ID: 1122230756

View in Genome Browser
Species Human (GRCh38)
Location 14:100305529-100305551
Sequence CGCCCGCCCGGGCCCTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122230745_1122230756 17 Left 1122230745 14:100305489-100305511 CCGACGCCCACGGTCGGGGCATG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230744_1122230756 18 Left 1122230744 14:100305488-100305510 CCCGACGCCCACGGTCGGGGCAT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230748_1122230756 11 Left 1122230748 14:100305495-100305517 CCCACGGTCGGGGCATGGGAGAG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230749_1122230756 10 Left 1122230749 14:100305496-100305518 CCACGGTCGGGGCATGGGAGAGC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230740_1122230756 23 Left 1122230740 14:100305483-100305505 CCGTGCCCGACGCCCACGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122230756 Original CRISPR CGCCCGCCCGGGCCCTCCCG GGG Intronic
900082166 1:866596-866618 CGTCCTCCCGTGCCCTCACGTGG + Intergenic
900082177 1:866645-866667 CGTCCTCCCGTGCCCTCACGTGG + Intergenic
900082190 1:866694-866716 CGTCCTCCCGAGCCCTCACGTGG + Intergenic
900082201 1:866743-866765 CGTCCTCCCGTGCCCTCACGTGG + Intergenic
900082214 1:866792-866814 CGTCCTCCCGAGCCCTCACGTGG + Intergenic
900082227 1:866841-866863 CGTCCTCCCGAGCCCTCACGTGG + Intergenic
900082240 1:866890-866912 CGTCCTCCCGAGCCCTCACGTGG + Intergenic
900082251 1:866939-866961 CGTCCTCCCGAGCCCTCACGTGG + Intergenic
900113493 1:1019466-1019488 CGCCCCCCCAGGCCCCGCCGCGG - Intergenic
900324802 1:2103450-2103472 CCCCCTCCCAGGCCTTCCCGAGG - Intronic
900497798 1:2984173-2984195 CGCACCCCCGGGCATTCCCGGGG + Intergenic
901017936 1:6242376-6242398 CGCCCGCCCCCGCCCCCTCGGGG - Intergenic
901242557 1:7704044-7704066 GCCCCGCCCTGGCCCTCCCCGGG + Intronic
901373269 1:8818056-8818078 CGCCAGCCCGGCCCAGCCCGGGG - Intergenic
901381777 1:8878994-8879016 CGCCGCCCCGGGCCATCCCCCGG - Intronic
901676571 1:10889012-10889034 CGCCCGCCCCGGCCGCCCAGGGG - Intergenic
901735486 1:11309620-11309642 CTCCCACCAGGTCCCTCCCGTGG - Intergenic
901776066 1:11561152-11561174 TGCCAGCTGGGGCCCTCCCGTGG - Intergenic
903263388 1:22143000-22143022 CGCGCGCCCCGGCCCGCCCGCGG - Intronic
903498918 1:23791298-23791320 CGCTCTCCGGGACCCTCCCGAGG - Intronic
903724634 1:25431327-25431349 CGCCCGCCGGGGTCCGCCCCGGG + Intronic
903750437 1:25617566-25617588 CGCTCGCCCGGGCCCCGCCGAGG + Exonic
903788387 1:25875887-25875909 CGCCCTCCCCGACCCTCCCAGGG - Intergenic
904837781 1:33349974-33349996 TGTCCGCCCCGCCCCTCCCGCGG - Intronic
906204334 1:43979173-43979195 CGCCCGCGCGCGCGCCCCCGCGG - Intronic
906214384 1:44030528-44030550 CGGCCGCCCGGCCCCGCCCTAGG + Intronic
906365556 1:45206505-45206527 CGCGCTCCCGGGCCCGGCCGCGG - Exonic
906615825 1:47232222-47232244 CGGCGGCCCGGCCCCTCCCGCGG + Intergenic
906805553 1:48776534-48776556 CGGGCCCCCGGCCCCTCCCGGGG + Intronic
907200933 1:52726428-52726450 CGCCCGGGCGGGTCCTCGCGGGG + Intergenic
910237196 1:85048267-85048289 TGCCCGGCCCGGCCTTCCCGCGG + Intronic
913323515 1:117606601-117606623 GGCTCGCCCCGGCGCTCCCGCGG + Intronic
915458219 1:156054079-156054101 TGCCCGCCCGAGCCGTGCCGCGG + Intergenic
916694473 1:167221541-167221563 CCCCCGCCCGGGCCCGCTCCCGG - Intronic
