ID: 1122225549

View in Genome Browser
Species Human (GRCh38)
Location 14:100275715-100275737
Sequence GCTCACAGGCAGAAGGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 480}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122225549 Original CRISPR GCTCACAGGCAGAAGGGAGA GGG (reversed) Intronic
900247433 1:1643737-1643759 ACTCACAGGCAGATGTGAGCAGG + Intronic
900258657 1:1710874-1710896 ACTCACAGGCAGATGTGAGCAGG + Intronic
900505915 1:3029698-3029720 GCTCACAGGCCCCAGGAAGAAGG + Intergenic
900655384 1:3754309-3754331 GCTCGCAGGCTGAAGGGTGCAGG - Intronic
900816258 1:4848660-4848682 CTTCACAGGGAGAGGGGAGATGG + Intergenic
901063312 1:6483842-6483864 GCTCCCAGGAAGAGGGGACAAGG - Intronic
901076084 1:6555505-6555527 GCAGACAGCCAGAATGGAGAGGG - Exonic
901289640 1:8113953-8113975 GCTGACAGGCAGCAAGGAAAGGG - Intergenic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902508962 1:16955304-16955326 GCTCACAGGCAGAAGAGCTTCGG + Exonic
902586510 1:17442233-17442255 GCACCCAGGCTGAAGGGTGATGG + Intergenic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
903692266 1:25182984-25183006 GCTCACTGGCAGAAGGAAACAGG + Intergenic
903967891 1:27101386-27101408 CCACACAGGCACAAGGGAGGGGG - Intronic
904326729 1:29731369-29731391 GCTCAAAGGCAGAAGTCAGGAGG + Intergenic
904359375 1:29962061-29962083 GCTCACAGTCAGGAGGGGCATGG - Intergenic
904475432 1:30761965-30761987 CCTCAAAGGCAGAAGTGAGGTGG - Intergenic
904901713 1:33862757-33862779 GCTCACAGGGAGGAAGGGGATGG + Intronic
904936932 1:34137555-34137577 GTTCAAAGGCAGAAGGGTGAAGG - Intronic
905017965 1:34790699-34790721 GGTCACAGCGAGAAGGGTGAGGG + Intronic
905102175 1:35533837-35533859 GCTGACAGTCAAAAGGGAGGTGG - Intronic
905276970 1:36824699-36824721 GCCCAGAGGGAGAAGGCAGAGGG + Intronic
906719677 1:47996497-47996519 GCTCCCAGCCAGGAGCGAGAAGG - Intronic
907255681 1:53177023-53177045 GCTGGCACACAGAAGGGAGAGGG - Intergenic
908034125 1:60033599-60033621 GCTCACAGCCAGAAGTGAACAGG - Exonic
908731250 1:67228822-67228844 TCTTATAAGCAGAAGGGAGAAGG - Intronic
909663001 1:78104656-78104678 GCTAAAGGGGAGAAGGGAGAAGG + Intronic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
911331988 1:96535338-96535360 GCTCACAGTCAGATGGCAGAGGG + Intergenic
911499860 1:98672461-98672483 GCTCACAGGAAGAAAGAAGAGGG + Intronic
911769314 1:101719160-101719182 GCACAAAGGCAGAAGGGTAAGGG + Intergenic
912915591 1:113811876-113811898 GCTCACCGTCAGAGGCGAGAAGG + Exonic
914918462 1:151832258-151832280 GGTGACAGGCATAGGGGAGATGG + Intergenic
915858710 1:159419083-159419105 GCTCACAGGCAAAGGGGACTTGG + Intergenic
915954171 1:160209062-160209084 GCTCACATCCAGAGGGGTGAGGG - Intronic
916585543 1:166146684-166146706 GCTCAAATTCAGAAGGCAGAGGG + Intronic
917547412 1:175984959-175984981 ACTCATAGGCAGAAGGGACTTGG + Intronic
917829989 1:178872345-178872367 GCTCACAAGAAGAATGGAGCAGG + Intronic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
919824155 1:201492044-201492066 GCTCCCAAGAAGGAGGGAGAGGG + Intronic
920007913 1:202846814-202846836 GCACACAGGGAGAAGGGTCATGG - Intergenic
920013120 1:202884678-202884700 GCCCACAGGCAGACGCGTGACGG + Intronic
921412288 1:214848759-214848781 GCTGAAAGGCAGGAGGAAGATGG - Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922459715 1:225806038-225806060 GCTCACAGGCAACAGAGACAAGG - Intergenic
922618994 1:226979314-226979336 GTTCACAGGCAGAAGGCGGCAGG - Intronic
922663446 1:227449452-227449474 ACTGACGGGCAGAAGGCAGAAGG + Intergenic
922933675 1:229408498-229408520 GCTTCCAGGCAGAATGAAGAAGG - Intergenic
923135982 1:231119591-231119613 GCTCAACAGCAGATGGGAGATGG + Intergenic
1064473248 10:15658802-15658824 GCTCTCAGGCAGCAGTGAGGTGG - Intronic
1066226313 10:33386874-33386896 CCTGACAGGCAGAGGGAAGATGG + Intergenic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067735370 10:48846358-48846380 GCTCACAGCCAGGCTGGAGAGGG - Intronic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1069107138 10:64397100-64397122 ACTCAGGGGCATAAGGGAGAAGG + Intergenic
1069374800 10:67782941-67782963 GGTCACATTCAGAAGTGAGAGGG + Intergenic
1069892856 10:71662722-71662744 GCTCACAGTCAGAAAGGACTTGG - Intronic
1069996459 10:72344857-72344879 GCCCACAGGCAGATGGGAGGTGG + Intronic
1070629059 10:78071441-78071463 GCAACCAGGCAGAGGGGAGAAGG - Intergenic
1070630435 10:78080936-78080958 CCCCACAGGCAGAGAGGAGAAGG + Intergenic
1070652232 10:78245698-78245720 GCTCCCTGGCAGAGGGAAGAAGG + Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1072991915 10:100204013-100204035 CCTCACATGCAGAAGGGATGAGG + Intronic
1073313794 10:102563845-102563867 GCTCTTACGCAGAAGGGACAGGG + Intronic
