ID: 1122218930

View in Genome Browser
Species Human (GRCh38)
Location 14:100222881-100222903
Sequence TGATTTATACAGTGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122218917_1122218930 29 Left 1122218917 14:100222829-100222851 CCTGGCTTGTCGGTGGAGTAGGT No data
Right 1122218930 14:100222881-100222903 TGATTTATACAGTGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122218930 Original CRISPR TGATTTATACAGTGGGTGGA TGG Intergenic
No off target data available for this crispr