ID: 1122218710

View in Genome Browser
Species Human (GRCh38)
Location 14:100221656-100221678
Sequence CCCCAAAGGCTGCTCTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122218706_1122218710 25 Left 1122218706 14:100221608-100221630 CCTCTCTGTGTAAGGCTTGCGAT No data
Right 1122218710 14:100221656-100221678 CCCCAAAGGCTGCTCTTAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122218710 Original CRISPR CCCCAAAGGCTGCTCTTAAC TGG Intergenic
No off target data available for this crispr