921272969 1:213489300-213489322 AGCCCACCTGGGCCCTCCCTGGG - Intergenic
922196480 1:223364204-223364226 CGCCCGCGCGCTCCCTCCCCAGG + Intergenic
922496500 1:226062225-226062247 CGCGCGCCGGGGCCCGCGCGGGG + Intronic
922730601 1:227947168-227947190 GGCCCGGCCGGGGCGTCCCGCGG - Intronic
923171665 1:231422310-231422332 CGCCCGCCCGGGTCGCCGCGGGG - Exonic
923859982 1:237883663-237883685 CGCCCTCCCCCGCCCTCCCCCGG - Intronic
924419223 1:243891902-243891924 CCCCCGCCCCAGCCCTCCCCAGG + Intergenic
1065099582 10:22320782-22320804 CGGCCGCCCGCCTCCTCCCGGGG - Intronic
1065240031 10:23695391-23695413 CTCCCGGCCTGGCCCTCCTGGGG - Intronic
1067135914 10:43606896-43606918 CGCCCGCCCGTTCCCTCCACAGG - Intronic
1067711759 10:48656059-48656081 CGGCCGCCCGGGGCCTGCCTGGG + Intronic
1072591818 10:96833336-96833358 CGGCCGCCCGGCCCCTCCCGGGG - Intronic
1073058338 10:100716162-100716184 CGCCGACCCCGCCCCTCCCGCGG - Intergenic
1073122535 10:101131506-101131528 CCGCCGCCCGGGCCCCCCGGTGG + Exonic
1073208259 10:101779992-101780014 CGCCCGCCCGGAGCCTCTAGAGG + Intronic
1073241963 10:102065197-102065219 CGCCCGCCCGGGCACGCTCTCGG - Intergenic
1073325824 10:102643675-102643697 CGGGCGCCCGGGCTCTGCCGAGG - Intergenic
1074618703 10:115094231-115094253 CGCGGGCCCGAGCTCTCCCGGGG - Intronic
1075040633 10:119104397-119104419 CGCCCGCCCGCGGCCGCCTGTGG + Intronic
1075438383 10:122461401-122461423 CGCCCGCCCTGCCCCCTCCGCGG + Intergenic
1075732241 10:124643533-124643555 CCCCCCCGCTGGCCCTCCCGGGG - Intronic
1075991030 10:126839140-126839162 CACCCACCAGGGCCCTCCAGAGG - Intergenic
1076792513 10:132784855-132784877 CGCCCACCCGGGGCCGCCCCCGG + Exonic
1076850080 10:133088350-133088372 CGCCCGCCCCAGCCCGGCCGCGG - Intronic
1077065033 11:637287-637309 CGCCCGCCCGGGCGCGCCATGGG + Exonic
1077282769 11:1753092-1753114 CGTCCTCCCGGGCCCTCCCTTGG - Exonic
1077675028 11:4187708-4187730 CGCCCACCCGCGGCCTCACGGGG + Intergenic
1077914704 11:6603738-6603760 CGCCGGCCCCGCCCCGCCCGTGG - Intronic
1078216316 11:9314723-9314745 GCCCCGCCCCGGCCCGCCCGCGG + Exonic
1078246107 11:9574162-9574184 CGCTCGCCCGGGCCGGCCCCCGG + Exonic
1078495297 11:11811326-11811348 AGCGAGCCCAGGCCCTCCCGAGG - Intergenic
1078987066 11:16607083-16607105 CGGCCACCCGCGCCCTCTCGGGG + Intronic
1081832025 11:46121798-46121820 CGCCCGCCCGAGCGCCGCCGCGG - Intergenic
1082789225 11:57335745-57335767 CTCGCGCCGGGGCCCTCGCGAGG - Exonic
1083254109 11:61485883-61485905 CGCCCTCACAGGCCCTCCCTGGG + Exonic
1083628821 11:64085565-64085587 CGCCCGCCCGGGTCCACCCCAGG + Intronic
1083660927 11:64251489-64251511 GCCCCGCCCGGGCCCCGCCGAGG + Intergenic
1084165551 11:67373355-67373377 TCCCCGCCCGGCCCCTCTCGAGG + Intronic
1084310367 11:68312992-68313014 TCCCCACCCGGGCCCTCCCCGGG + Intronic
1085680925 11:78574493-78574515 CGTCCGCCCAGGCCCTCCGCGGG + Exonic
1089249134 11:117144762-117144784 TGCCCTGCCGGGCCCACCCGCGG + Intronic
1089637467 11:119824544-119824566 GGTCCGCCCGGCCCCTCCCCAGG - Intergenic
1089993414 11:122882871-122882893 CGCCCGCCCCGGCGCTGCCCTGG - Exonic
1090364189 11:126192544-126192566 AGCCCGTCCTGGCCCTGCCGGGG - Intergenic
1090788400 11:130069688-130069710 CCCCCGCCCGGCCCCGCCCCCGG - Intergenic
1091263784 11:134254067-134254089 CTCCGGCCCGGGTCCTCCTGCGG + Intronic
1091616110 12:2052653-2052675 CGCGCGCCCCGGCCTCCCCGGGG + Intronic
