ID: 1122231199

View in Genome Browser
Species Human (GRCh38)
Location 14:100306975-100306997
Sequence CACCGCCGCCGCGGGCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122231199_1122231216 24 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231216 14:100307022-100307044 GCCGAACCCGCCGGGTTCTGGGG No data
1122231199_1122231219 29 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231219 14:100307027-100307049 ACCCGCCGGGTTCTGGGGGTCGG No data
1122231199_1122231212 16 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231212 14:100307014-100307036 GACTCCTGGCCGAACCCGCCGGG No data
1122231199_1122231211 15 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231211 14:100307013-100307035 GGACTCCTGGCCGAACCCGCCGG No data
1122231199_1122231215 23 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231215 14:100307021-100307043 GGCCGAACCCGCCGGGTTCTGGG No data
1122231199_1122231218 25 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231218 14:100307023-100307045 CCGAACCCGCCGGGTTCTGGGGG No data
1122231199_1122231206 -6 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231206 14:100306992-100307014 GCGGTGGCCTCCGGGGCTTCCGG No data
1122231199_1122231214 22 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231214 14:100307020-100307042 TGGCCGAACCCGCCGGGTTCTGG No data
1122231199_1122231208 2 Left 1122231199 14:100306975-100306997 CCTGCGCGCCCGCGGCGGCGGTG No data
Right 1122231208 14:100307000-100307022 CTCCGGGGCTTCCGGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122231199 Original CRISPR CACCGCCGCCGCGGGCGCGC AGG (reversed) Intergenic
No off target data available for this crispr