ID: 1122229436

View in Genome Browser
Species Human (GRCh38)
Location 14:100298280-100298302
Sequence TTGGGGAATTTCCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122229424_1122229436 7 Left 1122229424 14:100298250-100298272 CCCAACCACAAGCGGAGGGTGGG 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 176
1122229426_1122229436 6 Left 1122229426 14:100298251-100298273 CCAACCACAAGCGGAGGGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 176
1122229430_1122229436 2 Left 1122229430 14:100298255-100298277 CCACAAGCGGAGGGTGGGGGGTT 0: 1
1: 0
2: 1
3: 10
4: 122
Right 1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG 0: 1
1: 0
2: 2
3: 16
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122229436 Original CRISPR TTGGGGAATTTCCAGCTGGA GGG Intronic
900687300 1:3956928-3956950 TCAGGGAAATCCCAGCTGGAGGG + Intergenic
904917493 1:33980879-33980901 GTGGGGAACTTCCAGAAGGAGGG + Intronic
905975709 1:42172230-42172252 TAGGGGAATTTGCAGGAGGAGGG - Intergenic
908668997 1:66524835-66524857 TTGGGGAATATTAATCTGGATGG - Intergenic
910039025 1:82825014-82825036 ATGGGGAGTTCCCAGGTGGAGGG + Intergenic
911976649 1:104505806-104505828 TTTGGGAAAATACAGCTGGAAGG + Intergenic
912467595 1:109884676-109884698 GTGGGGAAGTTCCAGCTGTGGGG - Intergenic
916664370 1:166952160-166952182 CTGGGGCATCTCCAGCTGGCAGG - Intronic
917519227 1:175734222-175734244 TTTGGGAATTTCAGGCAGGAAGG - Intronic
918606944 1:186438749-186438771 TGGGGGAAGTGCCAGCAGGAAGG + Intergenic
922236335 1:223725511-223725533 TTGGGGACAGTACAGCTGGAGGG + Intronic
922585090 1:226728011-226728033 GTGGTGAATTTTCAGCTGAAGGG - Intronic
1068634770 10:59336656-59336678 TTGGAGAATTTCCCATTGGAGGG - Intronic
1069424552 10:68278182-68278204 TTGTGGATTTTCCAGGTGCATGG - Intergenic
1071143735 10:82542814-82542836 TTGGGAAATTTCCAGGTTGAAGG + Intronic
1072040715 10:91603678-91603700 CTGGGGATTTTCCAGTTAGAGGG - Intergenic
1074055787 10:109922414-109922436 GTGGAGAACTTCCATCTGGAAGG - Intronic
1074394443 10:113085991-113086013 TTGGGGCAATTCCAGCAGGTGGG + Intronic
1075059018 10:119241687-119241709 TTGTGGAATTGCCTGCTTGAGGG + Intronic
1078303912 11:10162896-10162918 TTGGGAAATTTCCAGATGAAAGG - Intronic
1079739150 11:24035987-24036009 TTGGATAATTTGCAGCTTGATGG + Intergenic
1080950458 11:37026430-37026452 TTGAGGCATTTCCAGGAGGAGGG - Intergenic
1083547470 11:63559559-63559581 TTGGAGAATTTAAAGCTGGAGGG - Intronic
1088224509 11:107604878-107604900 TTGGGGCATTTCCAGCAGCTTGG - Intronic
1090752713 11:129761420-129761442 TTGGGTAGTTTCCAGTTTGAGGG + Intergenic
1091550802 12:1533705-1533727 TTGGGGCATTTCTCGCTGAAGGG - Intronic
1093996879 12:25652571-25652593 TCTGGGAATTTCCCTCTGGAGGG + Intergenic
1103203926 12:119113269-119113291 TTGGGTAATTTCCAGATGATTGG + Intronic
1103225172 12:119281191-119281213 TTGGGTGATTTCCAGCTTGAGGG - Intergenic
1103831366 12:123782032-123782054 TTGCTGAAATTCCTGCTGGATGG + Intronic