1093697854 12:22182669-22182691 CTCCCGCCAGGTCCCTCCCATGG + Intronic
1094199246 12:27780173-27780195 CGCTCGCCCGGCCTCTCCGGCGG - Exonic
1094470277 12:30796233-30796255 CGCCCGCCCCCGCCGCCCCGCGG + Intergenic
1096392258 12:51238716-51238738 GGACCGCGCGGACCCTCCCGCGG + Intronic
1096741155 12:53695171-53695193 CGTCCGGCCGGGCCCTGCGGAGG - Intergenic
1096792571 12:54054162-54054184 GGCCCGCCTGGGCCGGCCCGTGG - Exonic
1097029183 12:56079543-56079565 CGCCGGCCGGGCCTCTCCCGGGG - Intergenic
1097194967 12:57238153-57238175 CTCCCGCCCGCGCCCTCCACAGG - Intronic
1100315476 12:93441488-93441510 CGCGCGCCCGCGGCCTCCGGCGG + Intronic
1101037216 12:100717440-100717462 CGCCGGGCCGGGCCGTCCAGGGG + Intergenic
1103119998 12:118372513-118372535 CGCTGTCCCGGTCCCTCCCGGGG + Intronic
1103727373 12:123004830-123004852 CTCCCGCCTGGGCCCTGCTGTGG - Intronic
1104049632 12:125186735-125186757 CGCGCGCCCGGCCCGGCCCGCGG - Intergenic
1104823629 12:131693348-131693370 CTCCCTCCCTGGCCCTCCCCAGG + Intergenic
1105054038 12:133080891-133080913 CGCCCCCCAGGGCCCCTCCGCGG - Exonic
1105768072 13:23579894-23579916 CGCCCGCCCGCGTCCTGCGGAGG + Intronic
1105847725 13:24307982-24308004 CTCCCGCCAGGACCCTGCCGGGG - Intronic
1108340698 13:49496103-49496125 CGCCCGCCCGCCCGCCCCCGCGG - Intronic
1113082326 13:106533217-106533239 TGCCCGCCCGGTGCCTCCAGAGG - Intronic
1113776105 13:112946010-112946032 CGCCAGCCCGGGCTCTTCTGGGG + Intronic
1117377414 14:55129187-55129209 CGCCCGGCCCGCCTCTCCCGAGG - Exonic
1117517384 14:56515278-56515300 CTCCCGCTGGGGCCCTCCCACGG - Intronic
1118768195 14:68924101-68924123 CGCTCCCCCCGGCCCTCCCCTGG - Intronic
1119261015 14:73238003-73238025 CGGCCACCCCGGGCCTCCCGTGG + Intronic
1121417439 14:93788834-93788856 CGGCCGCGCGAGCCCTCCCCGGG + Intergenic
1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG + Intronic
1122750460 14:103928808-103928830 CGCGAGCCCGTGCCCTCTCGCGG + Intronic
1122889008 14:104724140-104724162 CGCCCGCCCTGGCCCTCCCCCGG + Intergenic
1123036651 14:105474516-105474538 CGCCTGGCCGGGCCGTCCCCGGG - Intronic
1124169351 15:27358963-27358985 CGCCCCGCCGGGTCCTCCCCAGG - Intronic
1124249306 15:28096794-28096816 AGCCCACCCGCGGCCTCCCGAGG - Intronic
1124351865 15:28961631-28961653 CACCCGCCCGGCCGCTCCCCCGG - Intronic
1129116715 15:73368782-73368804 GGCCCGTCCGGCCCGTCCCGGGG + Exonic
1129334365 15:74843427-74843449 CCGCCGCCCGCGCCCTCACGTGG - Intergenic
1129539305 15:76338042-76338064 CGCGCGCCCCGGCCCTGCCCAGG + Intronic
1132483995 16:180899-180921 ACCCCGCCGGGGCCCTCCCGGGG - Intronic
1132484124 16:181382-181404 CCGCCGCCCGGGGCGTCCCGCGG - Intergenic
1132523234 16:401105-401127 GCCCCGCCCGGGCCCCCACGCGG + Intronic
1132614174 16:832088-832110 CCCCCGCCCCGGCCCTGCCCTGG - Intergenic
1132656687 16:1044470-1044492 CACCCGCCCGGGGCCGCCTGGGG + Intergenic
1132843557 16:1990031-1990053 CGTCCGGCCGGCCCCGCCCGAGG - Exonic
1132933776 16:2471246-2471268 CGCAAGCCCGGGCCCAGCCGGGG - Intergenic
1133188431 16:4116293-4116315 CGCCCGCCCGCGCCCACGCCGGG + Intergenic
1133802099 16:9092308-9092330 CCCCCGCCCGGGCCCGGCCCCGG + Intronic
1135116391 16:19727340-19727362 CGCCCGCCTTGGCCTTCCAGTGG - Intronic
1136383473 16:29908172-29908194 CGCTGGCCCTGGCCCTCCCCAGG - Intronic