1073561277 10:104498901-104498923 GCGCACACACAGAAGGGAGGAGG - Intergenic
1074290051 10:112131593-112131615 GCTCCCAGACAGAAGGCAGGTGG - Intergenic
1074290446 10:112134223-112134245 GCTGAAAAACAGAAGGGAGAGGG + Intergenic
1074894308 10:117761830-117761852 GCTCACATTCAGAAGGGACCTGG - Intergenic
1075090908 10:119443833-119443855 GCAAACAGGCTGAAGGGACAGGG + Intronic
1075647687 10:124107407-124107429 GGTCAGAGGCAGAAGGGTGGTGG + Intergenic
1075674106 10:124283850-124283872 GCTGACAGGCAAATGGGAGCGGG - Intergenic
1075714032 10:124545581-124545603 GCTCCCAGGTAGCAGGAAGAAGG + Intronic
1075979412 10:126723889-126723911 GCTCACATTCAGTAGGGAGCAGG + Intergenic
1076074994 10:127526469-127526491 ACTTTCAGGCAGAAGGGAGGGGG + Intergenic
1076107707 10:127836450-127836472 ACTCACATGCAGAATGGAAATGG + Intergenic
1076121926 10:127943473-127943495 TCTCCCATGCAGGAGGGAGACGG + Intronic
1076269726 10:129141129-129141151 GTTCACAGGCTGCAGGGAGCAGG + Intergenic
1076530464 10:131141307-131141329 GCTCTAAGGCAGGAGGAAGAAGG - Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077319930 11:1936573-1936595 GCTCAGCGGCTGAAGGGAGCTGG + Intronic
1077329508 11:1977847-1977869 GCTGCCTGGCAGATGGGAGATGG - Intronic
1077562207 11:3271108-3271130 ACCCACAGGCAGGAAGGAGAGGG - Intergenic
1077562325 11:3271552-3271574 GCTCACTGGCAAAGGGGAGCAGG - Intergenic
1077568101 11:3316928-3316950 ACCCACAGGCAGGAAGGAGAGGG - Intergenic
1077568219 11:3317372-3317394 GCTCACTGGCAAAGGGGAGCAGG - Intergenic
1077893662 11:6437758-6437780 GCTCACAGCCATCAGAGAGATGG + Intronic
1077895684 11:6451488-6451510 GGGCACAGACAGAAGGGAGTAGG + Intronic
1077959547 11:7060182-7060204 TGTCTCAGGCAGAAGAGAGAGGG - Intronic
1077995203 11:7446802-7446824 GCTCACAGACAGAAAGGGCAGGG - Intronic
1079243225 11:18735390-18735412 GCAGACAAGGAGAAGGGAGACGG - Intronic
1079450183 11:20594321-20594343 ACACACAGACAGAAGAGAGAGGG + Intergenic
1080986809 11:37477510-37477532 GCTGACAGGCAGAGGGCATAGGG - Intergenic
1081237141 11:40659359-40659381 GTTCCCAGGCAGAAAGGAGGGGG + Intronic
1081964673 11:47162262-47162284 GCTCCTAGGCTGAGGGGAGAAGG + Intronic
1083201724 11:61124865-61124887 CCTCCCAGGAAGAAAGGAGAGGG + Intronic
1083325133 11:61869318-61869340 GGTCACAGGCACAGGGCAGAGGG - Intergenic
1083923278 11:65791721-65791743 GCCCCCAGGCAGTAGGAAGAGGG + Intronic
1084327718 11:68411414-68411436 GCTGGAAGGCACAAGGGAGAAGG - Exonic
1084459897 11:69290902-69290924 GCTCACAGGCAGAAGGGTCAGGG + Intergenic
1084961267 11:72717988-72718010 GCCCACGGCAAGAAGGGAGAGGG + Intronic
1085696138 11:78706397-78706419 GCTCAGAGGCATGAGTGAGAAGG - Intronic
1088233029 11:107692542-107692564 GCTCAATAGCAGAAAGGAGATGG + Intergenic
1088588509 11:111380314-111380336 GCTCTGTGGCTGAAGGGAGAAGG - Intronic
1089442439 11:118528714-118528736 CCTCTCAGGCAGCAGGCAGATGG - Exonic
1089660448 11:119982030-119982052 GTTCACAGGCAGCCGGGAGTGGG - Intergenic
1089782551 11:120883801-120883823 GATCTCAGGCAGAAGCGTGATGG - Intronic
1091054250 11:132403812-132403834 GCTCACTGGGAGAAGTGGGAGGG + Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1202812487 11_KI270721v1_random:33026-33048 GCTGCCTGGCAGATGGGAGATGG - Intergenic
1092957864 12:13566122-13566144 ACTCACAGCCAGAAAGGACACGG + Intronic
1094117462 12:26932712-26932734 GCTCTCTGGGAGACGGGAGAGGG - Intronic
1094145674 12:27226149-27226171 GCGTATAGGAAGAAGGGAGAAGG + Intergenic
1096492896 12:52022863-52022885 GCTCCCAGTCTGTAGGGAGACGG - Exonic
1096546796 12:52345657-52345679 TCTCACAGGCAGGAGGAAGAGGG + Intergenic
1096899253 12:54857656-54857678 GCACACAGGCAGAAAGAAAAAGG + Intronic
1097210915 12:57368924-57368946 GCACACAGTCAGCAGGGCGAGGG + Intronic
1097725184 12:63067070-63067092 GCTTGAAAGCAGAAGGGAGAAGG - Intergenic
1098854013 12:75631761-75631783 GGTAAAAGGCAGAAGGGTGAGGG + Intergenic
1099487848 12:83249976-83249998 GCTCATAGGCAGAAGGGACTTGG + Intergenic
1100341478 12:93683614-93683636 GCCCACAGGTAGAGGGGAAATGG - Intronic
1100515099 12:95319888-95319910 GGTCACAGAGAGAAGGGAAATGG - Intergenic
1102148817 12:110674340-110674362 GCTCATAGGCAAAAGGGACTTGG + Intronic
1103952521 12:124558742-124558764 AGTCACAGTCAGGAGGGAGAGGG + Intronic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1105306227 13:19170817-19170839 ACTTACAGGCAGGAAGGAGATGG + Intergenic
1105827043 13:24132110-24132132 GTGCCCAGGGAGAAGGGAGAAGG - Intronic
1105891572 13:24685979-24686001 TCTTAGAGGCAGAAGGGACATGG + Intronic
1106629898 13:31460389-31460411 GTTCACAGGGAAAAGGGAGCTGG - Intergenic
1106683735 13:32034710-32034732 ACTCAGAGGCAAAAGGGAGCTGG - Intronic
