ID: 1122234748

View in Genome Browser
Species Human (GRCh38)
Location 14:100325293-100325315
Sequence CTGGGCAAAGGCCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 1, 2: 10, 3: 126, 4: 833}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122234748_1122234765 30 Left 1122234748 14:100325293-100325315 CCCTCCTCCTGGCCTTTGCCCAG 0: 1
1: 1
2: 10
3: 126
4: 833
Right 1122234765 14:100325346-100325368 GCCAAAACACAGTTACCGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122234748 Original CRISPR CTGGGCAAAGGCCAGGAGGA GGG (reversed) Intronic
900029412 1:359948-359970 CTGGCCAGAGGCCAGCAGGAGGG + Intergenic
900050014 1:588720-588742 CTGGCCAGAGGCCAGCAGGAGGG + Intergenic
900116916 1:1032956-1032978 CTGGGCAGCGGCCAGGGAGAGGG + Intronic
900132318 1:1092340-1092362 CTGAGCAAAGGCCGGGCCGAGGG - Intronic
900284654 1:1893333-1893355 CTGGGCCAAAGCCTGGAGGATGG - Intergenic
900368432 1:2320869-2320891 CCAGGCAGAGGCCAGGAGGTTGG + Intergenic
900838867 1:5031055-5031077 CTGGGAGAAGGCAAGGGGGAGGG - Intergenic
900926343 1:5708639-5708661 CAGGGCCAAGGCCAATAGGAAGG - Intergenic
900966815 1:5964575-5964597 CTGGGTACAGGCCGGGAGGGTGG - Intronic
900971308 1:5993631-5993653 CAGGACAAATGCCAGGAGGAGGG - Intronic
901019796 1:6249833-6249855 CTCCGCGAAGGCCAGGAGGCTGG + Exonic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901063852 1:6485697-6485719 CTGGGCAGAGGCGGGGAGGCGGG - Intronic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
901112838 1:6812273-6812295 CTGGGCAAAGGCCACAAGCTAGG - Intronic
901115381 1:6839760-6839782 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901145419 1:7061650-7061672 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
901675658 1:10882260-10882282 CAGTGCAAAGGCCCGGAGGCAGG - Intergenic
901760129 1:11465622-11465644 CTGGGCACAGGGCAGCAGGGCGG - Intergenic
901922623 1:12547853-12547875 CAGGGCAAATGCCAGGTGGATGG - Intergenic
902336699 1:15758542-15758564 CTTGGCACAGGCCAGGGGGTGGG - Intronic
902374233 1:16022808-16022830 CTGGACAAATGACAGGAGGGTGG - Intronic
902379184 1:16044685-16044707 CTGGACAAATGCCAGGAGGAGGG - Intronic
902481463 1:16714254-16714276 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
902627573 1:17685390-17685412 CAGTGCAAAGGCCCGGAGGCAGG - Intronic
902651086 1:17838088-17838110 CTGTGCAAAGGCGCAGAGGAGGG + Intergenic
903192667 1:21665753-21665775 CTGGGGTCAGCCCAGGAGGAGGG - Intronic
903320545 1:22540600-22540622 CAGTGCAAAGGCCTGGAGGCAGG + Intergenic
903328501 1:22585159-22585181 CTGTGCAAAGGCCCCGAGGCAGG + Intronic
903352587 1:22726949-22726971 CTAGGCAAAGGCCTAGAGGCTGG + Intronic
903360172 1:22772100-22772122 CTCGGCAAAGGACAGGATGATGG - Intronic
903543401 1:24109106-24109128 GTGGGCAAAGGCCCAGAGGTAGG - Intronic
903661165 1:24979731-24979753 ATGGGCAAAGGCTCAGAGGAGGG + Intergenic
903818794 1:26085041-26085063 ATGTGCAAAGGCCAGGAGGTAGG - Intergenic
903853688 1:26322950-26322972 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
904431266 1:30466090-30466112 CAGGGCAGAGGCGAGGAAGATGG - Intergenic
904460636 1:30677665-30677687 ATGTGCAAAGGCTGGGAGGAGGG + Intergenic
