ID: 1122225839

View in Genome Browser
Species Human (GRCh38)
Location 14:100278788-100278810
Sequence CGCAGGCTGAGCGCCTGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 150}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122225835_1122225839 10 Left 1122225835 14:100278755-100278777 CCGGCAAGTGTGAGTGAAGCATC 0: 1
1: 0
2: 1
3: 10
4: 89
Right 1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 150
1122225832_1122225839 13 Left 1122225832 14:100278752-100278774 CCCCCGGCAAGTGTGAGTGAAGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 150
1122225834_1122225839 11 Left 1122225834 14:100278754-100278776 CCCGGCAAGTGTGAGTGAAGCAT 0: 1
1: 0
2: 1
3: 12
4: 142
Right 1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 150
1122225833_1122225839 12 Left 1122225833 14:100278753-100278775 CCCCGGCAAGTGTGAGTGAAGCA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122225839 Original CRISPR CGCAGGCTGAGCGCCTGCGC AGG Exonic
900132011 1:1091261-1091283 TGCTGGGTGAGCGCCTGCTCAGG - Intronic
900229900 1:1551376-1551398 AGCAGGGTGAGCCCCTGAGCAGG + Intronic
900483185 1:2909267-2909289 CGCAGGCTTAGATCCTGGGCAGG - Intergenic
900581673 1:3412688-3412710 CGCAAGCTGGGCGCCGGCGAGGG + Exonic
901084569 1:6602753-6602775 AGCAGGCTCAGGGCGTGCGCGGG + Exonic
903471660 1:23591794-23591816 CTCAGGCTGGGGGCCTGCCCTGG - Intronic
904412004 1:30330263-30330285 GGCAGGCTGAGTTCCAGCGCTGG + Intergenic
905847023 1:41241955-41241977 AGCAGGCGCAGCGGCTGCGCAGG + Intronic
906423110 1:45687122-45687144 CGGAGGCTGCGCGGCTGCGTCGG + Intronic
906680380 1:47722232-47722254 GGCTGGCTGAGGGCCTGGGCTGG - Intergenic
910286964 1:85566289-85566311 CCCAGGCTGAACTCCTGGGCTGG - Intronic
916787031 1:168093821-168093843 CGCAGGGTGAGCGGCTGGGCTGG + Intronic
918834919 1:189449898-189449920 AGCACGCTGGGAGCCTGCGCTGG - Intergenic
919188906 1:194190020-194190042 CGCTGGCTGTGCCCCTGCACTGG + Intergenic
922738873 1:228004835-228004857 GGCAGGCTGAGCTCCTGCCTGGG + Intergenic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1071563335 10:86659267-86659289 CAAAGGCTGAGCACCTGCCCTGG + Intronic
1073326168 10:102644921-102644943 CGCAGGCAGACCTTCTGCGCGGG - Exonic
1074373637 10:112921172-112921194 AGCAGGCTGAGAGGCTGCTCTGG + Intergenic
1074529848 10:114289524-114289546 CTCAGGCTGAGGGCCTGCCATGG - Intronic
1075587175 10:123666376-123666398 CGGACCCTGAGCGCCGGCGCGGG + Exonic
1076843283 10:133057021-133057043 CCCAGCCTGTGCGCCTGCACCGG + Intergenic
1080383928 11:31799338-31799360 CGCCGGCCGAGCGGCCGCGCTGG + Intronic
1082009718 11:47441863-47441885 AGCAGGCAGAGCGCCTGCAGTGG + Exonic
1083629344 11:64087779-64087801 CGGAGGCTGGACGCCTGCCCAGG + Intronic
1083927612 11:65818058-65818080 CGCAGGCACAGCGCCCGCCCCGG + Intergenic
1084335986 11:68458095-68458117 CACAGGCTGATCACCTGGGCAGG - Intergenic
1085050187 11:73376407-73376429 CGCAGGCTGCGCGGCTGTCCGGG + Exonic
1087962266 11:104366539-104366561 CGCGGCCGGAGCGCCAGCGCGGG - Intergenic
1089341921 11:117763858-117763880 GGCAGGCTGAGCTCCTGCAGGGG - Intronic