1106234275 13:27848522-27848544 TTGTGGAAGGTCCAGCTGGAAGG + Intergenic
1106442107 13:29784675-29784697 ATGGAGAATGGCCAGCTGGAAGG + Intronic
1111139676 13:84099579-84099601 TTGTGGATTTTCCAGATCGATGG + Intergenic
1112399708 13:99065424-99065446 TTGTGGGTTTTCGAGCTGGAAGG - Intronic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1114379166 14:22182774-22182796 TTGGGGAATTATCTGCTGGCTGG - Intergenic
1121398672 14:93652229-93652251 TTGAGGTATTTCCAGTTTGAGGG + Intronic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1202904595 14_GL000194v1_random:60869-60891 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1125227914 15:37416240-37416262 TTGCAGAATTTCAAGCTGAAAGG - Intergenic
1125891944 15:43273606-43273628 CTGGGGGATGTCCAGCTGGAAGG + Intergenic
1128609137 15:69059899-69059921 TTGGGGAGTTTGCAGCTTCATGG - Intronic
1129128751 15:73470754-73470776 TGGGGGAGTTTTCAGATGGATGG + Intronic
1129549144 15:76429600-76429622 TTGTGGAAATTTCAGCTTGAGGG + Intronic
1130803441 15:87292010-87292032 TTGGAGAATTGGCCGCTGGATGG - Intergenic
1131721115 15:95169958-95169980 TTGGGGGATCTACAGCAGGAGGG + Intergenic
1135853966 16:25989494-25989516 CTGAGGACTTTCCAGCAGGATGG - Intronic
1137932004 16:52597733-52597755 TTGGCTACTTTCCAGCTGCAAGG + Intergenic
1138869085 16:60859212-60859234 TTGGGGAAGTTACAGTTGGAAGG - Intergenic
1141461992 16:84183251-84183273 CTGGAGAATTTCAAGCTGGAGGG - Exonic
1141825838 16:86479818-86479840 TTCTGGGATTGCCAGCTGGAGGG + Intergenic
1142031791 16:87842247-87842269 CTGGTGACTTTCCAGCAGGAAGG - Intronic
1142899595 17:3003910-3003932 TGTGGGACTGTCCAGCTGGAGGG + Intronic
1144712850 17:17413861-17413883 TTGGGGCATTTCCAGACAGAAGG - Intergenic
1147618811 17:41848213-41848235 TTGAGGAATATGCAGCTAGACGG + Exonic
1148204178 17:45769246-45769268 TTGGGGGATTTCCACAGGGATGG - Intergenic
1148429457 17:47630556-47630578 TTGGGGCATTTCTGGATGGATGG - Intergenic
1151986041 17:77544445-77544467 TTGCAGCATTTCCTGCTGGAAGG - Intergenic
1153497774 18:5717508-5717530 TTGGGGAAACTCCAGATGGGGGG + Intergenic
1156070650 18:33203015-33203037 TTGCAAAATTTCCATCTGGAAGG + Intronic
1156982368 18:43305705-43305727 TTGGTGGAGTTCAAGCTGGAAGG + Intergenic
1160081426 18:75731102-75731124 TTGGAGAATTCCCTGCTGAATGG - Intergenic
1161411352 19:4119858-4119880 ATTGGAAATTTCCAGATGGAAGG - Intronic
1161493790 19:4576656-4576678 TTGTCGAATTCCCAGCTGGGTGG - Intergenic
1162882138 19:13667693-13667715 TTGGAAAAATTCCAGCTGGCCGG + Intergenic
1163710266 19:18842467-18842489 ATGGAGAGTGTCCAGCTGGAGGG + Intronic
1164438897 19:28256596-28256618 GTGGGGAGTTTCCAGGTGGCTGG - Intergenic
1165117163 19:33535518-33535540 TTGGGGAGTTTCCAGTTTGGGGG - Intergenic
1165179685 19:33957003-33957025 CTGGGGAATTTCTACCTGCAAGG - Intergenic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1165859501 19:38899938-38899960 GTGGGGAATTTCCCGCAGGGCGG + Intronic