904701126 1:32358820-32358842 GTGGGTAAAGGCCTGGAGGCAGG - Intronic
904944686 1:34190467-34190489 ATGTGCAAAGACCATGAGGAGGG - Intronic
905328798 1:37177386-37177408 CTGAGCAAAGGCCCAGAGGGAGG + Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
905510198 1:38513313-38513335 CTGTGCAAAGGCTTGGAGGCAGG - Intergenic
905631363 1:39520812-39520834 CTGGGCACAGCCCAAGAGCAGGG - Intronic
905666393 1:39765359-39765381 CTGGGCACAGCCCAAGAGCAGGG + Intronic
906003753 1:42450121-42450143 CTAGGGATAGGCCAGTAGGAGGG - Intronic
906530789 1:46522852-46522874 CTGTGCAGAGGCCAGGAGATGGG - Intergenic
906721082 1:48005278-48005300 CTGGGAAAAGGCCCAGAGGTGGG + Intergenic
907048363 1:51313663-51313685 CTGGGCAAAGGCCTGGAGGAGGG - Intronic
907238772 1:53069285-53069307 ATGTGCAAAGGCCTGGAGGGAGG + Intronic
907337865 1:53712175-53712197 CTGTGCAAAGGCCTGGTAGAAGG - Intronic
907461222 1:54606982-54607004 CTCAGCAAGGGCCAGCAGGAAGG - Intronic
907657223 1:56356582-56356604 ATAAGCAAAGGCCCGGAGGACGG + Intergenic
907910305 1:58820055-58820077 CTGAGCAACGGCCAGGAAGGAGG - Intergenic
908155913 1:61352945-61352967 ATGAGCAAAGGCTTGGAGGAAGG + Intronic
908774412 1:67626290-67626312 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
909502083 1:76345867-76345889 CAGTGCAAAGGCCCTGAGGAAGG - Intronic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910144152 1:84058844-84058866 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
910683878 1:89896261-89896283 ATGGGAAGAGGCCAGGAGGTGGG + Intronic
911110989 1:94185111-94185133 CTGGGCAAACTGCAGGTGGAAGG + Intronic
911176471 1:94822576-94822598 CTGGACAAAGGCTTGGGGGAAGG + Intronic
912218852 1:107648987-107649009 CTAGGCAAATTCCAGGAGGAAGG + Intronic
912701503 1:111881654-111881676 CAGGGCAAAGGGCAGGGGCATGG + Intronic
912933474 1:113983601-113983623 CTGAGCACAGGCCTGGAGAATGG + Intergenic
912977774 1:114345865-114345887 CTGGGGAAAGGACAGGGAGAGGG + Intergenic
913199363 1:116483693-116483715 CTGGCAGAAGGCCAGGATGATGG + Intergenic
913597633 1:120393966-120393988 CTGGGCACAGGAAAGAAGGAGGG - Intergenic
914666335 1:149835860-149835882 GAGGGCAGAGGCAAGGAGGAGGG + Intergenic
914669432 1:149857938-149857960 GAGGGCAGAGGCAAGGAGGAGGG - Intronic
914935320 1:151974184-151974206 ATGTGCAAAGGACTGGAGGAGGG + Intergenic
915606891 1:156957870-156957892 CTGGTTAGAGGCTAGGAGGAGGG + Intronic
915631193 1:157155087-157155109 CTGGACAGAGGCCAAGAGTAAGG - Intergenic
915936329 1:160092226-160092248 AGTGGCAGAGGCCAGGAGGAAGG + Intronic
915964500 1:160294530-160294552 CTTGGCAAGGGACAGGAAGAAGG - Exonic
915973642 1:160371000-160371022 CTCGGCGAAGGCCAGGTTGAAGG - Exonic
916212223 1:162368251-162368273 CTGGGCTACAGGCAGGAGGAAGG - Exonic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
917595985 1:176529532-176529554 CTGGGGCAAGGGGAGGAGGAGGG + Intronic
917621798 1:176803671-176803693 ATGGGCACAGGTCTGGAGGAAGG - Intronic
917931331 1:179824660-179824682 CAAGGCAAAGCCCAGGAGGGCGG - Intergenic
918039968 1:180908028-180908050 CTGGGCAAAGGCAAGGAGACAGG + Intergenic
918322260 1:183375441-183375463 CTGGGCAAAGGCATAGGGGAGGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919085601 1:192917373-192917395 CTGGGCAGAGGCTTGGAGTAGGG - Intergenic
