG + Intronic
963673707 3:148282182-148282204 CCTCAGCCTTTCCCATGTTGTGG - Intergenic
964475925 3:157097545-157097567 CCTCAGCCTCCACAAAAATGTGG - Intergenic
964813830 3:160695120-160695142 CCTCAGCCTCCACACACTTGGGG + Intergenic
965035794 3:163435904-163435926 CCTCAGCCTCCCCAAAGTTCTGG - Intergenic
965427641 3:168546872-168546894 CCTCAGCCTCCAAAGTGCTGGGG + Intergenic
968565994 4:1313151-1313173 CCTCAGCCTTCACTCCGGTGAGG + Intronic
968915372 4:3494923-3494945 CCTCACCCGCCACCCTGTTGTGG + Intronic
969171484 4:5367464-5367486 CCCCAGCCTCCACTAACATGTGG - Intronic
969932509 4:10644555-10644577 CCTGAGCCTCTACTATATTCTGG - Intronic
972539666 4:40028508-40028530 CCTCAGGCTCCAATATGGTTAGG - Intergenic
972574756 4:40341545-40341567 CTTCAGCCTCCAATTGGTTGTGG + Intronic
973887444 4:55337380-55337402 CCTCAGCCTCCCCAAAGTGGTGG + Intergenic
974191077 4:58504748-58504770 CCTGAGCCTCCAGCAAGTTGAGG - Intergenic
974198613 4:58610229-58610251 CCTCAGCCTCCAGAATTGTGAGG + Intergenic
974634111 4:64536802-64536824 CTTCAGCCTCCACAGTGCTGGGG + Intergenic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
978371781 4:108036471-108036493 CATCATCCTCCACTGTGTTTTGG + Intergenic
979004773 4:115279504-115279526 ATACAGCCTTCACTATGTTGAGG - Intergenic
979153282 4:117348059-117348081 CTCCAGCCTCCACAATTTTGAGG - Intergenic
984021266 4:174487269-174487291 CCTCCCCCTCCACTCTCTTGGGG + Intergenic
984526801 4:180867120-180867142 CCTCAGCCCCCTCTAGGCTGTGG - Intergenic
984796284 4:183663180-183663202 CCTCAGCCTCCAAGTAGTTGGGG + Intronic
985892904 5:2729977-2729999 CCTCAGGGTGCACAATGTTGTGG - Intergenic
986236340 5:5914196-5914218 CCTCAGCCTCCCAAGTGTTGGGG - Intergenic
986971228 5:13339389-13339411 CCTCAGCCTCCAGTGTGTTTGGG + Intergenic
990405225 5:55483419-55483441 CCTCAGCCTCCCCAAAGTTCTGG - Intronic
991694834 5:69261066-69261088 CCTCAGCCTCCAATAGTTTTGGG + Intronic
996606905 5:125334163-125334185 CCTCAGCCTGCAGTCTATTGTGG - Intergenic
1002662890 5:180803190-180803212 CCTCAGCCTCCCCTGGGTTGGGG - Intronic
1003136046 6:3435398-3435420 CCTCCTCCTCCCCTATGATGGGG + Intronic
1005859390 6:29889096-29889118 CCTCAGCCTCCACTCAGGTCAGG + Intergenic
1005864545 6:29927818-29927840 CCTCAGCCTCCACTCAGGTCAGG + Intergenic
1005866959 6:29943907-29943929 CCTCAGCCTCCACTCAGGTCAGG + Intronic
1005992541 6:30912383-30912405 CCTGCGCCACCACCATGTTGGGG - Exonic
1006340716 6:33445114-33445136 CCTCAGCCTCCACCAAGTGAGGG - Intronic
1006917638 6:37605168-37605190 CCCCAGCCTCCACCATGATGAGG - Intergenic
1009777702 6:68226426-68226448 GCTCAGCCTCATCTTTGTTGGGG - Intergenic
1010828639 6:80503556-80503578 CCTCAGCCTACTCAATGTGGAGG + Intergenic
1015620914 6:135130755-135130777 CCTCAGGCTCCAATATGGTTTGG - Intergenic
1015867486 6:137741704-137741726 CCTCACACTCAACTATGATGAGG - Intergenic
1016033054 6:139357561-139357583 CCTCAGCCTCCCAAATGTTTGGG + Intergenic
1017216131 6:151909654-151909676 CCTCAGCCACCACTGGGTTCAGG + Intronic
1017746373 6:157450397-157450419 CCTCAGCCTCCCGAATGTTCAGG - Intronic
1017796891 6:157852822-157852844 CCTCGGCCTCCAAAATGCTGGGG + Intronic
1018733338 6:166669456-166669478 CCTCACCCTCGCCTCTGTTGGGG + Intronic
1020111115 7:5448305-5448327 CCTCAGCCTCCCAAATCTTGGGG + Intronic
