ID: 1122205939

View in Genome Browser
Species Human (GRCh38)
Location 14:100147970-100147992
Sequence CTTGAACTTCACCACAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 187}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122205939_1122205941 -8 Left 1122205939 14:100147970-100147992 CCTGGGCTGTGGTGAAGTTCAAG 0: 1
1: 0
2: 4
3: 22
4: 187
Right 1122205941 14:100147985-100148007 AGTTCAAGTGAGATGGTCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 118
1122205939_1122205948 28 Left 1122205939 14:100147970-100147992 CCTGGGCTGTGGTGAAGTTCAAG 0: 1
1: 0
2: 4
3: 22
4: 187
Right 1122205948 14:100148021-100148043 CTTGGTACTGCCAGCCGGAATGG 0: 1
1: 0
2: 0
3: 8
4: 59
1122205939_1122205945 23 Left 1122205939 14:100147970-100147992 CCTGGGCTGTGGTGAAGTTCAAG 0: 1
1: 0
2: 4
3: 22
4: 187
Right 1122205945 14:100148016-100148038 ACCGCCTTGGTACTGCCAGCCGG 0: 1
1: 0
2: 1
3: 8
4: 74
1122205939_1122205944 10 Left 1122205939 14:100147970-100147992 CCTGGGCTGTGGTGAAGTTCAAG 0: 1
1: 0
2: 4
3: 22
4: 187
Right 1122205944 14:100148003-100148025 CCTGGTGCAGAGCACCGCCTTGG 0: 1
1: 0
2: 1
3: 20
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122205939 Original CRISPR CTTGAACTTCACCACAGCCC AGG (reversed) Intronic
900169677 1:1260647-1260669 CTTGAACATCCCCACACCCCAGG + Intronic
900178387 1:1300674-1300696 CTTGAACTTCCGCACATCCCTGG + Exonic
901238919 1:7681710-7681732 CTTGAAGTTCAGCACGGCCCTGG - Intronic
901699629 1:11038296-11038318 TTTGATCTTCACAACAGCCCTGG - Intronic
901843164 1:11966274-11966296 CCAGAACTACACCAAAGCCCTGG + Exonic
902098564 1:13966358-13966380 CTTGAACTTCTTCTCAGCCCTGG + Intergenic
904336297 1:29800468-29800490 GGTGAACTCCTCCACAGCCCCGG - Intergenic
905274290 1:36807104-36807126 CTTCAGCTACACCAGAGCCCAGG + Intronic
905412336 1:37779264-37779286 CAAGAACTTCATCACAGCCGAGG + Intergenic
915211529 1:154313192-154313214 CTTGAGCTTGACCAGTGCCCCGG + Intergenic
915244231 1:154544821-154544843 AATGAACATGACCACAGCCCAGG - Exonic
916451636 1:164926624-164926646 CTGGAGCTTCCCCACAGACCTGG + Intergenic
918260852 1:182794729-182794751 CTTGGATTTCACCACAGCCTTGG + Intronic
918811853 1:189132635-189132657 TTTGACCTTGACCACAGCCTTGG + Intergenic
919710891 1:200726889-200726911 CTGGAAGTACACCCCAGCCCCGG - Intergenic
921576749 1:216844170-216844192 CTTGAAATTCATTACAGGCCTGG + Intronic
921707687 1:218343089-218343111 CTTTAATTTCCCCAAAGCCCAGG - Intergenic
923149042 1:231217696-231217718 CTCCACCATCACCACAGCCCAGG + Intronic
923766112 1:236893741-236893763 CTGGATTTTCTCCACAGCCCTGG - Intronic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
924825240 1:247531822-247531844 CCTGATCTTCAACACGGCCCGGG + Exonic