919309245 1:195886215-195886237 CTGGGCAAATGACAGGGAGAGGG + Intergenic
919782631 1:201230707-201230729 ATGAGCAAAGGCAAGGAGGTAGG + Intergenic
919972163 1:202588117-202588139 CAGGGCAAAGACAAGGAGGAAGG - Exonic
920231836 1:204475824-204475846 CTGGCCCAGAGCCAGGAGGATGG - Intronic
920365532 1:205446503-205446525 CTGGGCTCAGCCTAGGAGGAAGG - Intronic
920696525 1:208185038-208185060 ATGGGCCAATGCCAGGAGTAGGG - Intronic
920704254 1:208240283-208240305 GAGGGCTAAGCCCAGGAGGACGG + Intronic
920852238 1:209635931-209635953 CTGGACAAAGGCTCTGAGGAGGG - Intronic
920979438 1:210819405-210819427 CTGGCCAACTGTCAGGAGGAGGG + Intronic
921676578 1:217982859-217982881 CCGGGCTGAGGGCAGGAGGAAGG + Intergenic
921732529 1:218594112-218594134 TGGAGCAAAGGGCAGGAGGACGG - Intergenic
922154365 1:223029628-223029650 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
922156093 1:223040649-223040671 ATGGGCAAGGGGCAGGGGGAGGG + Intergenic
922627345 1:227062110-227062132 ATGGGCAAAGGCCAGAATAAGGG - Intronic
923120099 1:230981859-230981881 TTGTGCAAAGGCCTTGAGGAAGG - Intronic
923143323 1:231179911-231179933 CTGGGCAAAGAGTAGGAGAAGGG + Intronic
923750132 1:236739796-236739818 AGGGGCCAAGGCCATGAGGAGGG - Intronic
924511475 1:244731833-244731855 CTGGGCACAGCCCTGGAGGGAGG + Intergenic
1062950815 10:1501889-1501911 CTGGGCAGAGGACAGGATTAAGG + Intronic
1063503891 10:6579690-6579712 CTGGTCAAGGGCCTGGGGGAGGG - Intronic
1063842282 10:10085981-10086003 CGGGGAAAAGGGCAGGAGGGAGG - Intergenic
1066443867 10:35464179-35464201 CTGGGCTAAGGCACAGAGGAGGG - Intronic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067067421 10:43111862-43111884 CTGGGGTAAGTACAGGAGGAAGG - Intronic
1067179345 10:43973160-43973182 CATGGCAGAGGCCAGGTGGATGG - Intergenic
1067267483 10:44757924-44757946 CCAGGCAAAGGCCAGGACCAAGG - Intergenic
1067437280 10:46287129-46287151 CTGGTGAAAGGGCAGGAGGAGGG + Exonic
1067474351 10:46556365-46556387 CTGGGCAGGGGCCAGGATGCCGG + Intergenic
1067581877 10:47451446-47451468 CAGGGCCAGGGCCAGGAGGCGGG + Intergenic
1067684005 10:48456582-48456604 CTGGGGGAAGGGCAGGAGGCAGG + Intronic
1067837883 10:49652791-49652813 CAGGGCAAAGGTCAGGAGGCAGG - Intronic
1068214321 10:53964046-53964068 CTTGGCAAAGCCAAGGAGGCAGG - Intronic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1069597752 10:69683461-69683483 GTGAGCAAAGGCAAGGAAGAGGG + Intergenic
1069661444 10:70126212-70126234 CTCAGCACAGGCCAGGAGGAGGG - Intronic
1069718901 10:70537936-70537958 CTGGGAGAGGCCCAGGAGGAGGG - Intronic
1069893083 10:71664115-71664137 CTGGGGAGATGCCTGGAGGAGGG - Intronic
1070001158 10:72378473-72378495 CTGGTGAAAGGCGAAGAGGAAGG - Intronic
1070310941 10:75273350-75273372 TTGAGCAAAGGCCAGGAGGCTGG - Intergenic
1070489646 10:76964606-76964628 CTGGGCAAAAGAAAGAAGGAAGG - Intronic
1071255524 10:83868566-83868588 CTGCTCAAAGGCCATGAGGTGGG - Intergenic
1071427865 10:85577359-85577381 CTGGGCAGAAGACAGGTGGATGG + Intergenic
1071957898 10:90779080-90779102 CTGATGAAAGGCCAGGAGGAAGG + Intronic
1072709666 10:97707722-97707744 CTGGGAACAGGCCAAGAGGAGGG + Intergenic