1136540314 16:30924682-30924704 CGCCCTCCAGGCCCCTCCCCTGG + Exonic
1137665218 16:50245902-50245924 TGCCCGGCCGCTCCCTCCCGCGG + Intergenic
1139528206 16:67529160-67529182 CGGCCGCCAGGGCCTTGCCGTGG - Intronic
1139761335 16:69187049-69187071 CGCCGGCCCCGCCCCTCCAGAGG + Intronic
1141132181 16:81444461-81444483 CTCCCGCCCGGGCACCCGCGGGG + Intergenic
1141573466 16:84948652-84948674 CGCCCGGCCGGGCACTCCCACGG + Intergenic
1141638620 16:85328813-85328835 CCCCGCCCCGGGGCCTCCCGCGG + Intergenic
1142136357 16:88453577-88453599 CGCCCGCCGCCGCCCGCCCGGGG + Exonic
1142240124 16:88941194-88941216 CGGCCGCCTGGGCCATGCCGGGG + Intronic
1142395338 16:89828544-89828566 TGCCCGCCCGGGCCATGGCGGGG - Exonic
1142421451 16:89972846-89972868 CGCCCTCCCGCGCTCCCCCGCGG - Intergenic
1142431083 16:90027749-90027771 TGCCCGCCCACGCCCACCCGGGG - Intronic
1142471954 17:169727-169749 CCCCCACCCTGGCCCTCCAGAGG + Intronic
1142695151 17:1629206-1629228 CCCCCAGCCGGGCTCTCCCGCGG + Intergenic
1142760919 17:2041596-2041618 CCCCCGCGCGGGCCGGCCCGGGG - Exonic
1143078760 17:4366321-4366343 CGCCAGCCCGGGCCCTCGGCAGG - Exonic
1143749947 17:9021147-9021169 CCCCCGCCCGCGCGCTCCCCCGG + Intergenic
1145248563 17:21285126-21285148 CCCCCGCCTGGGCCCTCACCTGG + Intronic
1147145497 17:38482287-38482309 CGCCTGCCCCGGGCCTCCCAGGG + Intronic
1147684013 17:42276307-42276329 CGCCCGCTCGCTCCCTCCCTCGG + Exonic
1147996595 17:44363243-44363265 CGCCCGCCCCAGCCCGCCCCTGG + Intronic
1148081015 17:44967793-44967815 CGGCCCTCCGGGGCCTCCCGGGG - Exonic
1148406941 17:47423957-47423979 CGCGCGCCCCCTCCCTCCCGAGG - Intronic
1148664202 17:49362264-49362286 CGCGCGCCCGCGCGCGCCCGCGG + Intronic
1148782452 17:50129624-50129646 AGCCCGCCCGGAGCCCCCCGCGG - Exonic
1148878561 17:50707686-50707708 CGCCTGCCCCGCCCCGCCCGGGG + Exonic
1150840240 17:68600536-68600558 CACCCCCGCGGGCGCTCCCGAGG + Exonic
1151478604 17:74357119-74357141 CGCCCGCCTGGGGCGCCCCGTGG - Exonic
1152049207 17:77959155-77959177 CCGCCGCCCGCGCACTCCCGAGG + Intergenic
1152349701 17:79777936-79777958 CCCCCGCCCGGGGCCCCGCGCGG + Intergenic
1152357430 17:79813791-79813813 CCCTCGCCCCGCCCCTCCCGGGG + Intergenic
1152364044 17:79844891-79844913 CCCCTGCCCGGGCCCTGCCTGGG - Intergenic
1152544235 17:80992563-80992585 CGCCTGCCGGGGTCCTGCCGGGG + Intronic
1152711183 17:81871146-81871168 CGCCCGCCGAGACCCTGCCGCGG + Intronic
1152933752 17:83124261-83124283 CGGCTGCCCGAGCCCTCCAGGGG - Intergenic
1153457214 18:5295262-5295284 GGCCCTCCCCCGCCCTCCCGCGG + Intronic
1153457509 18:5296203-5296225 CGCAGGCCAGGGCCCTCCGGGGG - Intronic
1153900755 18:9614887-9614909 CGGCCGGGCGGGGCCTCCCGCGG + Intronic
1154210877 18:12377452-12377474 CGCCCTCCCGAGTCCTCCCTCGG - Intergenic
1154304349 18:13218962-13218984 CGCGCCCCCAGGCCCACCCGGGG - Intronic
1155654286 18:28176914-28176936 CGCCCGCCCCACCCCGCCCGTGG + Intronic
1157496750 18:48161939-48161961 CGCCGGGCCGCGGCCTCCCGGGG - Intronic
1158478787 18:57803080-57803102 CGCCCGCCCGGCCCCAGCCCTGG + Exonic
1158725660 18:59969509-59969531 CGCGCGCCCCCACCCTCCCGAGG - Intergenic
1158931095 18:62325481-62325503 CGCCGGCCCCGGCCCTTCCCGGG - Intronic
1158954061 18:62523290-62523312 CCCCGGCCCCGGCCCTCCCCCGG + Exonic
1160518227 18:79490091-79490113 CCCCCGCCCCCGCCCCCCCGTGG + Intronic