1090326100 11:125887644-125887666 CGCAGGCTCGGCGCGTGGGCCGG + Exonic
1091634603 12:2187507-2187529 CCAAGGCTGAGCATCTGCGCAGG + Intronic
1091714917 12:2770208-2770230 GGCAGGCTGAGGCCCTGCACGGG - Intergenic
1095793221 12:46189794-46189816 GGCAGGCAGAGCGCATGTGCAGG - Intronic
1101125711 12:101631736-101631758 CGCTAGCTGAGCGCCTGTCCTGG - Intronic
1102025712 12:109713554-109713576 GGCATGCTGCGCGCCGGCGCCGG - Intergenic
1103593181 12:122006635-122006657 CGCACGCACAGCGTCTGCGCTGG + Intergenic
1103926915 12:124428253-124428275 CGAAGGCTGGGCGCCGGAGCTGG - Intronic
1104458292 12:128933273-128933295 CGCAGGCGGCGCCCGTGCGCAGG + Intronic
1104730844 12:131104533-131104555 AGGAGGCTCAGCGCCTGCCCGGG + Intronic
1104968838 12:132522087-132522109 CCCAGGCTGAGGGGCCGCGCCGG - Intronic
1105443939 13:20436628-20436650 CCCAGCCTGAACTCCTGCGCTGG + Intronic
1112494858 13:99896407-99896429 CGCAGGCCGGACACCTGCGCAGG + Exonic
1113758946 13:112834121-112834143 TGCTGGCTGAAGGCCTGCGCTGG + Intronic
1113810805 13:113141368-113141390 TGCAGACTGAGGGCCTGCGGTGG - Intronic
1118849632 14:69573800-69573822 CCCAGGCTGAGCGCCAGAACGGG + Intronic
1121694981 14:95904849-95904871 CCCTGGCTGAGGACCTGCGCAGG + Intergenic
1122225839 14:100278788-100278810 CGCAGGCTGAGCGCCTGCGCAGG + Exonic
1122329141 14:100901320-100901342 CACATGCTGAGTGCCTGCACTGG + Intergenic
1122406989 14:101506577-101506599 CGCAGGCTGGTCACCTGCCCCGG + Intergenic
1122648028 14:103207752-103207774 CGCTGCGCGAGCGCCTGCGCGGG + Intergenic
1122900222 14:104779342-104779364 TGGAGGCTGAGAGCCTGTGCAGG + Intronic
1123018287 14:105385852-105385874 TGCAGGCTGAGAGCCCGCACGGG + Intronic
1123028031 14:105437809-105437831 CCCAAGCTGAGCCCCTGCGGTGG + Intronic
1127995783 15:64152444-64152466 CGGGGGCTGACCGGCTGCGCAGG - Intronic
1129108491 15:73324215-73324237 CGCTGGCTGTGCGCCGGCCCCGG + Exonic
1129243568 15:74266481-74266503 CACAGTCTGAGCCCCTGCACAGG - Intronic
1131422657 15:92320176-92320198 CGCTGGCTGAGTCCCTGCTCTGG - Intergenic
1132239206 15:100244696-100244718 CGCAGGCTGAGAGCCAGGGAAGG - Intronic
1133745853 16:8686191-8686213 CGCAGGCTGAGCGCCGGTCTGGG + Intronic
1135992097 16:27224461-27224483 CTCAGGCTGAGCTCCAGCCCCGG - Intergenic
1139505902 16:67397980-67398002 CGCATGCTTGGCGCCTGGGCAGG + Intronic
1141900471 16:86987315-86987337 TGCAGGCTGAGGGCATACGCAGG + Intergenic
1141900480 16:86987387-86987409 CGCAGGCTGAGGGCATATGCAGG + Intergenic
1141900483 16:86987404-86987426 TGCAGGCTGAGGGCATACGCAGG + Intergenic
1143893366 17:10118813-10118835 CACAGGCTGGCCACCTGCGCTGG - Intronic
1144438322 17:15260872-15260894 CGCAGCCCGACCGCCCGCGCGGG + Intronic
1146258615 17:31406272-31406294 TGGCAGCTGAGCGCCTGCGCTGG - Intronic
1146788272 17:35736370-35736392 CTCAGGCTGAGACCCTGGGCTGG + Intronic
1148854091 17:50569293-50569315 CGCAGGGTGAGGACCTGGGCTGG + Exonic
1150249663 17:63698925-63698947 CGCAGGCTGAAGGACTGTGCGGG + Exonic
1151026203 17:70679839-70679861 CGGAGACTGAGTGCCTGAGCAGG - Intergenic