1107152401 13:37127406-37127428 GCTCACAAGCAGAAGGAACTTGG - Intergenic
1107187929 13:37546375-37546397 GCTCACAGGGAGAAGAGACTGGG + Intergenic
1107203626 13:37753863-37753885 GCTGAAAGACAGAAGAGAGAGGG - Intronic
1108379486 13:49842422-49842444 CCTCACATGGAGAAGGCAGAAGG - Intergenic
1109853332 13:68097894-68097916 GATCCCAGGCAGGAAGGAGATGG + Intergenic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1111186345 13:84741340-84741362 GCTGACAGCCAGCAAGGAGATGG - Intergenic
1112992534 13:105531732-105531754 GTTCTCAGGCAAAAGGGAAAAGG + Intergenic
1113166907 13:107452766-107452788 GCTCATAGGCAGAAGGCTTATGG - Intronic
1113240990 13:108336671-108336693 GCTCACAGACAGCAGAGTGAGGG - Intergenic
1113645114 13:111989369-111989391 GATCTCAGGCAGAAGGCAGAAGG - Intergenic
1114386022 14:22255809-22255831 TCTCATAGCCAAAAGGGAGAGGG + Intergenic
1114528385 14:23380144-23380166 GCCCACAGGACGCAGGGAGAGGG + Intergenic
1114559108 14:23578145-23578167 GCAGACAGGCAGAAGGGAGGGGG + Intronic
1115160554 14:30389154-30389176 GCTTAAAGGTAAAAGGGAGATGG + Intergenic
1115490368 14:33952492-33952514 CCTCAGAGGCAGAGAGGAGAGGG - Intronic
1116547341 14:46185112-46185134 GCTGACAGGCAGCAGAGAAATGG + Intergenic
1119181843 14:72610704-72610726 GCTCAAGGGCAGGTGGGAGATGG + Intergenic
1119422237 14:74514270-74514292 GAACACAGGAAGAAGGCAGATGG - Intronic
1119442495 14:74637672-74637694 GATGAGGGGCAGAAGGGAGACGG - Intergenic
1120381339 14:83783932-83783954 TTTCACAGGTAGAAGGGACAAGG - Intergenic
1121161281 14:91743712-91743734 CCTCCCATGCAGAAGGCAGAAGG - Intronic
1121422322 14:93824505-93824527 CTTCACAGCCAGGAGGGAGACGG - Intergenic
1121641213 14:95486023-95486045 GATGCCAGGCAGAAGGGAGAAGG + Intergenic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122271323 14:100569544-100569566 GCTCACAGCCAGGAGGGGAAAGG - Intronic
1122707213 14:103629003-103629025 GGTCACAGGGAGGAGGGTGACGG - Intronic
1122809660 14:104281696-104281718 GCACACCAGCAGAGGGGAGAGGG - Intergenic
1124045413 15:26145260-26145282 GCTCATAGACAGTAGGGAGTTGG + Intergenic
1124546677 15:30634729-30634751 GCTCACTGACAGCAGGGAGAGGG - Intronic
1124780282 15:32624729-32624751 GCTCACTGACAGCAGGGAGAGGG - Intronic
1125270411 15:37932801-37932823 TCTTTCAGGAAGAAGGGAGATGG + Intronic
1125587593 15:40832050-40832072 GCCCTGTGGCAGAAGGGAGATGG + Intergenic
1128761247 15:70217470-70217492 TATCACAGGCAGGAGGCAGAAGG + Intergenic
1129380030 15:75158856-75158878 GCCATCAGGCAGGAGGGAGAGGG - Intergenic
1129530154 15:76258964-76258986 GCTCACAGGCAGAGGGCATCAGG - Intronic
1129876542 15:78979154-78979176 GAGCCCAGGCAGAAGAGAGACGG + Intronic
1129976518 15:79826696-79826718 GCTTTCATGCAGAAGGCAGAGGG - Intergenic
1130369828 15:83275713-83275735 GCTCTCAGGCACAATAGAGATGG + Intronic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131766551 15:95682004-95682026 GCTGAGAGGCAGAAGAGAGCTGG - Intergenic
1132056270 15:98651692-98651714 GAACACAGGCAGGAGGGAGGGGG + Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1132782348 16:1634519-1634541 GCCCACACGGAGAAGGGAAAAGG - Intronic
1133290625 16:4718453-4718475 CCCCACTGGCAGAAGGGAAATGG + Intronic
1133653065 16:7831241-7831263 GCTCACATACAGAAGTGAGGAGG - Intergenic
1134229796 16:12419895-12419917 TCTGACTAGCAGAAGGGAGATGG + Intronic
1134387007 16:13782593-13782615 GCTTCCAGGCAGAAGGAACAAGG - Intergenic
1134841823 16:17407718-17407740 GCACATAGCCAGAAGGTAGAAGG - Intronic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135899238 16:26441514-26441536 GCTGGAAGGCAGAAGGGAGATGG - Intergenic
1136183886 16:28573628-28573650 GCTGACAGTCGGAGGGGAGATGG + Intronic
1136279508 16:29199705-29199727 ACTCAGAGGCAGAAAGGAGGCGG - Intergenic
1136476965 16:30519543-30519565 GCTAACAGGCAGAGGGGAGGAGG + Intronic
1136737488 16:32477096-32477118 GCTCCCAGGCCGAAGGCAGCAGG + Intergenic
1137846657 16:51696347-51696369 GCTCATATGCAGGAGGGGGAAGG + Intergenic
1137926442 16:52546505-52546527 GCTCAAAGGTAGAAGAGACATGG + Intronic
1138840147 16:60491757-60491779 TCTCTGATGCAGAAGGGAGAAGG + Intergenic
1139016809 16:62699279-62699301 GATCACTGGGAGAAGGGATAAGG + Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1139349531 16:66326576-66326598 GCTGACAGGCAGAATGGTCAAGG - Intergenic
1139648315 16:68347994-68348016 GCTCACAGCCTGATGGGAGATGG + Intronic
1139717084 16:68822350-68822372 CCTCAAAGACAGAAGGGACAAGG - Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1140709600 16:77664560-77664582 GCTCAAAGCCAGGAGGCAGAGGG - Intergenic
1140958770 16:79892707-79892729 GCTCAGAGGGAGATGGGAGGGGG - Intergenic