1160765306 19:804962-804984 CGCCCGCCCTGGCCCTGGCCCGG + Intronic
1160793887 19:935039-935061 CTCCCGCCCGGCCCCTACTGGGG + Intronic
1160880094 19:1315800-1315822 CGCCCTCTCTGGCCCCCCCGCGG + Intergenic
1160992212 19:1864421-1864443 CACCCTCCCGGGCCCCGCCGCGG - Intergenic
1161703070 19:5805330-5805352 CTCCGGCCCGGGCCCCCCCCGGG + Intergenic
1161864317 19:6822352-6822374 CCCCCGCCCACGCCCTCCCCAGG - Intronic
1162442475 19:10701532-10701554 CGCCTGCCCGGGCCCTGGAGCGG - Exonic
1162951327 19:14073474-14073496 CGCCCGCCCGCGCCCGCTCCAGG - Exonic
1163502831 19:17686768-17686790 CGCCCGCCCGCTCCCCGCCGCGG - Intronic
1165871281 19:38975417-38975439 CGCTTTCCCGGGCCCTCCCTCGG - Intronic
1166094190 19:40529449-40529471 CGCCCGCCCCGCCCCTCTCCTGG - Intronic
1166317864 19:41998848-41998870 CGCCCGCACAGCCCCGCCCGTGG + Exonic
1166528409 19:43527247-43527269 CCCCCGCCCCGCCCTTCCCGGGG - Intronic
1166672944 19:44722443-44722465 GGCCCGCTCGGGGCTTCCCGAGG - Intergenic
1166947202 19:46404539-46404561 CTCCTGCCCCGGCCCTCCTGGGG - Intergenic
1167331606 19:48859631-48859653 GGGCCGCCGGGGCCCTCCCCGGG + Exonic
1167428421 19:49441431-49441453 CGGCCGCCCGGGCCCGCGGGCGG - Exonic
1167454546 19:49591483-49591505 CCCCCGCCCGGGGCCTTCCCGGG + Intergenic
1167501600 19:49851478-49851500 GGCCCGCTCGGCCCCTCCCATGG + Exonic
1168246928 19:55117192-55117214 CCCCCGCCCGGCGTCTCCCGGGG - Intronic
925349099 2:3188719-3188741 TGCCCGCCCTGGGCCTCCCCTGG - Intergenic
925730538 2:6917325-6917347 CGCCCGCCTGCGCCGGCCCGAGG - Intergenic
926342410 2:11914667-11914689 TGCCAGACCCGGCCCTCCCGAGG - Intergenic
929583727 2:43100942-43100964 CGGCCGCCGGGGCCCCCCCTGGG - Intergenic
929779779 2:44949965-44949987 CGCCTGCCCCCGCCCTCCCTCGG - Intergenic
929788679 2:45009132-45009154 CGCCCGCGCGCGCCCTCACCGGG + Exonic
929857828 2:45651168-45651190 CGCCAGCCCGCGCTCCCCCGCGG - Intergenic
930198373 2:48530363-48530385 CGCCCGCCCTGGCCGCCCCCAGG + Intronic
934238632 2:90250583-90250605 CGCCGGCCCTGGCCCTGCCTTGG + Intergenic
936863894 2:117055712-117055734 CTCCCCCCCGGGCGCTGCCGCGG - Intergenic
937221280 2:120344486-120344508 GGCCGCCCCCGGCCCTCCCGGGG - Intergenic
937283422 2:120735776-120735798 AGCCCGCCCGCTCCCTGCCGGGG - Intronic
937986137 2:127638938-127638960 CGCCTGGCCTGGCCCTCCCCAGG - Exonic
941067985 2:160924819-160924841 CTCCCACCAGGTCCCTCCCGTGG + Intergenic
941905560 2:170714641-170714663 CGGCCGCCCGGCCCCGCCCCAGG + Intergenic
941992885 2:171574283-171574305 CGCCAGCCCGGGGCCTCCACGGG + Intergenic
942702542 2:178730022-178730044 CCCCCGCCCCGGCCCACCCCAGG + Intronic
944221884 2:197311003-197311025 CGCCCGGCCGGGCCGGCCCCGGG + Intronic
946386729 2:219388130-219388152 CGCCCGCCCTGCCCCTCGCAGGG + Intronic
947523358 2:230864852-230864874 CGGGCGCCGGGGCCCTCCCGCGG + Intronic
948467386 2:238158884-238158906 CGCCCGCCCGCGCCCCCTCCCGG - Intergenic
948874540 2:240819792-240819814 CGGCCGGGCGAGCCCTCCCGAGG + Intronic
948910070 2:240998499-240998521 CGCGCGCCCGCGCCCTCCCACGG + Intergenic
949018253 2:241725557-241725579 AGCCCTCCCGGGCCCATCCGAGG - Exonic
1173649156 20:44651885-44651907 CGCCCGACCGGACCCACCTGTGG + Intronic
1174258750 20:49278131-49278153 CGCCCGCCCGGCTCCGCCCAGGG - Exonic
1175248894 20:57597205-57597227 CCCCCGCCCGCGCCCTCCGCAGG - Intergenic