1151660770 17:75516838-75516860 CTCAGGCCGAGCGGCTGCGCCGG + Exonic
1151708321 17:75784627-75784649 CGGATGCTGAGGGCCTGCGACGG - Intronic
1157718342 18:49904807-49904829 GGCTGGCTGAGCACCTGCGGAGG - Exonic
1159985320 18:74834697-74834719 CGCAGGCTGAGCACTAGTGCAGG + Intronic
1161001270 19:1912409-1912431 CGCTGGCTGAGCTCCTGCCACGG + Exonic
1161038872 19:2099519-2099541 CGCAGCATCAGCGCCTGGGCAGG + Exonic
1163063576 19:14776824-14776846 CGCAGGCTGGGCAGCTGTGCGGG + Exonic
1163489047 19:17606334-17606356 AGCACGCTGAGCGCCGACGCGGG - Exonic
1166316474 19:41992459-41992481 CGCAGCCTCTGCGCCTGGGCCGG + Intronic
1166928439 19:46285901-46285923 AGCTTGCTGAGCGCCTGCACTGG - Intergenic
1168045001 19:53788183-53788205 GGGCGGCTGTGCGCCTGCGCCGG + Intergenic
925024357 2:595922-595944 CCCAGGCAGAGCCCCTCCGCAGG - Intergenic
929573558 2:43038728-43038750 CGCAGGGTGAATGCCTGAGCTGG - Intergenic
931392222 2:61854053-61854075 CGAGGCCTGAGCGCCTGCGCTGG + Exonic
937325673 2:120988561-120988583 CGCAGGCTGTACTGCTGCGCCGG - Exonic
938076235 2:128340078-128340100 CCCAGCCTGGGCGGCTGCGCTGG + Intergenic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
938899303 2:135786265-135786287 CGCAGGCAGTGCGCCTACTCGGG - Intergenic
942449443 2:176099971-176099993 CGCAGGCTGCGCGGGGGCGCAGG - Exonic
943333714 2:186589780-186589802 CTCAGGCTGAGCACCTGAGGAGG - Intergenic
948806040 2:240453730-240453752 CGCAGCCGGAGCGGGTGCGCAGG - Intronic
948983970 2:241508800-241508822 GGCAGGCCGCGCGCCTGGGCGGG + Intronic
949012253 2:241687310-241687332 CCCCGGCTGAGCCCCTGCACTGG - Intergenic
1169191352 20:3660763-3660785 CGCTGCCTGCGCGCCTACGCGGG - Exonic
1175232302 20:57481589-57481611 CGCTGCCTGAGCCCCTGCCCTGG + Intergenic
1175847432 20:62065971-62065993 CGCGGTCTCCGCGCCTGCGCAGG - Intergenic
1176374567 21:6080674-6080696 CGCAGTCAGAGGGGCTGCGCTGG - Intergenic
1177278792 21:18951482-18951504 AGAAGGCTGTGCGCATGCGCTGG - Intergenic
1179730312 21:43363911-43363933 CGCAGGCAGAGCGCCTTGCCTGG + Intergenic
1179748908 21:43457571-43457593 CGCAGTCAGAGGGGCTGCGCTGG + Intergenic
1179786362 21:43732461-43732483 AGCAAGCTGAGCCCCTGGGCTGG - Intronic
1179940595 21:44637040-44637062 CCCAGGCTGAGGGCCCACGCTGG + Intronic
1182472352 22:30556227-30556249 TCCAGGCTGGGTGCCTGCGCGGG + Intronic
1183743512 22:39680754-39680776 CCCAGGCTGGGCCCCTGCACAGG + Intronic
1183838688 22:40479121-40479143 AGCAAGCTGAGCGCTTGCACAGG + Intronic
1183936374 22:41264720-41264742 AGCAGGCTGAGCTCTTGAGCAGG + Exonic
1184502959 22:44885015-44885037 CCCTGGCTGTGCGCCTGCTCAGG - Intronic
1184645318 22:45891977-45891999 AGCAGGCTGAGCCCGTGCCCTGG + Intergenic
1185274128 22:49943136-49943158 GGCAGGCCCAGCCCCTGCGCAGG - Intergenic
1185278579 22:49960466-49960488 CGCAGGCGCAGTGCCCGCGCGGG - Intergenic
1185397583 22:50600742-50600764 GGCGGGCCGAGCGCCGGCGCGGG + Exonic
949089614 3:11737-11759 CGCCGGCGCTGCGCCTGCGCCGG - Intergenic
949089615 3:11741-11763 CGCAGGCGCAGCGCCGGCGCAGG + Intergenic
950409479 3:12825915-12825937 CGCTGGCTGTGTGCCTGCGGTGG - Intronic
