ID: 1122219591

View in Genome Browser
Species Human (GRCh38)
Location 14:100228098-100228120
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122219587_1122219591 30 Left 1122219587 14:100228045-100228067 CCACAGGGAATGCACACACACGC No data
Right 1122219591 14:100228098-100228120 TCCCCTAGGTGGTTTCTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122219591 Original CRISPR TCCCCTAGGTGGTTTCTAGA AGG Intergenic