ID: 1122219587

View in Genome Browser
Species Human (GRCh38)
Location 14:100228045-100228067
Sequence GCGTGTGTGTGCATTCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122219587_1122219588 16 Left 1122219587 14:100228045-100228067 CCACAGGGAATGCACACACACGC No data
Right 1122219588 14:100228084-100228106 TGTATCCAACTATTTCCCCTAGG No data
1122219587_1122219591 30 Left 1122219587 14:100228045-100228067 CCACAGGGAATGCACACACACGC No data
Right 1122219591 14:100228098-100228120 TCCCCTAGGTGGTTTCTAGAAGG No data
1122219587_1122219589 19 Left 1122219587 14:100228045-100228067 CCACAGGGAATGCACACACACGC No data
Right 1122219589 14:100228087-100228109 ATCCAACTATTTCCCCTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122219587 Original CRISPR GCGTGTGTGTGCATTCCCTG TGG (reversed) Intergenic