1140963912 16:79945181-79945203 GCTGAGAGGCATAAGGGAGGAGG + Intergenic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141570566 16:84931161-84931183 GGTCAGAGTCAGAGGGGAGATGG - Intergenic
1141796174 16:86276573-86276595 GGTCACTGGCATCAGGGAGAAGG + Intergenic
1141875080 16:86818700-86818722 GCTCAGACGCGGCAGGGAGAGGG + Intergenic
1142108573 16:88319165-88319187 CCTCACAGACAGATGGAAGAGGG + Intergenic
1142203611 16:88772442-88772464 GCCCACAGGCAGGTGGCAGAGGG + Intronic
1142373499 16:89695581-89695603 GCTCACAGGCTGCAGGGAGAAGG - Exonic
1203015583 16_KI270728v1_random:352481-352503 GCTCCCAGGCCGAAGGCAGCAGG - Intergenic
1203033918 16_KI270728v1_random:625639-625661 GCTCCCAGGCCGAAGGCAGCAGG - Intergenic
1142875340 17:2849083-2849105 CCTCAAAGGCAGAAGAGAGCGGG + Intronic
1143690421 17:8558653-8558675 GCCTACTGGCAGAAGAGAGAAGG - Intronic
1144351733 17:14403255-14403277 GCTCATAGGCAGAAGGGACTTGG + Intergenic
1144970506 17:19106269-19106291 GCTCAGAGCTGGAAGGGAGAAGG + Intergenic
1144990809 17:19232431-19232453 GCTCAGAGCTGGAAGGGAGAAGG + Intronic
1145098767 17:20055828-20055850 TCTCACAGTCAGAACGGAGGGGG - Intronic
1145215595 17:21049461-21049483 GCTTAAAGGCAGAATGGAAATGG + Intergenic
1145228027 17:21147570-21147592 GGTGCCAGGCAGAAGGGATATGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146499844 17:33354848-33354870 GGACAGAGGCAGAGGGGAGAGGG - Intronic
1146801167 17:35824129-35824151 GGTCACAGGGAGGAGGTAGAGGG + Exonic
1147139734 17:38454208-38454230 GCTCAAAGGCCGCAGGGAGTTGG - Intronic
1149310787 17:55391166-55391188 GGTCAATGGCACAAGGGAGATGG + Intergenic
1150447576 17:65239077-65239099 GTTTACAGACAGAAAGGAGATGG + Intergenic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1152022612 17:77788548-77788570 CATGTCAGGCAGAAGGGAGAGGG + Intergenic
1152033528 17:77858077-77858099 GGACACAGGCAGAAGCCAGAAGG + Intergenic
1152089047 17:78237040-78237062 GCTCCCAGGCACAATGCAGAGGG - Intronic
1152314299 17:79571389-79571411 AGGCATAGGCAGAAGGGAGAGGG - Intergenic
1152498064 17:80688555-80688577 GCTCAAAGGGAGAAAGAAGAAGG + Intronic
1152845860 17:82599452-82599474 GCTCAGAGGTGGAAAGGAGAAGG + Intronic
1153685798 18:7543826-7543848 GCTCACAGGAACAAGAGACAAGG + Intergenic
1153687864 18:7565076-7565098 AGTAACAGGCAGAAGGGACAGGG + Intergenic
1153725174 18:7946961-7946983 ACTCACAGGATGGAGGGAGAGGG - Intronic
1153976027 18:10269115-10269137 GTTCAAAGGCTGAAGAGAGAAGG - Intergenic
1154412253 18:14147848-14147870 TCTCACTAGCAAAAGGGAGAGGG - Intergenic
1156147784 18:34206981-34207003 GCTCAAAAGTAGAATGGAGATGG - Intronic
1156931149 18:42645154-42645176 ACTCAAAGGCAGATAGGAGAGGG - Intergenic
1157754566 18:50206351-50206373 GCTCAAAGTAAGAAAGGAGAAGG - Intergenic
1158201557 18:54947313-54947335 GCTCCCAGGGAGGAGGCAGAGGG + Intronic
1158241202 18:55380219-55380241 CCTCACATGGAGAAGAGAGAAGG + Intronic
1158900405 18:61957144-61957166 GACAACTGGCAGAAGGGAGAAGG - Intergenic
1159049358 18:63404327-63404349 GCAGACAGACAGAAGGGAGAAGG + Intronic
1159717735 18:71847586-71847608 GCTCATAGGCGGAAGGGACTTGG + Intergenic
1160080996 18:75727030-75727052 GAGCACAGGGAGAGGGGAGAAGG - Intergenic
1160153521 18:76413356-76413378 GCTCCTAGGCAGCAGGGAGAGGG + Intronic
1160627094 18:80218252-80218274 GCTCATAGGCAGAAAGGACTTGG - Intronic
1162539701 19:11287283-11287305 GGACACAGACAGAGGGGAGAAGG - Intergenic
1162835779 19:13316909-13316931 GCTCTCAGGTCTAAGGGAGATGG + Intronic
1162922237 19:13909945-13909967 GCTCAAAGGCAAAGGTGAGATGG + Exonic
1163197782 19:15735915-15735937 GTTAACAGGCAGATGGGAAATGG - Intergenic
1163224083 19:15943044-15943066 GTTAACAGGCAGATGGGAAATGG - Intergenic
1163512060 19:17741319-17741341 GCTCCCAGGCTGGAGGGGGAGGG + Intergenic
1165022737 19:32937214-32937236 GCTCTGAGGCTGAAGGCAGAGGG - Intronic
1165766752 19:38356431-38356453 GCTGCCAGACAGGAGGGAGAGGG + Intronic
1165806513 19:38584242-38584264 GGGCACAGGCAGAAGGGTGAGGG - Intronic
1165913520 19:39244240-39244262 GGTGACAGGCACAGGGGAGAGGG + Intronic
1165917440 19:39269384-39269406 GGTGACAGGCACAGGGGAGAGGG - Intronic
1165995038 19:39838060-39838082 GCTCTCAGGCAGATGGGATTGGG - Intronic
1166159461 19:40941170-40941192 GTTCAGAGGCAGAGGGGAGTGGG + Intergenic
1166168395 19:41009093-41009115 GTTCAGAGGCAGAGGGGAGTGGG + Intronic
1166292056 19:41869622-41869644 GCTCACAGCCAGGAGGGAAGGGG + Intronic
1166754644 19:45183032-45183054 GCCCTGAGGCAGAAGGGAAAGGG + Intronic
1166937966 19:46346443-46346465 GAACACAGGAAGAAAGGAGATGG + Intergenic
1167449772 19:49560298-49560320 GGTCACAGTCAGAAGGGTGGAGG - Intronic
1168464374 19:56589855-56589877 GCTCACTGGGAGAGGTGAGAGGG + Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925123650 2:1438485-1438507 GCTGACAGACAGAAGGCAGCAGG - Intronic