1022377131 7:29824622-29824644 TCTCATCCTCCACTGTGTTCTGG - Intronic
1023594810 7:41817609-41817631 CATCAACCTCAACTATGTTGGGG + Intergenic
1025745192 7:64236532-64236554 CCTCAGCCTCCACAAAGTGCTGG - Intronic
1026328889 7:69335164-69335186 CCTCAGCCTCCACTGTATCTGGG + Intergenic
1027548083 7:79555656-79555678 CCTCAGCTTCCATTCTGTGGAGG - Intergenic
1028847664 7:95500314-95500336 CCTCAGCCTCCCCAAAGTTCTGG - Intronic
1030125109 7:106145897-106145919 CCTCAGCCCCCACAAAGTTCTGG - Intergenic
1030445035 7:109638480-109638502 TCCCAGCCTCCAGTATGGTGAGG - Intergenic
1031074374 7:117198830-117198852 CCTCAGCCTCCATAATAGTGGGG - Intronic
1032157639 7:129482034-129482056 CCTCAGCCTCCCCTGAGTAGAGG - Intronic
1033031235 7:137829220-137829242 CCTCAGTCACCACTGTGGTGAGG + Intronic
1034725531 7:153332008-153332030 CCTCAGCCTCCAGTGTCATGGGG - Intergenic
1035995358 8:4540451-4540473 CCTCAGCCTCCCCTAAGTCCTGG - Intronic
1038328553 8:26590320-26590342 CCTCAGTCTCCACATGGTTGAGG + Intronic
1039791158 8:40876564-40876586 CCTCAGCCTCCAAAGTGCTGGGG + Intronic
1041739170 8:61139943-61139965 GCTCAGCCTCCACAGTGTGGAGG - Intronic
1044311221 8:90695021-90695043 CCTCAACATTCACTAAGTTGGGG + Intronic
1045539609 8:103071053-103071075 CCTCAGACTCTACAATGATGTGG - Exonic
1046932985 8:119859467-119859489 CCTCAGCCTCCCCTAAGTGCAGG + Intergenic
1047210435 8:122836030-122836052 TCTCAGCCTACCCTCTGTTGTGG - Intronic
1047722969 8:127659313-127659335 TCTCAGCCTCCACAATTGTGTGG - Intergenic
1048384802 8:133902060-133902082 CCTAAGCCGCCACCATCTTGGGG + Intergenic
1049403232 8:142440199-142440221 CCTCAGCTTCCTCCATGATGGGG + Intergenic
1051704658 9:19864281-19864303 CCTCTGCCTCCTCTATTTTTTGG - Intergenic
1053055147 9:34989624-34989646 GCTCAGCCTCCACTGTGATTGGG - Exonic
1053885104 9:42637946-42637968 CCTCAGCCTCCACAAAGTGTTGG - Intergenic
1054224126 9:62445395-62445417 CCTCAGCCTCCACAAAGTGTTGG - Intergenic
1055734664 9:79314079-79314101 CCTCAGGCTCCAATATGGTGTGG + Intergenic
1056198664 9:84253296-84253318 CCTCATCCTCCCCCACGTTGTGG + Intergenic
1056241246 9:84648768-84648790 CTTCAGACTCCTCCATGTTGTGG + Intergenic
1056253924 9:84778878-84778900 CCTCTCCCTCCTCAATGTTGAGG + Intronic
1056785264 9:89588033-89588055 CCTCAGCCTCCTCTATATCTGGG + Intergenic
1058477242 9:105349909-105349931 CCTCTGATGCCACTATGTTGAGG + Intronic
1059346376 9:113631754-113631776 CCTCAGCCTCTCATATTTTGAGG - Intergenic
1060088396 9:120721676-120721698 CCTCAGCCAGCACGATGATGTGG - Intergenic
1062454278 9:136628470-136628492 CCGCAGCCTCCAGGATGTTGCGG - Intergenic
1187672908 X:21686244-21686266 CTTCAGCATTCACTATGTGGTGG - Intergenic
1188572970 X:31611674-31611696 CCTCAGCCTCCAGTGTGTCTGGG + Intronic
1190147851 X:47913392-47913414 CCTCAGCCTCCCAAGTGTTGGGG - Intronic
1190333074 X:49247711-49247733 CCTCAACCTCCTCAATGCTGCGG - Exonic
1195629713 X:107042269-107042291 CCTCTGCCTTCACTAGCTTGAGG + Intergenic
1197730161 X:129803181-129803203 TCTCTGCCCCCACTAAGTTGAGG + Intergenic
1199743356 X:150756490-150756512 CCACATCCTCCACTGTGTCGTGG + Intronic
1199972648 X:152872303-152872325 CCTGAGCACCCACTATGCTGTGG - Intergenic
1200761635 Y:7044327-7044349 CCTCAGCCTCCATAGTGCTGGGG + Intronic
1201337879 Y:12899965-12899987 CCTCAGCCTCCAGGTGGTTGGGG - Intergenic