1166049526 19:40249626-40249648 GAGGGGCATTTACAGCTGGAGGG + Intronic
1166088456 19:40492374-40492396 TTGGGGATGTTCCAGGTAGATGG + Intronic
1167855466 19:52234819-52234841 ACGGGGAATTTCAAGATGGAGGG + Intergenic
925731695 2:6923581-6923603 TTGGCAATTTTACAGCTGGAAGG - Intronic
925913935 2:8590810-8590832 GTGGGGAATTTCTGGGTGGATGG - Intergenic
926693498 2:15754127-15754149 TTTGGAAATTTCCAACTGCAAGG + Intergenic
928517557 2:32058349-32058371 TTGGGGTAAGTTCAGCTGGATGG - Intergenic
931795882 2:65709581-65709603 TTGGGTAGTTTCCAGCTTGGGGG - Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
933710358 2:85320798-85320820 AAGGGGAATTTCCATTTGGATGG + Intronic
934502046 2:94869526-94869548 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
935953004 2:108348011-108348033 TTGGGGAAATTCCAGCATGGGGG - Intergenic
937206463 2:120239846-120239868 TTGGGGAATTTCTGGAGGGAGGG + Intergenic
937685598 2:124692919-124692941 TTGGGGAATCACAAGCTGGGAGG - Intronic
938833311 2:135074308-135074330 TTGGGGACTTTCCAACAGAAAGG + Intronic
938979713 2:136514557-136514579 TGAGGGTTTTTCCAGCTGGAGGG + Intergenic
939396226 2:141633054-141633076 TTCGGAAATTTCCACCTGAATGG + Intronic
939425315 2:142028585-142028607 TTGGGACATTTCCAGTTTGAGGG + Intronic
940617995 2:156074967-156074989 AAGGAGAATTTCCACCTGGATGG - Intergenic
943160055 2:184236006-184236028 TTGGGGACTTTTAAGATGGATGG - Intergenic
945424479 2:209683082-209683104 TGGGTGAATTCCCAGATGGATGG - Intronic
947477370 2:230462361-230462383 TTGTGGAATTTCCTGGTGCATGG + Intronic
1168874071 20:1158435-1158457 TTGGGAATTTTCCAGCTGGTTGG - Intronic
1171325295 20:24286017-24286039 TTGGAGAACTTCCCCCTGGAGGG + Intergenic
1172392680 20:34576526-34576548 TTGCTGGATTTGCAGCTGGAAGG - Intronic
1174505319 20:51014010-51014032 TGGGGGAGTTTTCTGCTGGAGGG - Intronic
1176545668 21:8196943-8196965 TGGAGGAATTCCCAGCGGGATGG - Intergenic
1176564619 21:8379988-8380010 TGGAGGAATTCCCAGCGGGATGG - Intergenic
1176623965 21:9075636-9075658 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1179951797 21:44712362-44712384 TTCAGGAATTTCCCTCTGGAGGG + Intergenic
1181886681 22:26027241-26027263 CTTGGGAGTTTCCAGCTGAATGG - Exonic
1182519800 22:30878882-30878904 TTGGGGACACTCCAGCTGCAAGG + Intronic
1184087318 22:42272657-42272679 TGGGGAAGTTTCCAGGTGGAGGG - Intronic
1184379819 22:44138277-44138299 TAAGGGAATTTCCAGGAGGAGGG + Intronic
1184926022 22:47638485-47638507 TTTGGGAAATTCCACCTGAACGG + Intergenic
1184938961 22:47746915-47746937 TTGGCGAGTTTCAAGATGGAAGG + Intergenic
1185120769 22:48968630-48968652 TTTGGGAATGTCCAGGTGGCAGG - Intergenic
1203250539 22_KI270733v1_random:113180-113202 TGGAGGAATTCCCAGCGGGATGG - Intergenic
950651197 3:14408030-14408052 TTGGGTTGTTTCCAGCTGGGGGG + Intronic
951619601 3:24586816-24586838 TTGGGAAATTTCCACCTGGGGGG + Intergenic
952216021 3:31278742-31278764 GTGGGGAAGTTACATCTGGAAGG - Intergenic