925159772 2:1675955-1675977 TCACGCAGGCAGATGGGAGAAGG + Intronic
925417473 2:3680690-3680712 GCTCACATGCTGTAGGGAAAGGG + Intronic
925900611 2:8506675-8506697 TCTCTGAGGCAGCAGGGAGAGGG + Intergenic
926107345 2:10160625-10160647 GGGCAGAGGCAGAGGGGAGAGGG - Intronic
926761045 2:16279400-16279422 TCTGACAGGGATAAGGGAGAAGG + Intergenic
927177366 2:20420056-20420078 GCTCACAGGAACAGGGAAGATGG + Intergenic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
927572189 2:24169440-24169462 GCTCACAGGAATCAGGGTGAAGG + Exonic
928331744 2:30362771-30362793 GCTAACAGGGAGAGGAGAGAAGG + Intergenic
929548595 2:42874785-42874807 GCTCTCAGGGGGAAGGGAGGGGG + Intergenic
929701416 2:44166353-44166375 GCTCATAGGCGGAAGGGATTCGG + Intergenic
929848058 2:45553790-45553812 GCTCCCAAAAAGAAGGGAGATGG + Intronic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931027861 2:58134240-58134262 TCTTAAAGGGAGAAGGGAGAGGG - Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932271229 2:70411967-70411989 GGTCACATGCAGAAGGGAGGAGG - Intergenic
932515840 2:72348158-72348180 GCTCACAGGTAGAAGGAGTAAGG + Intronic
933790900 2:85882981-85883003 GCCCATAGGCAGAAGGGACTTGG + Intronic
933864053 2:86500046-86500068 GCTCACAGGAGGAAGGGACTTGG - Intergenic
935152146 2:100447460-100447482 GGTTAGAGGCAGAAGGCAGAAGG + Intergenic
935277807 2:101490885-101490907 CCTCACATGTAGAAGGCAGAAGG - Intergenic
936266682 2:111016261-111016283 GATCACAGTCTGAGGGGAGAGGG + Intronic
936445085 2:112588752-112588774 GCCCACAGTCTGGAGGGAGAAGG - Intronic
937499247 2:122460758-122460780 GGTCACAGGAATATGGGAGAAGG - Intergenic
937527605 2:122789464-122789486 GCTCATAGGCAGAAGGGCCTTGG + Intergenic
938780657 2:134581848-134581870 GTTCAAGGGCAGGAGGGAGATGG - Intronic
939001348 2:136738770-136738792 GGACACAGGCATAAGGGACAAGG + Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940011266 2:149058079-149058101 TCACACAGTCAGAAGGCAGAAGG - Intronic
940485162 2:154288504-154288526 GCTTATAGGCAGAAAGGACATGG - Intronic
940699606 2:157024290-157024312 CCTCATAGGCAGAAGGGACTTGG + Intergenic
941653521 2:168119064-168119086 GCTCACAGGGAGGAGGGCAAGGG - Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
942801669 2:179883066-179883088 TGTCACTGGCAGAAGGGAGAGGG + Intergenic
943179463 2:184524714-184524736 GCTCCCAGGCAAAAAGGAGTAGG - Intergenic
943529778 2:189064889-189064911 GCTCAGATCCAGAAAGGAGATGG - Intronic
943880585 2:193139902-193139924 GCTCACAGGCAGAAGGGGCTTGG - Intergenic
944190881 2:197002668-197002690 TCTCCCAGGAAGAAGGGTGATGG + Intronic
946263146 2:218513547-218513569 GGTCACAGGCAGAGAGGAGTGGG - Intronic
947258382 2:228191764-228191786 GCTCAGAGGCAGCAGTGAAATGG + Intergenic
948252070 2:236537243-236537265 GCTGACAGGGAGAATGGAGGAGG + Intergenic
948570231 2:238913187-238913209 GAACACAGGCGGAAGTGAGATGG - Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
1169669727 20:8083323-8083345 GCTCACAGGCAGAGAGCAGCAGG - Intergenic
1170789615 20:19496984-19497006 ACTCACAAGGAGAAGGCAGAAGG - Intronic
1172108717 20:32532627-32532649 GGTACCAGGCAGAAGGGGGATGG - Intronic
1172878509 20:38181295-38181317 GGTCACACGAAGAAGGGAGTAGG - Intergenic
1172897053 20:38307553-38307575 GCTGGCTGGCTGAAGGGAGAAGG - Exonic
1173349414 20:42231353-42231375 GCTCACAGCCAGAATGCAGCAGG - Intronic
1173451550 20:43168739-43168761 GGGCACAGGTAAAAGGGAGAGGG - Intronic
1173616957 20:44409531-44409553 TGTGACAGGCAGATGGGAGAGGG + Intronic
1173788113 20:45809836-45809858 TCTCACTGCCAGAAAGGAGATGG - Intronic
1174637648 20:52015882-52015904 GGCAACATGCAGAAGGGAGATGG + Intergenic
1175250833 20:57609353-57609375 GCCAACAGGAAGAGGGGAGAGGG - Intronic
1175549456 20:59807903-59807925 GGTCACAGCCAGACGGCAGATGG - Intronic
1176860755 21:14010409-14010431 TCTCACTAGCAAAAGGGAGAGGG + Intergenic
1176925529 21:14744937-14744959 GCTCATAGGTAGAAGGGACTTGG - Intergenic
1177520339 21:22213687-22213709 GCACACCAGCAGAAGGAAGAAGG - Intergenic
1177968464 21:27759100-27759122 GCTCTCAGCAAGAGGGGAGATGG - Intergenic
1177989338 21:28019127-28019149 GTTCATGGGCAGAAGGGAGCAGG - Intergenic
1177992946 21:28059568-28059590 GCTCATAGGCAGAAGGGACTTGG + Intergenic
1178373808 21:32050075-32050097 AATGACAGGCAGAAGGTAGACGG + Intergenic
1179056998 21:37945329-37945351 GCTTGCACGCAGAAGGGAAATGG - Intergenic
1179162294 21:38908575-38908597 GCTGAGAGGCATAAGGCAGATGG - Intergenic
1179180757 21:39042908-39042930 GCCCACTGGCATAAGGGAGCTGG - Intergenic
1180058271 21:45370938-45370960 GCTGACAGCCAGGAGGGAGAGGG + Intergenic
1180070702 21:45434728-45434750 GCTGACTGGCAGTGGGGAGATGG + Intronic