1063749026 10:8921306-8921328 CTTGAACCTCACCATAGCAGTGG - Intergenic
1064105752 10:12499813-12499835 CTGGAACCTCACCATAGCTCTGG + Intronic
1064996596 10:21301791-21301813 CTTGAACTTTCACAAAGCCCTGG - Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1070730118 10:78821311-78821333 CTTCATCCTCACCACAGCCCTGG - Intergenic
1070832194 10:79424916-79424938 AGTAAACCTCACCACAGCCCTGG + Intronic
1071488797 10:86122157-86122179 TTTAAACTTTACCACAGCCTTGG + Intronic
1074112001 10:110429340-110429362 TTTCATCTTCACCACAGCCTGGG + Intergenic
1074228128 10:111507388-111507410 CTTAAACTCAACCACTGCCCTGG - Intergenic
1075486925 10:122829933-122829955 TTTAATCCTCACCACAGCCCCGG + Intergenic
1075939019 10:126372353-126372375 TTTGGAATTCACCACAACCCAGG + Intronic
1076395479 10:130135412-130135434 CTTGAACTTCAACACAGACAGGG - Intergenic
1076533218 10:131159277-131159299 CTTGGTCTTCATCTCAGCCCTGG - Intronic
1079140454 11:17805844-17805866 CATGAGCCTCACCACAGCACTGG - Intronic
1081579298 11:44340822-44340844 CTGGGACTTCACCAAAGCACTGG + Intergenic
1082092979 11:48104840-48104862 CTTGAACTTAACCACCCCCAGGG - Intronic
1083956600 11:65987344-65987366 TTTGATTCTCACCACAGCCCTGG - Intergenic
1085402923 11:76245289-76245311 TTTGAACCTCACCACAGCTCTGG - Intergenic
1085739172 11:79064632-79064654 CACCAACTTCACCAGAGCCCCGG + Intronic
1085844686 11:80051571-80051593 TTTCATCTTCACAACAGCCCTGG - Intergenic
1085968805 11:81562064-81562086 CTTGAAATTCACCACAAACACGG - Intergenic
1086052786 11:82613663-82613685 CATGCACTTCACCACAGGACTGG + Intergenic
1087488190 11:98785987-98786009 CTTGGGATTCACCTCAGCCCAGG + Intergenic
1087586408 11:100127517-100127539 CTTGAACTTAACCACTTCCAGGG - Intronic
1088703934 11:112443614-112443636 CTTGAACAACACCATAGACCAGG - Intergenic
1088735848 11:112727209-112727231 CTTAATCCTCACCACAGCACTGG + Intergenic
1091371747 11:135066166-135066188 CGTGAGCTTCACCAGGGCCCTGG + Intergenic
1092153032 12:6264137-6264159 ATTCAGCTTCACAACAGCCCTGG - Intergenic
1096550303 12:52367780-52367802 TTTGAACTCCACAACAGCCTGGG + Intergenic
1097355494 12:58596241-58596263 CTTGGACTTAAACACAGACCTGG + Intronic
1098051994 12:66463922-66463944 ATTGAACTGCACAACACCCCTGG + Intronic
1100133626 12:91526820-91526842 ATTGAACTTCATAACAACCCAGG + Intergenic
1100265709 12:92973953-92973975 CCTGAACTTGTACACAGCCCTGG + Intergenic
1100594454 12:96060068-96060090 CTTGAACTTCAGCACTTTCCAGG + Intergenic
1101523264 12:105504382-105504404 TTTAATCTTCACAACAGCCCAGG - Intergenic
1102015885 12:109647743-109647765 CTGGATCTTCACCCCAGCTCTGG + Intergenic
1104555565 12:129797136-129797158 GTAGAATTTCCCCACAGCCCAGG + Intronic
1107523002 13:41201843-41201865 CTTGCACTGCACTACAGCCTGGG - Intergenic