1176147672 20:63572683-63572705 CGCCCGGCCTGCCCCTCCCTGGG + Intronic
1176548979 21:8213461-8213483 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176556872 21:8257673-8257695 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176567908 21:8396491-8396513 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176575812 21:8440710-8440732 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1176952758 21:15065324-15065346 GGCGCGCCCGGGCCGTCCCCCGG + Intergenic
1178610417 21:34074083-34074105 CGCCCGCGCGTGTCCTCCCGCGG - Intronic
1179495050 21:41766435-41766457 GGCCCGCCCGGGACCCACCGGGG - Intronic
1179529543 21:42009634-42009656 CCCGCCCCCGGCCCCTCCCGCGG - Intronic
1180699695 22:17774521-17774543 GGCCCGCCCCGGCCCGCCCCCGG + Intronic
1180955827 22:19740805-19740827 CGCCCGCCCGGGCCTTGTGGGGG + Intergenic
1181574876 22:23787302-23787324 GGCCCGCCCCGGGGCTCCCGCGG - Intronic
1182428699 22:30288146-30288168 CGCCAGCCTGGGCCCTCCCTGGG - Intronic
1182476765 22:30580748-30580770 CTCCAGCCCTGGCCCTCCAGTGG - Intronic
1183649164 22:39144504-39144526 GGCCCGCTCAGGCCCGCCCGGGG + Intronic
1184101464 22:42343644-42343666 CGCGCGCCCCGGCCGGCCCGGGG + Intergenic
1184105790 22:42366927-42366949 CGCCTGCCCTGGGCCTCCCCTGG + Intergenic
1184680789 22:46071338-46071360 CGCCCGCGCGCGCCGTCCCGGGG + Intronic
1184712754 22:46262845-46262867 CGCCCGCCCGGCCTCCCCCGCGG - Exonic
1184755846 22:46515257-46515279 CCCCCACCTGGGCCCTCCTGGGG + Intronic
1184881281 22:47305980-47306002 CTCCAGCCCGGGCCCTCTCCTGG + Intergenic
1185051139 22:48554944-48554966 CCCCCGCCCAGGGACTCCCGAGG - Intronic
1185289166 22:50015363-50015385 CGCCCGCCCCGGCGCGCCCCGGG + Intronic
1185343055 22:50300067-50300089 CCACCGCCCGCGCCCTCCCGGGG + Intronic
1203253863 22_KI270733v1_random:129768-129790 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1203261919 22_KI270733v1_random:174847-174869 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
951906873 3:27715012-27715034 CCCCCTCCTGGACCCTCCCGGGG - Intergenic
952334306 3:32391818-32391840 CGCCCGCCCCCGCCCGCCCCCGG + Exonic
954453806 3:50586167-50586189 TGCCCCCCAGGGCCCTCCTGAGG + Intergenic
954909088 3:54088005-54088027 CGCCCGCCTGAGCTCGCCCGAGG + Intergenic
955387711 3:58492362-58492384 CCCCCGCCCAGGCCCCGCCGCGG - Intronic
956761201 3:72446888-72446910 CGCCCGCCGCGGCCCTTCCCGGG - Exonic
960687233 3:120306855-120306877 GGCCTGCTCGGCCCCTCCCGTGG + Intergenic
961328231 3:126124242-126124264 CCCCCGCCTGGGCTCTCCCCAGG + Intronic
961345143 3:126259453-126259475 AGCCAGGCCGCGCCCTCCCGGGG - Intergenic
961545301 3:127629151-127629173 CGCCCGCGCGGCCCCTGACGCGG + Intergenic
961827612 3:129606949-129606971 CGCCCTCCAGGACCCGCCCGCGG + Intergenic
964819664 3:160755881-160755903 CGCCCGCGCGGTCCCTCCGGGGG - Intronic
965596980 3:170419646-170419668 CTCCCGCCCGGCCTCCCCCGGGG + Intronic
965827752 3:172747822-172747844 CGCCCGCCTGGGCCTTCCAAAGG + Intergenic
966860813 3:184230143-184230165 CGGCCCCCCGGGGCCCCCCGCGG - Intronic
966862063 3:184236130-184236152 CGCCCTCCCTGGCCCTCCACAGG + Exonic
967055349 3:185825116-185825138 CGGCCGGCCCGGCCCGCCCGGGG + Intergenic
968356722 3:198113822-198113844 CGCCGGGCCGGGCCCTGCCACGG + Intergenic
968601937 4:1513585-1513607 CGGAAGCCCGGGCCCTGCCGGGG - Intergenic