950449016 3:13055180-13055202 GGCGGGCTGAGCTCCTGGGCAGG - Intronic
950449508 3:13057772-13057794 GGCAGGCTGAGCTCCTGGGCAGG - Intronic
952329689 3:32353021-32353043 CCCAGGCTCTGCGCCTGTGCTGG + Intronic
952484693 3:33798553-33798575 CGCATCCAGTGCGCCTGCGCTGG + Exonic
953433177 3:42856230-42856252 CTCAGGCTGAGCTCCTGGGGTGG + Intronic
953797304 3:45995502-45995524 GGCAGGCTGGGTGCCTGGGCCGG + Intronic
954358157 3:50100001-50100023 CGCAGGCTGAGGGCCTTCGAAGG - Exonic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
960632265 3:119744096-119744118 TGCTGGCTGAGCGCCAGCGGCGG + Exonic
961451088 3:127002598-127002620 CGCAGCCTGAGAGCCTACCCTGG + Intronic
968549940 4:1216979-1217001 AGCAGGTTGAGCGCCGGGGCGGG + Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
978154569 4:105474143-105474165 CGCAGCCCGAGCGCCGGGGCGGG - Intergenic
979278188 4:118836182-118836204 CGGTGGCTGTGCGCGTGCGCAGG - Intronic
983077555 4:163344078-163344100 CGCGGGCTGCGAGTCTGCGCAGG + Intronic
984793407 4:183634997-183635019 TACAGGCTGAGCCACTGCGCTGG + Intergenic
992297188 5:75337249-75337271 GCCAGGCTGAGCGTCGGCGCCGG + Exonic
997013485 5:129904993-129905015 CGGCTGCTGAGCGCCGGCGCGGG - Exonic
997362810 5:133305916-133305938 AGCAGGGTGAGCTCCTGGGCAGG - Intronic
1001255335 5:170178847-170178869 AGCTGGCTGAGGGCCTGGGCCGG + Intergenic
1001646645 5:173287212-173287234 CGCAGCCTGTACACCTGCGCTGG + Intergenic
1013196412 6:107848472-107848494 CGGGGGCTGAGCGCCTGGACCGG + Intergenic
1013330485 6:109095168-109095190 CGCAAGCTTAGCGCCTCCGGGGG - Exonic
1015526155 6:134176478-134176500 CGCAGCCTGACCGCCGGCGCGGG + Intronic
1017497572 6:154995341-154995363 CGCGCGCTGTGCGCCTGCGGCGG - Intronic
1019195086 6:170276565-170276587 CTCAGGCCCAGCGCTTGCGCTGG + Intergenic
1019338207 7:494991-495013 CCCAGGCTGGGCACCTGCCCAGG + Intergenic
1019481854 7:1270549-1270571 AGCATGCTGAGCACCTGAGCAGG - Intergenic
1019619189 7:1981410-1981432 CGCAGGCTGAGGGGCTACGTAGG + Intronic
1022476268 7:30712455-30712477 TGCAGGCTGAGCACCTGCTGGGG + Intronic
1023865216 7:44235165-44235187 AGCAGGGTGAGCGCCTGGGCTGG - Intronic
1024046137 7:45587022-45587044 CCCAGGCTGAGAGACTGTGCTGG + Intronic
1027250097 7:76393564-76393586 AGCGGGCTGCGGGCCTGCGCTGG - Exonic
1035360861 7:158313493-158313515 CCCTGGCTGAGCGTCTGCCCAGG - Intronic
1036074731 8:5483500-5483522 CGTAGGATGAGCGCCTGCCATGG - Intergenic
1042040045 8:64580765-64580787 CCCGGGCTGCGCGCCGGCGCGGG + Exonic
1044306461 8:90645914-90645936 GGCCGGCTGAGGGCCCGCGCTGG - Exonic
1049497994 8:142945703-142945725 CCCAGGCTGTGGCCCTGCGCTGG + Intergenic
1049619451 8:143591471-143591493 CGCAGGCTGAGCGCGGGCTGGGG - Intronic
1054765022 9:69035993-69036015 CGCACGCCGCACGCCTGCGCAGG + Intronic
1060042871 9:120315927-120315949 CACAGGCTGAGCGTGTGCTCTGG + Intergenic
1062475373 9:136724109-136724131 CCCAGCCTGAGTGCCTGGGCTGG - Intergenic
1062500436 9:136849762-136849784 CCCAGGCTGAGGTCCTGGGCGGG + Intronic
1062656397 9:137606173-137606195 TGCAGCGGGAGCGCCTGCGCCGG - Intronic