ID: 1122230756

View in Genome Browser
Species Human (GRCh38)
Location 14:100305529-100305551
Sequence CGCCCGCCCGGGCCCTCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 336}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122230749_1122230756 10 Left 1122230749 14:100305496-100305518 CCACGGTCGGGGCATGGGAGAGC 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230740_1122230756 23 Left 1122230740 14:100305483-100305505 CCGTGCCCGACGCCCACGGTCGG 0: 1
1: 0
2: 0
3: 4
4: 54
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230744_1122230756 18 Left 1122230744 14:100305488-100305510 CCCGACGCCCACGGTCGGGGCAT 0: 1
1: 0
2: 0
3: 0
4: 34
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230748_1122230756 11 Left 1122230748 14:100305495-100305517 CCCACGGTCGGGGCATGGGAGAG 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336
1122230745_1122230756 17 Left 1122230745 14:100305489-100305511 CCGACGCCCACGGTCGGGGCATG 0: 1
1: 0
2: 0
3: 2
4: 35
Right 1122230756 14:100305529-100305551 CGCCCGCCCGGGCCCTCCCGGGG 0: 1
1: 0
2: 2
3: 21
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122230756 Original CRISPR CGCCCGCCCGGGCCCTCCCG GGG Intronic