1110658291 13:78026855-78026877 CAAGAACTTTACCACAACCCAGG - Intergenic
1111956529 13:94765152-94765174 CTTGAACTTCATCAATGCCCAGG - Intergenic
1112045947 13:95597942-95597964 CTTAAAGACCACCACAGCCCAGG - Intronic
1113347509 13:109494552-109494574 ATTGAAATTCACCACATCCCCGG + Intergenic
1115124927 14:29980947-29980969 CCTGAACTTCACATCATCCCTGG - Intronic
1115376945 14:32686812-32686834 CTGGAACTTCACCACAGGAGTGG - Intronic
1116706612 14:48310798-48310820 CTTGGCCTTCTCCACAGCTCAGG - Intergenic
1117312535 14:54542286-54542308 CTTTTACATCATCACAGCCCAGG - Intergenic
1117371410 14:55081678-55081700 CTTGAACCTCACCACTGGCCTGG + Intergenic
1119183582 14:72620559-72620581 TTTGAAGTTAACCACAACCCTGG - Intronic
1121274354 14:92657636-92657658 CTTGAACTTCCCCACTGTCCTGG - Intronic
1121715647 14:96071901-96071923 CTTGAGCTTCAGCACAGTTCTGG + Intronic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1122915538 14:104856702-104856724 CTACATCTTCACCAGAGCCCTGG + Intergenic
1125728403 15:41879846-41879868 CTAGAACTTCCTCACTGCCCTGG - Exonic
1128366838 15:67010343-67010365 CTAGAACGTCAGCTCAGCCCAGG + Intergenic
1129396289 15:75249769-75249791 TTTGATCCTCACAACAGCCCTGG + Intergenic
1129416415 15:75384816-75384838 TTTGATCTTCACAACTGCCCTGG + Intronic
1130709376 15:86264733-86264755 CTTGAAGTCCACCACAGAGCTGG - Exonic
1130879474 15:88042748-88042770 CTTAATCATCACCACAACCCTGG + Intronic
1131152305 15:90054624-90054646 CTTGAACTTCATCAGGGCCTGGG - Intronic
1133184590 16:4086408-4086430 CTTGTCCTTCATCACAGGCCTGG - Intronic
1135549352 16:23386310-23386332 CTTAAACCTCACCACAGACTGGG - Intergenic
1136042926 16:27594503-27594525 CTTGAAAGTCACCTCGGCCCTGG + Intronic
1136427999 16:30182163-30182185 CTTGAACTTCTCCACACGACAGG + Intergenic
1137401492 16:48157240-48157262 CTTGATCTTCGCAACAACCCCGG + Intergenic
1140142462 16:72271739-72271761 CATCAGCTTCCCCACAGCCCTGG + Intergenic
1142856924 17:2736016-2736038 CTTCAACTTCACCACAGTCCAGG + Intergenic
1143761521 17:9107582-9107604 TTTGAACTTCTCCACAGGCTGGG + Intronic
1147565829 17:41536048-41536070 CTTGAGCCTCCGCACAGCCCAGG + Intergenic
1149895733 17:60426957-60426979 CTTGACCTTTACCCCTGCCCTGG + Intronic
1151471371 17:74320111-74320133 CTTCAGCTTCACCTCAGCCCAGG - Intergenic
1151971302 17:77458877-77458899 CTAGAATTTCACCAGAGCTCAGG + Intronic
1154260250 18:12825390-12825412 TTTGACCTTCAGGACAGCCCCGG + Intronic
1157169247 18:45386832-45386854 CATCATCTTCACAACAGCCCTGG - Intronic
1159861116 18:73650862-73650884 CTTGGACTCCACCACAGCAGTGG - Intergenic
1160246630 18:77164978-77165000 CTAGAAATTCACCACAGCCCTGG - Intergenic
1160456826 18:79007430-79007452 CTTCTACTTCATCACAGCACAGG - Intergenic
1160958728 19:1707594-1707616 CTTGGCTTTTACCACAGCCCAGG + Intergenic