969723495 4:8906242-8906264 CTCCAGCCCGGCCCCTCCCCAGG + Intergenic
972312113 4:37891265-37891287 CGCCCGCCCAGGCCGTCCCCAGG + Exonic
972396859 4:38664766-38664788 CCCCCGCCCGCGCCCTGCCCGGG - Intronic
976199058 4:82561691-82561713 CGCCCGCCCGAGCCCTCCGCGGG - Intronic
977176766 4:93828626-93828648 CGCCTGCCCGCGCCCTCCATTGG + Intergenic
980930014 4:139176536-139176558 CCCCCGCCCTGGCCTCCCCGCGG + Intronic
981617285 4:146655160-146655182 CGGGCGCCTGGGCCCTCCGGGGG + Intergenic
983238758 4:165207899-165207921 CGCCCGCCCGCTCACTCACGCGG - Intronic
985532644 5:443109-443131 CACGGGTCCGGGCCCTCCCGCGG - Exonic
985621126 5:956684-956706 CGCCTCCCCTGGCCCTTCCGAGG - Intergenic
985688505 5:1294546-1294568 GGCCCGCGGGGGCCCCCCCGAGG - Exonic
985781952 5:1876310-1876332 CGGCTGCCCGGGCGCTCCTGGGG + Intergenic
985791706 5:1931608-1931630 CACTCGCCCGGGCTCTGCCGAGG + Intergenic
985995552 5:3595387-3595409 CGCGCGGCCGGGGCCTCCAGGGG - Intergenic
986451472 5:7869444-7869466 CGCCGCCCAGGGGCCTCCCGCGG - Intronic
995779676 5:115762156-115762178 CTCCCACCAGGGCCCTCCCTGGG + Intergenic
998389494 5:141778447-141778469 CTCCCACACGGTCCCTCCCGTGG - Intergenic
998491579 5:142551616-142551638 CGCACTCCCGAGCCCTCCCCCGG - Intergenic
998503380 5:142652805-142652827 TGCCCGCCCGGGGCCTGGCGTGG - Intronic
999767938 5:154755313-154755335 CGCCCGCCCGCCGCCTGCCGCGG + Intronic
1001296817 5:170504308-170504330 CGCCGGGCCGGGTCCTCGCGCGG + Intronic
1002524311 5:179806880-179806902 GGCCCGGCCCGGCCCTGCCGCGG - Intronic
1003175588 6:3750902-3750924 CCCCTGCCCGGTACCTCCCGAGG - Intronic
1005851868 6:29828479-29828501 CCCTCGCCCGGACCCACCCGCGG - Intronic
1007431449 6:41779704-41779726 CGCCCGCCCGGGGCTTCCTAGGG + Intronic
1015315072 6:131808093-131808115 TTCCCCGCCGGGCCCTCCCGGGG - Exonic
1015842407 6:137489205-137489227 CTCCCGCACGGCCCCTCCCTTGG + Intergenic
1017304987 6:152906881-152906903 CGCCCGCCCGGCCTCTTCCAAGG + Intergenic
1017873079 6:158502707-158502729 CACCCCCCCGGGCCCGCCCTTGG - Exonic
1019290603 7:248324-248346 CTTCCGCCGGGTCCCTCCCGTGG + Exonic
1019355960 7:579111-579133 CGCCCGTCCGGGGCCTCCATGGG - Intronic
1019415928 7:926472-926494 CACCCTGCCGGGTCCTCCCGGGG + Intronic
1019543756 7:1562996-1563018 GGCCCCCCAGTGCCCTCCCGAGG - Intergenic
1020274374 7:6615701-6615723 CCCCCGCCCCGGCCCCCGCGCGG + Exonic
1021992663 7:26152689-26152711 CGCGCGCCCCCACCCTCCCGAGG - Exonic
1022106205 7:27199652-27199674 CGCCGGGCCGGGACCTCCCGAGG + Exonic
1022563970 7:31378206-31378228 CTCCCACCGGGTCCCTCCCGTGG - Intergenic
1023861765 7:44220969-44220991 CGCTCCCCCAGGCCCTCCCCTGG - Intronic
1027151859 7:75738977-75738999 CGCCCGCCCCGCCCTACCCGCGG + Intergenic
1027232640 7:76281663-76281685 CCCCGGCCCGCGCCCCCCCGGGG + Exonic
1029376148 7:100177938-100177960 CGCCCGCCGCTGCCCTTCCGGGG - Intronic
1029715651 7:102324072-102324094 CCCCCCCCCGGGCTCTCCCAAGG + Intergenic
1033033209 7:137846747-137846769 AGCCCGCCCGGCCCCTGCAGCGG - Exonic
1034197872 7:149262068-149262090 CGCCGCCCCGCGCCCTCCCGAGG - Intergenic
1034254062 7:149714889-149714911 GGCGCGCCCGGGCCCGCCCCCGG - Intronic
1034272944 7:149812136-149812158 TGCCCGCCTGGACCCTCCTGGGG + Intergenic
1034278999 7:149838655-149838677 GGGCCGCCCGCTCCCTCCCGAGG + Intronic
1034419048 7:150979416-150979438 TCCCCGCCCTGGCCTTCCCGGGG - Intergenic