1180975083 22:19843829-19843851 ACTCAGACCCAGAAGGGAGATGG - Intronic
1181307114 22:21923149-21923171 ACCCCCAGGCAGAAGGGAGGAGG - Exonic
1181615571 22:24052034-24052056 GCACACACTCAGATGGGAGAAGG - Intronic
1182160559 22:28116913-28116935 ACTCACAGGCAGAAGAGGCAGGG - Intronic
1182661635 22:31929284-31929306 ACACACAGGCTCAAGGGAGATGG + Intergenic
1182716887 22:32364097-32364119 GCTGACAGGGTGAAGGGAGTGGG - Intronic
1183034822 22:35133679-35133701 GCTCACTGGCAGAGGAGACAGGG + Intergenic
1183048943 22:35245233-35245255 GCTCAACGGCAGAATGGAGGTGG - Intergenic
1183067842 22:35375823-35375845 GCTCACAGTCAGGACGGAGGTGG + Intergenic
1183198632 22:36370698-36370720 GCTCACAGGCACTGGGCAGAAGG + Intronic
1183520433 22:38293603-38293625 GCCCACAGGCAGGAGGACGAGGG + Intronic
1184515136 22:44957090-44957112 GCTCAGAGGGAGGAGGGAGGGGG - Intronic
1184618139 22:45652163-45652185 GATCACAGGAAGAAGGAAAAAGG - Intergenic
1184667319 22:45995875-45995897 GCTCACGCTCAGGAGGGAGAGGG + Intergenic
1184767707 22:46580190-46580212 AGTAACAGGCAGAAGGCAGAGGG + Intronic
1185219834 22:49623789-49623811 GCTCTCAGGCCAAGGGGAGAGGG - Intronic
949096285 3:89733-89755 ACACAGAGGCAGAAGGGAGCCGG + Intergenic
951043678 3:18015313-18015335 GCAAAAAGGAAGAAGGGAGATGG - Intronic
951206721 3:19933590-19933612 GTTCACAGGCTGCAGGGAGCAGG - Exonic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952185147 3:30960672-30960694 GCTCATAGGCAGAAGGGACTTGG - Intergenic
952238918 3:31509708-31509730 GCTTCCAGGCAGCAGGGAGAAGG - Intergenic
952283817 3:31948473-31948495 GCTCTTAGGCAGAAGGTAGGTGG - Intronic
953360415 3:42290789-42290811 GCTAACAGTGAGTAGGGAGAGGG - Intergenic
954199422 3:49015327-49015349 GCTCACAGACAGCATGGAGCAGG + Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954696181 3:52428213-52428235 GGTAACTGGCAGAAGGGAAAAGG - Intergenic
954871600 3:53771464-53771486 TTTCACAGGTAAAAGGGAGAAGG + Intronic
955611506 3:60762408-60762430 CATCACAGGCAGAAGAAAGAGGG - Intronic
956765500 3:72481141-72481163 CCTCCCACGCAGAAGGCAGAAGG - Intergenic
959054688 3:101555569-101555591 ACTCTCAGGCAGATAGGAGAGGG + Intergenic
959108141 3:102089608-102089630 GCTCACTGGGAGAGGAGAGAGGG + Intergenic
960365920 3:116772234-116772256 GCTCAAGGGCAGCAGGAAGAAGG - Intronic
960542054 3:118871967-118871989 GCTCATAGGCATAAGGGACTTGG + Intergenic
961081885 3:124034179-124034201 GCTGACAGGCACAGGGGAGGGGG - Intergenic
961312362 3:126011326-126011348 GCTCAATAGCAGAATGGAGAGGG + Intronic
961504853 3:127363169-127363191 GCACACAGAGGGAAGGGAGACGG + Intergenic
961728550 3:128950176-128950198 GCCCACAGACAGAAAGGAGCTGG - Intronic
962343822 3:134605682-134605704 GCTGACCGGCAGAGGGGAAATGG - Intronic
963119622 3:141765009-141765031 GATCACAGACAGAAGGGGCAAGG - Intergenic
963224371 3:142846728-142846750 ACTCACAGGTAGATGGGAGATGG - Intronic
963287947 3:143454795-143454817 GCTGACAGCCAGAAAGGAAAAGG - Intronic
963420949 3:145060837-145060859 GCTCATAGGCAGAAGGGACTTGG - Intergenic
964241541 3:154600812-154600834 GCTCATAAGCAGAAGGGACTAGG - Intergenic
965055398 3:163706722-163706744 GTTCACAGGCTAGAGGGAGAGGG - Intergenic
965073985 3:163953490-163953512 GCTCTCAGGCAAAATGGGGAGGG - Intergenic
965127639 3:164650283-164650305 GTTCATAGGCAGAAGGGACTTGG + Intergenic
966191367 3:177274422-177274444 GCTCAAAGACAGAAGAGAAAGGG + Intergenic
966268109 3:178071128-178071150 TTTCACAGGCAGAAAGGAGAAGG - Intergenic
967444854 3:189554918-189554940 GCTCCTGGGCAGAAGGGAGCAGG - Intergenic
968075312 3:195812903-195812925 ACTCACAGGCACAAGCGAGGAGG + Intergenic
968447025 4:657283-657305 GCACACAGGCACATGGGAGGGGG + Intronic
968858978 4:3151330-3151352 GCCCACAGGAAAAAGAGAGAAGG + Intronic
969403848 4:6975738-6975760 GCTCAATAGCAGAATGGAGATGG + Intronic
969686913 4:8680730-8680752 GCTTGCAGGCAGAAGCTAGAGGG + Intergenic
970339340 4:15088049-15088071 ACTCACTGGAAGAAAGGAGAAGG - Intergenic
972783222 4:42303854-42303876 GCTCACAGAGAGAGGGGAAAAGG - Intergenic
975632501 4:76417317-76417339 GCTCATAGCCAGAAGGGACTTGG + Intronic
976266529 4:83190584-83190606 TCTCCAAGGAAGAAGGGAGAAGG + Intergenic
977682495 4:99811379-99811401 GCTAACAGGAAGACTGGAGAAGG + Intergenic
978262318 4:106774275-106774297 GCTCATAGGTGGAAGGGAGTTGG + Intergenic
978405130 4:108371114-108371136 GCTCCTAGGGAGGAGGGAGAGGG - Intergenic
978675316 4:111307897-111307919 CCTCACAGGCAGAAGAGAGTGGG - Intergenic
978943041 4:114460429-114460451 GGTCAAAGGTAGAAGGAAGAAGG - Intergenic
979295423 4:119027240-119027262 TCTGACAGGCAGAAGACAGAAGG + Exonic
979455349 4:120921502-120921524 GGTCAGAGGCAAAGGGGAGAGGG + Intronic