1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG + Exonic
1163138920 19:15332922-15332944 CCTCCACTTCACCCCAGCCCCGG - Intergenic
1163333998 19:16659961-16659983 CTTAAAGTTCAGCACCGCCCCGG + Exonic
1165176776 19:33936239-33936261 CTTAACCTTAACCACACCCCCGG + Intergenic
1166018824 19:40006079-40006101 CTTGTTCTTCCCCCCAGCCCCGG + Exonic
1166174527 19:41057356-41057378 CTTGATCCTCCCCACACCCCTGG - Intergenic
1167449352 19:49557807-49557829 CTGGAACTGCAGCACCGCCCAGG - Intronic
1167835550 19:52065625-52065647 CTTTAACTCCACTACAACCCTGG - Exonic
925104715 2:1281670-1281692 CTTCACCTTCATCACAGCCATGG - Intronic
925422571 2:3724836-3724858 CTTGAACCTCACCTCTGCCAGGG - Intronic
927699205 2:25257384-25257406 CTGGTACTTCACCCCAGTCCTGG - Intronic
928557375 2:32441388-32441410 CTTGAAGTAAATCACAGCCCCGG - Exonic
930698547 2:54436111-54436133 CTTATAATCCACCACAGCCCAGG + Intergenic
931110062 2:59100831-59100853 CTTGGACTACACCACTGCCAGGG - Intergenic
931495723 2:62804950-62804972 CCTGCCCTTCACCCCAGCCCTGG + Intronic
932121129 2:69101476-69101498 TTTAAACCTCACCACAGCCTGGG - Intronic
932322470 2:70832323-70832345 CTAGAACTACGCCAGAGCCCAGG + Intronic
932524075 2:72444767-72444789 CTTAGACTTCACCACAGCACAGG + Intronic
934884618 2:98013781-98013803 CTTAAGCTTCACCACAGGCAGGG - Intergenic
935694551 2:105760308-105760330 TTTGCATTTCTCCACAGCCCAGG - Intronic
942563024 2:177240243-177240265 CTTGCACTTCCTCAAAGCCCTGG - Intronic
942869999 2:180722984-180723006 CTTCAACTCCAGCACTGCCCAGG + Intergenic
943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG + Intergenic
945104757 2:206299588-206299610 CTTGAACTGCACTCCAGCCTGGG + Intronic
946708790 2:222485712-222485734 CTTCATCTTCCCCACACCCCAGG + Intronic
947158086 2:227183927-227183949 CTTGATTCTCACAACAGCCCTGG + Intronic
947450475 2:230203520-230203542 TTTGAACTTCCCGCCAGCCCTGG - Intronic
947461746 2:230309736-230309758 CCTGAACTTCACTGCAGACCAGG + Intronic
947470824 2:230399939-230399961 CCTGAACTTCACTGCAGACCAGG + Intronic
947761923 2:232609688-232609710 CTTCACCTTCAGCCCAGCCCAGG + Intronic
1169111177 20:3035159-3035181 CATGGGCTTCACCACCGCCCAGG - Intronic
1169869294 20:10234194-10234216 TTTGAACTTCATCACAGTTCTGG + Intronic
1170948607 20:20913814-20913836 CTTTAACTTCTCAGCAGCCCGGG + Intergenic
1171032010 20:21685213-21685235 CTTGAGCTTCACAACAGCCCTGG - Intergenic
1172116122 20:32574621-32574643 CTTGAACATTTCCTCAGCCCGGG + Intronic
1172610882 20:36251697-36251719 CTTGATCTTTACCACAGCCTGGG - Intronic
1173369137 20:42419261-42419283 CTTGAACTTTATTCCAGCCCTGG - Intronic
1173413518 20:42836524-42836546 CTTGAATTTCAAGACAGACCTGG - Intronic
1173860985 20:46283426-46283448 CTTCATCCTCACCATAGCCCCGG - Intronic
