ID: 1122227830 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:100290173-100290195 |
Sequence | GGCTGTGGTCCCCATCACCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122227830_1122227837 | 20 | Left | 1122227830 | 14:100290173-100290195 | CCAGGGTGATGGGGACCACAGCC | No data | ||
Right | 1122227837 | 14:100290216-100290238 | CCTGAGAGATTCAGCCACCCAGG | No data | ||||
1122227830_1122227838 | 30 | Left | 1122227830 | 14:100290173-100290195 | CCAGGGTGATGGGGACCACAGCC | No data | ||
Right | 1122227838 | 14:100290226-100290248 | TCAGCCACCCAGGCCTAGAGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122227830 | Original CRISPR | GGCTGTGGTCCCCATCACCC TGG (reversed) | Intergenic | ||