ID: 1122227837

View in Genome Browser
Species Human (GRCh38)
Location 14:100290216-100290238
Sequence CCTGAGAGATTCAGCCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122227833_1122227837 -1 Left 1122227833 14:100290194-100290216 CCACAGGCCACACTCAAGCTGCC No data
Right 1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG No data
1122227830_1122227837 20 Left 1122227830 14:100290173-100290195 CCAGGGTGATGGGGACCACAGCC No data
Right 1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG No data
1122227834_1122227837 -8 Left 1122227834 14:100290201-100290223 CCACACTCAAGCTGCCCTGAGAG No data
Right 1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG No data
1122227832_1122227837 5 Left 1122227832 14:100290188-100290210 CCACAGCCACAGGCCACACTCAA No data
Right 1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122227837 Original CRISPR CCTGAGAGATTCAGCCACCC AGG Intergenic
No off target data available for this crispr