1175486974 20:59353703-59353725 CTTGGACCTCAGCACAGCCCTGG + Intergenic
1176101380 20:63366031-63366053 CTGGAGCCTCACCAGAGCCCAGG + Intronic
1177145239 21:17400013-17400035 CTTCAACTTCACTCCAGCCTGGG + Intergenic
1177761975 21:25412346-25412368 CTTGAACTTAAACACAGCCCAGG + Intergenic
1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG + Intronic
1178605899 21:34036362-34036384 TTTGATCCTCACCACTGCCCGGG - Intergenic
1179138837 21:38704468-38704490 CTTGAACTTCACAATGGTCCTGG - Intergenic
1179725302 21:43338530-43338552 CTGGAAGTTCCCCACTGCCCTGG - Intergenic
1180848045 22:18995112-18995134 CTTGAGCTACAGCGCAGCCCTGG - Intergenic
1181618224 22:24069896-24069918 CTCTAACCTCGCCACAGCCCAGG - Intronic
1183598325 22:38825399-38825421 CTTGACCTTCCCAACAGCACTGG - Intronic
1184484040 22:44765521-44765543 CTTGGACCTCACTGCAGCCCAGG - Intronic
950197627 3:11020298-11020320 CCAGAACTCCACCACAGCGCTGG - Exonic
950500537 3:13360769-13360791 CTTGAAAATACCCACAGCCCTGG + Intronic
950814936 3:15691049-15691071 CTTGAATATCACCACATACCAGG + Intronic
952154451 3:30627644-30627666 CTTAAACCTTAACACAGCCCAGG - Intronic
952645926 3:35658791-35658813 CCTGAAATTCAGCACAGCACAGG - Intronic
952655173 3:35777307-35777329 CCTGACCTTCACAAAAGCCCTGG + Intronic
953569007 3:44057041-44057063 CTTGACCCTCACCTCAGCGCTGG + Intergenic
956759953 3:72432414-72432436 CTTCCACTGCACCACTGCCCTGG + Intronic
961566168 3:127764572-127764594 CTTGAACCTCATTACAGCCTTGG - Intronic
962270914 3:133977528-133977550 CTTCTCCTTCACCTCAGCCCAGG - Intronic
963475967 3:145805115-145805137 GTGGAACTTCCCCACAGGCCTGG - Intergenic
964354291 3:155835780-155835802 CTTGCATTTCACCACAGATCTGG + Intronic
965369995 3:167850093-167850115 CTTGAACTCAACCACTGCCATGG + Intergenic
969670129 4:8585613-8585635 CTGGATCCTCACCACAGCCTGGG + Intronic
970740827 4:19235612-19235634 CTTGAACTTGACAACCTCCCTGG - Intergenic
984596057 4:181669254-181669276 TTTAATCTTCACCACAACCCAGG + Intergenic
988330878 5:29838287-29838309 CTTGAACTTGGCCACATTCCAGG - Intergenic
992888640 5:81183843-81183865 CTTTAACTTCATCACATCCTTGG - Intronic
997243588 5:132326985-132327007 GATGAACTTCTCCAGAGCCCTGG + Intronic
998379569 5:141714472-141714494 TTTGATCTTCACCACAGGCCTGG - Intergenic
998644086 5:144043074-144043096 GTTGAACTTCAACACTTCCCGGG - Intergenic
999854245 5:155576474-155576496 CATGAACTTCACAAGTGCCCAGG - Intergenic
1000977153 5:167777655-167777677 TTTGATCTTCACAACAACCCTGG - Intronic
1004565493 6:16792093-16792115 CTTGAACTTCAACCCTCCCCTGG + Intergenic
1005421916 6:25660115-25660137 CTGGATCTTCACAACGGCCCTGG - Intronic
1006665821 6:35692397-35692419 CTTGTACTTGAACTCAGCCCAGG + Intronic