979610302 4:122682501-122682523 GCTCATAGACAGAAGGGACTCGG + Intergenic
979857589 4:125652346-125652368 GCTCACAAGGAATAGGGAGATGG - Intergenic
980243106 4:130202315-130202337 GCTCATAGGCAGAAGGGGGTGGG + Intergenic
980661167 4:135860408-135860430 ACTCACAGGCAGACAGGTGAGGG - Intergenic
981310919 4:143297411-143297433 GCCCACAGACAGAAGGGCCAGGG - Intergenic
981567223 4:146114075-146114097 GCCCAGAGGGAGAAGGGTGATGG + Intergenic
982292224 4:153791344-153791366 GCCCAAAAGCAGAAGGGAGTGGG - Intergenic
982354758 4:154453733-154453755 GGACACAGGGACAAGGGAGAAGG - Intronic
982829458 4:160042657-160042679 GCTCATCGGCAGAAGGGACTTGG - Intergenic
983125889 4:163950133-163950155 GCTCCCAGGCAGAAAGGGGTGGG - Intronic
983496830 4:168451454-168451476 GATATGAGGCAGAAGGGAGAAGG - Intronic
984257495 4:177406133-177406155 GCTTCCAGGCATAAGGAAGATGG - Intergenic
984922212 4:184775596-184775618 GCACACATGCACAAGAGAGAAGG + Intronic
984933183 4:184866679-184866701 GCAGGCAGGAAGAAGGGAGAGGG + Intergenic
985082493 4:186280415-186280437 CCTCACAGGCAGACGGGACAAGG - Intronic
985748305 5:1660180-1660202 GGTCACAGGCACAAGGCAGCTGG - Intergenic
985779680 5:1863737-1863759 ACTGAGAGGCAGAAGGCAGAAGG + Intergenic
986163408 5:5251606-5251628 GCACAGAGACTGAAGGGAGATGG + Intronic
986604550 5:9508626-9508648 GGACACCCGCAGAAGGGAGAAGG - Intronic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
991696683 5:69279540-69279562 GCTAACAGTCAAAAGGGAAATGG - Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992433863 5:76736365-76736387 TCCCTCAGGCAGAAGGGAGGAGG + Intergenic
992711556 5:79463188-79463210 GCTCACAGTCATATGGAAGAGGG - Intronic
992767111 5:80011444-80011466 ACTAAAAGGAAGAAGGGAGAAGG + Intronic
993146227 5:84096590-84096612 GCTCATAGGCTGAAGGGACTTGG + Intronic
993690809 5:90997017-90997039 GCTTATAGGCAGAAGGGACTTGG + Intronic
993749463 5:91649215-91649237 GCTCACTGGGAGAGGAGAGAGGG + Intergenic
995312588 5:110730966-110730988 GCTCATAGGCATAAGGGACTTGG - Intronic
995789548 5:115870604-115870626 GCTCAAAGGCAGAAAGAAGCAGG - Intronic
997091482 5:130864008-130864030 GCTCCTAGGCAGAAGGGACTTGG - Intergenic
998408066 5:141885766-141885788 ACTTCCAGGAAGAAGGGAGAGGG - Intergenic
998409376 5:141897754-141897776 GCTTCCGGGAAGAAGGGAGAGGG - Intergenic
998482732 5:142476249-142476271 GCTCACAGCCAGTTGGTAGAGGG + Intergenic
999086698 5:148898418-148898440 GCCAACAGGCAGTTGGGAGATGG - Intergenic
999194818 5:149774730-149774752 GGCCAGAGGCAGGAGGGAGAGGG - Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1000958581 5:167571984-167572006 GCTCAGATGTAGAAGGGAAAAGG - Intronic
1001098152 5:168792178-168792200 GCTGGAAGGCAGATGGGAGATGG + Intronic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002556971 5:180049821-180049843 ATTCAGAGGCAGAAAGGAGAGGG - Intronic
1002583508 5:180225671-180225693 GCTAACAGCCAGCAAGGAGATGG + Intergenic
1003027170 6:2565257-2565279 GTGCACAGGCAGAACGGACATGG - Intergenic
1003329608 6:5119096-5119118 GCTTACAGGAAGGATGGAGATGG - Intronic
1004180553 6:13377450-13377472 GCTGACAGCCAGCAAGGAGATGG - Intronic
1004424499 6:15498163-15498185 GCTCAGAGGAAGAAGAGACAAGG - Intronic
1004830738 6:19474749-19474771 GCTCATAGGCAAAAGGGACTTGG - Intergenic
1004934984 6:20498455-20498477 CCTCACAGCCAGAAAGGAGCTGG + Intergenic
1005008042 6:21309817-21309839 GCTGAAAGGCAGCGGGGAGAGGG - Intergenic
1005630317 6:27701120-27701142 GTCCAGAGGCTGAAGGGAGAGGG - Intergenic
1005692882 6:28324028-28324050 GCTCACAGGGTGAAGGGAAAGGG - Intergenic
1005944476 6:30585422-30585444 ACTCACAGGCACAGTGGAGAAGG - Intronic
1006305419 6:33215538-33215560 GCTCCCAGCCTGCAGGGAGAGGG - Intergenic
1006347696 6:33496751-33496773 GCTCACTGGCTGAAGAGACAGGG + Intergenic
1011010222 6:82695270-82695292 GCTCAAAGCCAGAAGACAGATGG + Intergenic
1012986795 6:105884331-105884353 GGTCCAAGGCAGAGGGGAGAGGG + Intergenic
1013815759 6:114095445-114095467 GCTCACATGAATATGGGAGAGGG + Intronic
1015893321 6:137990866-137990888 GGTAACAGACAGAAGGGAGCTGG + Intergenic
1016187859 6:141220664-141220686 GCTCATAGGCAGAAGGGACTTGG - Intergenic
1016393327 6:143596951-143596973 AGACACAGGCAGAAGGCAGATGG - Intronic
1017945929 6:159096303-159096325 GCCCACACACAGAACGGAGAGGG + Intergenic
1018163380 6:161069811-161069833 GCTCCCATGGAGCAGGGAGAAGG + Intronic
1018842189 6:167525328-167525350 GGACACAGGCAGGAGGGAGCAGG - Intergenic
1019098566 6:169608841-169608863 GCTCATAGGCAGAAGGGACTTGG - Intronic
1019282079 7:205675-205697 GGCCCCAGGCAGGAGGGAGATGG - Intronic
1019907370 7:4074991-4075013 CCTCCCAGGGAGAGGGGAGAAGG - Intronic
