ID: 1122227832

View in Genome Browser
Species Human (GRCh38)
Location 14:100290188-100290210
Sequence TTGAGTGTGGCCTGTGGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122227832_1122227842 22 Left 1122227832 14:100290188-100290210 CCACAGCCACAGGCCACACTCAA No data
Right 1122227842 14:100290233-100290255 CCCAGGCCTAGAGAGGCAAAGGG No data
1122227832_1122227844 23 Left 1122227832 14:100290188-100290210 CCACAGCCACAGGCCACACTCAA No data
Right 1122227844 14:100290234-100290256 CCAGGCCTAGAGAGGCAAAGGGG No data
1122227832_1122227838 15 Left 1122227832 14:100290188-100290210 CCACAGCCACAGGCCACACTCAA No data
Right 1122227838 14:100290226-100290248 TCAGCCACCCAGGCCTAGAGAGG No data
1122227832_1122227837 5 Left 1122227832 14:100290188-100290210 CCACAGCCACAGGCCACACTCAA No data
Right 1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG No data
1122227832_1122227840 21 Left 1122227832 14:100290188-100290210 CCACAGCCACAGGCCACACTCAA No data
Right 1122227840 14:100290232-100290254 ACCCAGGCCTAGAGAGGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122227832 Original CRISPR TTGAGTGTGGCCTGTGGCTG TGG (reversed) Intergenic
No off target data available for this crispr