1008192926 6:48482110-48482132 CTTGTACCTGTCCACAGCCCGGG + Intergenic
1008675205 6:53811769-53811791 CCTGGACTTAACCCCAGCCCAGG - Intronic
1013944591 6:115706475-115706497 CTTGAACTGGACCACAGGTCAGG - Intergenic
1014981417 6:127950440-127950462 CTTGAAATTAGCCACAGCACCGG + Intergenic
1015154337 6:130075121-130075143 GTTGAAGTTCAGAACAGCCCAGG - Intronic
1016558611 6:145368970-145368992 CCTGAACCCCATCACAGCCCTGG + Intergenic
1016981685 6:149860551-149860573 CTTGAACCTCACGACAGCCTGGG + Intronic
1018337510 6:162810014-162810036 CAGGAATTTCACCACTGCCCAGG + Intronic
1018762403 6:166903714-166903736 CTGGAACTCCGCCACATCCCAGG + Intronic
1019337462 7:492115-492137 CTTGGGCTGCACCACTGCCCTGG - Intergenic
1019888827 7:3928927-3928949 GCTGAACTGCAGCACAGCCCTGG + Intronic
1020960795 7:14799542-14799564 CTTGAACTTCCCCACACCACTGG - Intronic
1024827343 7:53406864-53406886 TTGCAACTGCACCACAGCCCAGG - Intergenic
1024944869 7:54798423-54798445 ACAGAACTTCACCCCAGCCCAGG + Intergenic
1026352030 7:69525999-69526021 CTTGAATTTCTCCACACTCCAGG + Intergenic
1030347676 7:108453322-108453344 CTTGAAATTTTCTACAGCCCAGG + Intronic
1031597087 7:123660650-123660672 CTTTATCTTCTCTACAGCCCTGG - Intronic
1032697608 7:134350872-134350894 CTTGAAATTCATCATTGCCCTGG - Intergenic
1036642813 8:10594598-10594620 CATGAACTTCTCCACGGCTCAGG - Intergenic
1040440654 8:47438177-47438199 CTTGAACTTGAGCAGACCCCTGG + Intronic
1041691124 8:60688271-60688293 CTTAACCTTCACCATAACCCTGG - Intronic
1043517081 8:81004881-81004903 CATGCACTTGACCACAGCCAGGG + Intronic
1048928347 8:139290948-139290970 CTTCAACTACACCGTAGCCCTGG + Intergenic
1051356595 9:16244860-16244882 CTTAATCTTCACAACATCCCAGG - Intronic
1051587710 9:18744626-18744648 CTTGAACCTCATAACAGCCCTGG + Intronic
1053459748 9:38259068-38259090 CTTAATCCTCACCACAGCCTTGG - Intergenic
1054747453 9:68869147-68869169 CTGGTACTTGTCCACAGCCCAGG - Intronic
1054864508 9:69986339-69986361 ATTACTCTTCACCACAGCCCAGG - Intergenic
1058544990 9:106051907-106051929 CTTGATTCTCGCCACAGCCCTGG + Intergenic
1059383986 9:113949916-113949938 CCTGAACTGCACCAGAGGCCAGG - Intronic
1059944362 9:119393735-119393757 CTTGTACTACACTACAGCCAAGG - Intergenic
1062217237 9:135395850-135395872 CTTGGCCATCACCATAGCCCTGG + Intergenic
1062261298 9:135664525-135664547 CTCGAACCTCACCCCAGCCTTGG - Intronic
1062481632 9:136755094-136755116 CGGGAACTTCAGCACAGGCCAGG + Intronic
1186021130 X:5256721-5256743 CTTGGACTGAACCACAGCACTGG + Intergenic
1189720014 X:43906242-43906264 CCTTAAATTCTCCACAGCCCAGG + Intergenic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1191650025 X:63527023-63527045 CTGTCACTTCACCACACCCCAGG + Intergenic
1198631800 X:138647246-138647268 CTTGAACTTCTCAAGAGTCCTGG - Intronic