ID: 1122227035

View in Genome Browser
Species Human (GRCh38)
Location 14:100285978-100286000
Sequence GGAGAGCTCCACCACGGGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122227026_1122227035 10 Left 1122227026 14:100285945-100285967 CCTCCAAGCTGGGGATGCTTTTC No data
Right 1122227035 14:100285978-100286000 GGAGAGCTCCACCACGGGCGTGG No data
1122227020_1122227035 30 Left 1122227020 14:100285925-100285947 CCAAAGGGACGTCCTGGAGCCCT No data
Right 1122227035 14:100285978-100286000 GGAGAGCTCCACCACGGGCGTGG No data
1122227027_1122227035 7 Left 1122227027 14:100285948-100285970 CCAAGCTGGGGATGCTTTTCCTC No data
Right 1122227035 14:100285978-100286000 GGAGAGCTCCACCACGGGCGTGG No data
1122227024_1122227035 18 Left 1122227024 14:100285937-100285959 CCTGGAGCCCTCCAAGCTGGGGA No data
Right 1122227035 14:100285978-100286000 GGAGAGCTCCACCACGGGCGTGG No data
1122227025_1122227035 11 Left 1122227025 14:100285944-100285966 CCCTCCAAGCTGGGGATGCTTTT No data
Right 1122227035 14:100285978-100286000 GGAGAGCTCCACCACGGGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122227035 Original CRISPR GGAGAGCTCCACCACGGGCG TGG Intergenic
No off target data available for this crispr