ID: 1122221000

View in Genome Browser
Species Human (GRCh38)
Location 14:100239122-100239144
Sequence GGAAGGCGGCGAGCGGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 1, 2: 6, 3: 48, 4: 500}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122221000_1122221012 5 Left 1122221000 14:100239122-100239144 CCCCCGCCCGCTCGCCGCCTTCC 0: 1
1: 1
2: 6
3: 48
4: 500
Right 1122221012 14:100239150-100239172 CTGCCTTCCTTCCCCACGGCCGG 0: 1
1: 0
2: 4
3: 51
4: 334
1122221000_1122221010 1 Left 1122221000 14:100239122-100239144 CCCCCGCCCGCTCGCCGCCTTCC 0: 1
1: 1
2: 6
3: 48
4: 500
Right 1122221010 14:100239146-100239168 CCCTCTGCCTTCCTTCCCCACGG 0: 1
1: 0
2: 9
3: 97
4: 877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122221000 Original CRISPR GGAAGGCGGCGAGCGGGCGG GGG (reversed) Exonic