ID: 1122227830

View in Genome Browser
Species Human (GRCh38)
Location 14:100290173-100290195
Sequence GGCTGTGGTCCCCATCACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122227830_1122227837 20 Left 1122227830 14:100290173-100290195 CCAGGGTGATGGGGACCACAGCC No data
Right 1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG No data
1122227830_1122227838 30 Left 1122227830 14:100290173-100290195 CCAGGGTGATGGGGACCACAGCC No data
Right 1122227838 14:100290226-100290248 TCAGCCACCCAGGCCTAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122227830 Original CRISPR GGCTGTGGTCCCCATCACCC TGG (reversed) Intergenic