1021489678 7:21205464-21205486 GGTCTCAGGCAGAAAGTAGAAGG + Intergenic
1022800395 7:33771412-33771434 GGTCCCAGGCAGAAGACAGAGGG - Intergenic
1024008065 7:45241827-45241849 ACTCAGAGACTGAAGGGAGACGG - Intergenic
1024399161 7:48903975-48903997 GCTCTCTGGCACAAGGGAAAAGG + Intergenic
1024700416 7:51899891-51899913 GCACACAGGAAGGAGGGACATGG - Intergenic
1024924467 7:54598711-54598733 GACCACCAGCAGAAGGGAGAAGG + Intergenic
1025194310 7:56920688-56920710 GCTCAAAACCAAAAGGGAGAGGG - Intergenic
1025677641 7:63656257-63656279 GCTCAAAACCAAAAGGGAGAGGG + Intergenic
1026086877 7:67270012-67270034 GCTCACAGTCACAAGGAAAAAGG - Intergenic
1027556574 7:79670940-79670962 GCTCACAGGCAGAAGGGACTTGG + Intergenic
1029381852 7:100220201-100220223 GCTCACAGTCACCAGGGAGATGG - Exonic
1029402016 7:100352651-100352673 GCTCACAGTCACCAGGGAGATGG - Exonic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1031664983 7:124472779-124472801 GCTCACAGGAAGCAGTGAAAAGG + Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032455041 7:132066816-132066838 GCAGACAGGCAGACGGGAGCAGG + Intergenic
1033595350 7:142854986-142855008 GCTCCCCGGAAGAAGGGAGTGGG + Intergenic
1034211106 7:149364041-149364063 GTTCACAGGCAAAAGGCAGAAGG - Intergenic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034488970 7:151382785-151382807 GCTCACAGGGAAATGGGAGATGG + Intronic
1035147495 7:156834771-156834793 GCTGACAGGCATGAGCGAGAAGG - Intronic
1035238114 7:157513364-157513386 GCTCACAGGCAGGAGAGCGGCGG - Intergenic
1035741494 8:1931177-1931199 GAACACAGGCAGCAGGGAGGCGG - Intronic
1037415918 8:18649512-18649534 GCTCATAGGCACAAGGGACTAGG + Intronic
1037638879 8:20724681-20724703 GCTCACAGCCTAAGGGGAGAAGG + Intergenic
1041178602 8:55223935-55223957 GCTCACAAGCAGAAAAGAAAAGG + Intronic
1041568917 8:59313617-59313639 GCACACAGGGAGAAGAGAGAGGG - Intergenic
1042166900 8:65954581-65954603 CCTCACAGGAAGAAGAGACAAGG - Intergenic
1043066095 8:75571726-75571748 ACGCACACCCAGAAGGGAGATGG - Intergenic
1043783247 8:84363323-84363345 ACTCAGAAACAGAAGGGAGATGG + Intronic
1047175706 8:122538365-122538387 ACTCACAGGCAGAGGTGAGAGGG + Intergenic
1048104714 8:131395451-131395473 CATCACAGGCAGAACGGAGAGGG - Intergenic
1048304300 8:133272922-133272944 GCTCACAGGGAAAATGGAAATGG - Intronic
1048949521 8:139483822-139483844 GCTCAGGGACAGAAGGGAAATGG - Intergenic
1048976919 8:139678331-139678353 GCTCTCACCCAGAAGGGAGGTGG - Intronic
1053221453 9:36316340-36316362 GCCCACAGACAGAACAGAGAGGG + Intergenic
1053864638 9:42423929-42423951 GAACAAAGGCAGAAGTGAGAGGG + Intergenic
1054460317 9:65458878-65458900 GGTGTGAGGCAGAAGGGAGAGGG - Intergenic
1054781815 9:69173179-69173201 GCTCACAAGTAGAAGGTAAAAGG - Intronic
1055714701 9:79104159-79104181 GGTCACAGGCTGTAGGGAAAGGG + Intergenic
1056075262 9:83031866-83031888 GCACACAGGCAGATGGGGGCAGG - Intronic
1056135923 9:83629373-83629395 GGTCACAGGCAGAAGAAACATGG - Intronic
1056165493 9:83937042-83937064 GCTCAGTGGCAGAAGAGAAAAGG + Intergenic
1056756490 9:89385174-89385196 CCTCAAAGGCAGAAGGGGGTAGG - Intronic
1056944160 9:90979394-90979416 GCACACAGACAGCCGGGAGATGG - Intergenic
1058649308 9:107159924-107159946 GCTCAGAGGCAAAAGGGACTTGG + Intergenic
1058930388 9:109713200-109713222 GCTCCCAAGAAGAAGGAAGAAGG - Intronic
1059835178 9:118143801-118143823 TCTCAGAGGCAGAACAGAGATGG + Intergenic
1061177409 9:129006093-129006115 GCACACAGGCAGAAGGGACCAGG + Exonic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1062176136 9:135164118-135164140 GGGCACTGGCAGCAGGGAGAAGG + Intergenic
1185661711 X:1733705-1733727 GCTCACAGACAGACGCGAGCCGG - Intergenic
1186359476 X:8824763-8824785 GATCTCAGGCAAATGGGAGAAGG - Intergenic
1187997290 X:24941803-24941825 GCTCACAGGCCAAGGAGAGAAGG - Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188637455 X:32452088-32452110 GCTCATAGGGAGAGGGAAGAGGG + Intronic
1188784998 X:34335589-34335611 GCTCATAGGTAGAAGGGACTTGG - Intergenic
1189172379 X:38922227-38922249 GATCCCAGGGAGCAGGGAGATGG + Intergenic
1191021104 X:55860955-55860977 GCTTAAAGGCAGAAGGGCTATGG - Intergenic
1192487876 X:71546178-71546200 GGAAACATGCAGAAGGGAGAGGG - Intronic
1193425503 X:81337128-81337150 GCTCACAGGGAGAAGAGACTGGG + Intergenic
1193642975 X:84034495-84034517 TCTCTCATGCAGAAGGGAGTTGG - Intergenic
1194909995 X:99630418-99630440 GCTCATAGGCAGAAGGGACTTGG - Intergenic
1194910185 X:99631758-99631780 GCTCATAAGAAGAAGGAAGATGG - Intergenic
1196624687 X:117864832-117864854 GCTGACAGCCAGAAAGGAAATGG - Intergenic
1199538211 X:148927661-148927683 GCTCACAGGCAAGAGGGATGTGG + Intronic
1199660174 X:150041499-150041521 GCTCACCGACATTAGGGAGACGG + Intergenic