952581891 3:34843770-34843792 TTAGCGGATTTCCAGCTGGTGGG - Intergenic
952694538 3:36250115-36250137 TTGGGCAGTCTCCAGCTGGGTGG - Intergenic
953899679 3:46832991-46833013 CAGGAGAATTTCCAGGTGGAAGG - Exonic
955107428 3:55911842-55911864 TTCAGGTATTTCCAGCTGAATGG + Intronic
956176419 3:66477481-66477503 TTGGGGATTGTCCATTTGGAGGG - Intronic
956751749 3:72348930-72348952 ATTGGGAATTACCAGCTGAATGG + Intergenic
960249546 3:115436996-115437018 TTGGGGAATCAGCAGCTAGATGG - Intergenic
961040858 3:123677055-123677077 TTAGGGGAGTCCCAGCTGGAGGG - Intronic
963737991 3:149042850-149042872 TTGGGTTATTTCCTGCTGGTCGG + Intronic
965530864 3:169769093-169769115 TTGTAGTAATTCCAGCTGGATGG + Intronic
965675192 3:171187425-171187447 TTTGGGAATTGCAAGCTTGAAGG - Intronic
967264188 3:187675696-187675718 CTGGGAATTTTCCAGCTGAATGG - Intergenic
968923252 4:3533300-3533322 GGGAGGAATTTCCAACTGGAGGG + Intergenic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
971264594 4:25086770-25086792 CAGGGGCATTTCCAGCTGCATGG + Intergenic
973088999 4:46108169-46108191 TTGGGGAATTTTTAGCTAGAAGG + Intronic
975520975 4:75300635-75300657 TTGGGGAAGCTCGAACTGGATGG - Intergenic
977312756 4:95407360-95407382 GTGAGGAATTTCAAGCGGGAGGG + Intronic
978653486 4:111037938-111037960 TTGGGGAATATCCACCTGGCAGG + Intergenic
979117236 4:116841025-116841047 TTGGGAATTTTCCACCTGAAAGG + Intergenic
980064164 4:128165158-128165180 TGGGGGAAATCCCATCTGGAAGG + Intronic
980794936 4:137669734-137669756 TTGGGGAAATTCCATCTGTAAGG - Intergenic
982099243 4:151952300-151952322 TGGGGGCATGTCCAGCTGTAGGG + Intergenic
984988039 4:185350537-185350559 TTGGGAACTTTCCAGTTTGAGGG + Intronic
985781402 5:1873750-1873772 CTGGGGAAGTCCCAGCTGAAAGG - Intergenic
987819829 5:22948460-22948482 TTGTGAAATTTCCAGCTTCATGG - Intergenic
993613624 5:90084266-90084288 TTGGGGAAATTCCAGAAGGCAGG + Intergenic
993895004 5:93523228-93523250 TCTGGGAAGTTCCAACTGGATGG + Intergenic
997615532 5:135243772-135243794 TTGGGGAATTTGGAGCAGAAGGG + Intronic
999326986 5:150649821-150649843 GTGGGGTATTTCCAGGAGGAAGG - Exonic
1000175277 5:158746063-158746085 TTGGGTTATTTCCAGCTTGGGGG + Intronic
1000522144 5:162308538-162308560 TAGGGGAATTTCAAGCAGGTTGG - Intergenic
1001560354 5:172665205-172665227 TGGAGGATTTGCCAGCTGGAGGG + Intronic
1003866463 6:10367442-10367464 TTGAAGAATTACAAGCTGGATGG + Intergenic
1005888214 6:30113432-30113454 TTGGGGAATTTCCAGTCACAGGG + Intergenic
1006182686 6:32163683-32163705 TTGGCTCATTTCCAGGTGGAGGG + Intronic
1006301406 6:33195241-33195263 TTGGGAGATTTCCAGGTTGAGGG + Intronic
1007195586 6:40057041-40057063 GTGGGGAAGTTCCAACTGGGTGG - Intergenic
1008591439 6:52997449-52997471 AGTGGGTATTTCCAGCTGGATGG - Intergenic
1012419417 6:99047191-99047213 CTGTGGAACTTCCAGCTTGATGG + Intergenic
1015468618 6:133576763-133576785 TGGGAGAAATTCCTGCTGGAAGG - Intergenic