1034951234 7:155298114-155298136 CGCCCGCCCGGGGCCAGCGGCGG - Intronic
1034957616 7:155344630-155344652 GGCCCTCCCGGGACCTCCCTGGG + Intergenic
1034983220 7:155491401-155491423 GCCCCGCCCTGGCCCTCCTGCGG - Intronic
1034985307 7:155509666-155509688 CCCCAGCCCGGGCCATCGCGCGG - Intronic
1035187731 7:157139217-157139239 CGCCCGCCCGGCTGCTTCCGCGG + Exonic
1035523097 8:290957-290979 CGTCCTCCCGAGCCCTCACGTGG - Intergenic
1035523108 8:291006-291028 CGTCCTCCCGTGCCCTCACGTGG - Intergenic
1036664689 8:10730731-10730753 CCGCCGCCAGGGCCCGCCCGGGG + Intronic
1036786707 8:11692738-11692760 CGTCCGTCCGCGCCCTCGCGTGG - Intronic
1036802569 8:11803082-11803104 CGTCCACCCGGGCCCTACAGGGG - Intronic
1037482107 8:19314229-19314251 GGCCAGCCCGGACCCTCCCGGGG - Intronic
1039467825 8:37796820-37796842 CGCCCGCCCGGGCCTTCCGCGGG - Intronic
1039531780 8:38269092-38269114 GGGCCGCCCGGGCCCGGCCGTGG + Intronic
1039542240 8:38382001-38382023 CGCCCGGCCCGGCCCGGCCGTGG - Exonic
1040915723 8:52565160-52565182 TGCGCCCCCGGGGCCTCCCGTGG + Exonic
1041673718 8:60517261-60517283 CACCCGCCCGGCCGCGCCCGGGG - Intronic
1045327247 8:101126514-101126536 CGCTCGCACGCGCCCTCCCAGGG + Intergenic
1048009183 8:130443107-130443129 CGTCGTCCCGGGCCCTCCCCCGG + Intronic
1048888041 8:138924375-138924397 TGCTTGCCCGGGCCCTCCTGTGG - Intergenic
1051936245 9:22446721-22446743 CCCCGCCCCGGGCCCTCCCCCGG + Intergenic
1052991747 9:34522799-34522821 CGCTGCCCCGGACCCTCCCGCGG - Exonic
1053129079 9:35605306-35605328 CGCCCGCCCGCCTCCGCCCGCGG + Exonic
1054489690 9:65763544-65763566 CGCCCCCCCGCCCCCTGCCGCGG + Intergenic
1055753601 9:79533123-79533145 CACCCTCCCTGACCCTCCCGAGG - Intergenic
1057294648 9:93828058-93828080 CGCCCGCCCTGGGCCGCCAGCGG - Intergenic
1057481247 9:95447226-95447248 GGCCCGCTGGGGCCCTCGCGGGG - Exonic
1058045451 9:100352733-100352755 CGTCGGGCCGGGTCCTCCCGGGG - Intronic
1060296530 9:122347149-122347171 CGGCCGCCCGGGCCGCTCCGCGG - Intergenic
1060700561 9:125746828-125746850 GGCCCGCCGGGGCCCTCCTCCGG + Intergenic
1061038900 9:128128432-128128454 CGCCGGGCGGGGCCATCCCGGGG - Exonic
1061225572 9:129279129-129279151 CCCCCCCCCGGTCCCTCCCCTGG + Intergenic
1061242679 9:129383524-129383546 CGCCCGCTGGGGGCCTCGCGCGG + Intergenic
1061472151 9:130835295-130835317 CGCGCGCCCGCGCCCGCCCATGG - Intronic
1061472243 9:130835612-130835634 CTCCCGCCTGCGCCCTCCCCGGG + Intronic
1061773436 9:132944916-132944938 CGCCCCCTCGGGCTCTCGCGTGG - Intergenic
1061808424 9:133149038-133149060 CGCTCGCCTGGGCCCGCGCGCGG + Intronic
1061975952 9:134068116-134068138 CGCGCGCCCGCGGCCTCCCCTGG - Intronic
1062653487 9:137590299-137590321 CCCCCGCTCGGCGCCTCCCGAGG - Exonic
1203470263 Un_GL000220v1:112912-112934 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1203478084 Un_GL000220v1:156884-156906 GGCCCGCCCGGCCGCGCCCGTGG + Intergenic
1189332351 X:40151853-40151875 CCCTCGCTCGGCCCCTCCCGTGG + Intronic
1196804739 X:119574394-119574416 GCCCCGCCCCGGGCCTCCCGTGG + Intergenic
1198800134 X:140439718-140439740 CCCCAGCCCGGGCCCGCCCCCGG - Intergenic
1199264885 X:145818212-145818234 CGCCCGCGCGGACGGTCCCGGGG - Exonic
1200017769 X:153179441-153179463 TGCCAGCCCTGGCCCACCCGCGG + Intronic
1200163271 X:154019822-154019844 CGCCGGGCCGGGACCTGCCGGGG + Exonic