1072918165 10:99553164-99553186 ATGGGCTAAGGTGAGGAGGATGG - Intergenic
1073078156 10:100837444-100837466 CTGTGCAAAGGTCAGAAGGGAGG - Intergenic
1073139432 10:101237568-101237590 CCGGGCTAAGGCCACGAGGACGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073398865 10:103240753-103240775 CGGGGCACATGGCAGGAGGAAGG + Intergenic
1074724785 10:116296810-116296832 GAAGGAAAAGGCCAGGAGGAAGG - Intergenic
1074952418 10:118351140-118351162 CTGGGAAAAGCACAGGAAGAAGG - Intergenic
1075248435 10:120845451-120845473 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1075571761 10:123551461-123551483 CCGGGCAAAGGCCATGCAGAGGG + Intergenic
1075925146 10:126245501-126245523 CTGGGCAGTGGGCAGGAGGTCGG + Intronic
1076141229 10:128079893-128079915 CTGGGCAAGACCCGGGAGGAGGG + Intronic
1076180293 10:128401827-128401849 CTGGGCATGGAGCAGGAGGAGGG + Intergenic
1076336589 10:129710542-129710564 CTGGGCAGGGGCCAGGTGTATGG + Intronic
1076488401 10:130839361-130839383 GTGTGCAAAGGCCCTGAGGAGGG - Intergenic
1076522011 10:131087160-131087182 TTGGGCACAGGCAATGAGGAGGG - Intergenic
1076802053 10:132835367-132835389 CTGGGCACAGGCCAGCAGGTGGG + Exonic
1077137025 11:1005324-1005346 CAGGGCCTAGGCCAGGGGGATGG + Intronic
1077195734 11:1279072-1279094 ATGGGGAAGGGACAGGAGGAGGG + Intronic
1077384258 11:2261588-2261610 GTAGGCAAATGCCAGGAGGAGGG + Intergenic
1077504456 11:2923672-2923694 CTTTGGAGAGGCCAGGAGGATGG + Intronic
1078059137 11:8032128-8032150 CTGGGGAAAGGCCTGGGGAAAGG + Intronic
1078564091 11:12398571-12398593 CTGGGCTAGGCACAGGAGGACGG - Intronic
1078754497 11:14196208-14196230 CAGGCCTAAGGCCAGGAGAAGGG - Intronic
1079292642 11:19202043-19202065 CTGGGGGAAGGGCAGGAGGGAGG + Intronic
1079306724 11:19329875-19329897 CTGTGCAAAGGCCTTGAGGCAGG + Intergenic
1079977511 11:27110234-27110256 CTGGGAAAAAGGTAGGAGGAGGG - Intronic
1080493813 11:32796056-32796078 CTGGGCAAACGCTTGGAGAAAGG - Intergenic
1080642912 11:34168144-34168166 CTGGGCACAGGGCATGGGGAAGG + Intronic
1081806011 11:45890929-45890951 CTGAGCAGAGGGCAGGAAGATGG + Intronic
1082955246 11:58863673-58863695 CTGGGGAATGGCCTGGAGGTTGG + Intronic
1083198690 11:61106376-61106398 CAGGGCAAAGGCAAGGGGGAAGG + Intronic
1083285610 11:61656704-61656726 ATGGGCAAAGGAGAGGAGGCTGG + Intergenic
1083300565 11:61737801-61737823 GTGGGGAGAGGCCTGGAGGAGGG - Intronic
1083419606 11:62545718-62545740 AGGGGCAAAGGGGAGGAGGAAGG - Intronic
1083425254 11:62581058-62581080 CTGGGAAAAGTCCATGAGAATGG - Intronic
1083495457 11:63048005-63048027 GTGGGCAAAGGCATGGAGGAGGG + Intergenic
1083613029 11:64013436-64013458 CAGGGCAAAGGCCCGGAGGCAGG + Intronic
1083629085 11:64086567-64086589 CTGTGCAAAGGCCCGGAGGCAGG - Intronic
1083640296 11:64141769-64141791 CTGGGCACAGGGTAGGAGGCAGG + Intronic
1083656632 11:64232890-64232912 ATGGGCAGAGGGCAGGAGGGTGG + Intronic
1083812546 11:65113615-65113637 CTGGCCTCAGGCCAGGGGGAGGG + Intronic
1083855765 11:65392320-65392342 CTGGCCTCAGGCCAGCAGGAGGG + Intronic
1083883796 11:65560913-65560935 GTGGGGAAGAGCCAGGAGGACGG + Intergenic
1084114623 11:67034817-67034839 CTGCGCAGAGGCCAGGGAGAAGG + Exonic
1084122433 11:67077508-67077530 CTGAGCGAAGGCTAGGAGGTTGG - Intergenic