1020234719 7:6346893-6346915 TTGGGGAGTTTACAGTTGGACGG - Intronic
1020437313 7:8178726-8178748 TAAGGTAATTTCCAGCAGGAAGG - Intronic
1020460524 7:8425087-8425109 TTGCTTAATTTCCACCTGGAGGG - Intergenic
1021166991 7:17354204-17354226 ATGGGGAAGTTCCAACTGGGTGG - Intergenic
1022012964 7:26325028-26325050 TTGGGGATAATCCAGCTGGGAGG + Intronic
1023739845 7:43269621-43269643 GTGGGGTATTCCCAGATGGATGG - Intronic
1024211328 7:47208188-47208210 TTGGTGAATTTCCAGCCTGCTGG - Intergenic
1026273434 7:68856212-68856234 TTTGAGAATATCAAGCTGGAAGG - Intergenic
1026681661 7:72471696-72471718 TGGGAGAATTTCCCGCTTGATGG - Intergenic
1031848848 7:126839017-126839039 TTGGGAAATTTCAGGCTGAAGGG - Intronic
1033090291 7:138379291-138379313 TTGGGGTTTTGCCAGGTGGATGG - Intergenic
1033491257 7:141845924-141845946 TTGGGGAATGTCCATGTGGCAGG + Intergenic
1035370359 7:158375912-158375934 TGGGGGATTTTACTGCTGGATGG - Intronic
1036773221 8:11592828-11592850 TTGGGGAAATTCCAGGTGGCTGG + Intergenic
1036921938 8:12864546-12864568 TTGCTGAATTTCCAGCCTGATGG - Intergenic
1044217092 8:89624764-89624786 TTTGGGAACTTCCTGCTGGGAGG - Intergenic
1045631179 8:104124749-104124771 TTGGAGAATGTCCAGCTTTATGG + Intronic
1046426883 8:114064726-114064748 TTGGGGACTTGCCAGATTGATGG + Intergenic
1048139328 8:131777817-131777839 TTAGGGAATTTCAAGATTGAGGG - Intergenic
1052667990 9:31519139-31519161 CTGGGGAAGTTCCAACTGGGCGG - Intergenic
1053137513 9:35660676-35660698 TTGGGGAATTTGTGGCAGGAGGG + Exonic
1059489145 9:114652790-114652812 TTGGGCTATTCCAAGCTGGAGGG - Intergenic
1060180420 9:121529835-121529857 CTCGGGAGCTTCCAGCTGGATGG + Intergenic
1203747148 Un_GL000218v1:46064-46086 TTTGGGAGTTTGCAGCTGGCAGG - Intergenic
1203466941 Un_GL000220v1:96452-96474 TGGAGGAATTCCCAGCGGGATGG - Intergenic
1203562958 Un_KI270744v1:73416-73438 TTTGGGAGTTTGCAGCTGGCAGG + Intergenic
1186779543 X:12899078-12899100 TTTGGGATTTTAAAGCTGGAGGG + Intergenic
1187821980 X:23297557-23297579 TTGGCCACTCTCCAGCTGGAAGG + Intergenic
1189865585 X:45323759-45323781 TTGGGGAGTTTTCAGCTGGATGG + Intergenic
1190065140 X:47235108-47235130 GAGGGGAATTTCCATCTGGGAGG - Intronic
1190380611 X:49836865-49836887 TAGGGGAAGTGCCAGCTGTAGGG + Intergenic
1190385233 X:49878424-49878446 TAGGGGAAGTGCCAGCTGTAGGG + Intergenic
1190515111 X:51215762-51215784 TTGGGACCTTTCCAGGTGGAGGG - Intergenic
1191030777 X:55968062-55968084 TTGCTGATTTTCCATCTGGAAGG - Intergenic
1191687878 X:63911090-63911112 TTGGGGAACTACAAGATGGATGG - Intergenic
1192922729 X:75724357-75724379 CTGGGGAACTTCGAACTGGATGG - Intergenic
1194046144 X:89005917-89005939 TTTGGGAATTTCCAGCAGTCTGG - Intergenic
1194959049 X:100214533-100214555 ATGGGGAAGTTCCAACTGGGAGG - Intergenic
1195332915 X:103820413-103820435 TTGAGTAATTTCAAGCTGGGAGG - Intergenic
1196359824 X:114839755-114839777 CTGAGGAATTTGCAACTGGAAGG + Intronic
1201160469 Y:11161059-11161081 TTTGGGATTTTGCAGCTGGCAGG - Intergenic