1084160585 11:67347264-67347286 CTGAACAAAGGCAAGCAGGAGGG - Intronic
1084236630 11:67791926-67791948 TTGGCCAGAGGCCAAGAGGAGGG + Intergenic
1084274471 11:68044429-68044451 CTAGGCAAAGCCCAGGTGCAGGG - Intronic
1084358378 11:68653919-68653941 CTGGAAAGGGGCCAGGAGGAGGG + Intergenic
1084371529 11:68748096-68748118 CTCCCCAAAGGCCAGGAGGCAGG + Intronic
1084429423 11:69102952-69102974 CTGTGCTCTGGCCAGGAGGAAGG + Intergenic
1084430535 11:69108311-69108333 CTGGACAAAGGCCCTGAGGCTGG - Intergenic
1084463784 11:69310514-69310536 GTGGGAAAAGACTAGGAGGACGG + Intronic
1084556904 11:69880876-69880898 CTGGGCAGAGCCCAGCAGCAAGG + Intergenic
1084589782 11:70084032-70084054 GTCTGCAAAGGCAAGGAGGAGGG + Intronic
1084767889 11:71324313-71324335 CTGTGCAAAGGCCCTGAGGCTGG + Intergenic
1084942957 11:72623648-72623670 ATGGGCAAAGGCAAGGGGGAGGG - Intronic
1084962319 11:72723424-72723446 CCATGCCAAGGCCAGGAGGAGGG + Intronic
1085045248 11:73348972-73348994 AGGGACAAAGGCCAGGAGGCTGG + Intronic
1085238612 11:75033745-75033767 GTGGGAAGAGGTCAGGAGGATGG + Intergenic
1085345527 11:75765973-75765995 ATGGACAAAGGCCTGGAGGTAGG - Intronic
1085449226 11:76622054-76622076 CTGGGCAGGGGGCAGGGGGAGGG + Intergenic
1085510715 11:77086749-77086771 CTGGGCAATGGCCAGAGGGCAGG - Intronic
1085527346 11:77172106-77172128 GTGGGCAAGCGCGAGGAGGAGGG - Intronic
1086118609 11:83282631-83282653 CTAGGCAAAGGCCCTGAGAAGGG - Intronic
1086551692 11:88059828-88059850 TTGGGCCCAGGCCAGGAGGAAGG + Intergenic
1087196594 11:95309940-95309962 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1088755758 11:112883875-112883897 AGGGGCACAGGCCAGGAGGCAGG + Intergenic
1089076636 11:115743874-115743896 CCGGGCACACCCCAGGAGGAAGG + Intergenic
1089364637 11:117914027-117914049 CTGGGAAAAGTCCAGGAACATGG + Intronic
1089495007 11:118903327-118903349 CAGGCCGAAGGCCAGGAGGAGGG + Exonic
1089606804 11:119646035-119646057 CAAGGAAAAGGCCAGGAGGCAGG - Intronic
1089857552 11:121559895-121559917 AGGGGCCAAGGGCAGGAGGAGGG - Intronic
1089930610 11:122307151-122307173 CTGGACAGAGGCCACTAGGAAGG + Intergenic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090501217 11:127263241-127263263 CTGGGCAAAGGGCAGAAGGAGGG + Intergenic
1090854091 11:130597219-130597241 CTGGGCATGGGCCATGAGGACGG - Intergenic
1090966400 11:131601101-131601123 TTGGGTAAGGGCCAGGAGGCAGG + Intronic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091384015 12:80817-80839 CTGAGCAAAGTCCTGGAGGAGGG + Intronic
1091460598 12:641437-641459 GTGGGGAGAGGCCATGAGGATGG + Intronic
1091701105 12:2663571-2663593 CTCGGAGAAGGGCAGGAGGATGG + Intronic
1091730434 12:2876861-2876883 CTGGGCACAGGCGGGGAGCAAGG - Intronic
1091874608 12:3923743-3923765 TTGGACAAAGGGAAGGAGGAGGG - Intergenic
1092964831 12:13631474-13631496 CTGGACAAAGGCAAGGAAGTTGG + Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093584787 12:20822113-20822135 CGGAGCAAAGAGCAGGAGGACGG + Intronic
1094155998 12:27337494-27337516 CTGAGGAAAGGCCTGGAGGTGGG - Intronic
1095261605 12:40105338-40105360 GAGGGCACTGGCCAGGAGGATGG + Exonic
1096179104 12:49540913-49540935 CTGGGCAACGCCCAGGTGGCGGG + Exonic
1096630763 12:52925507-52925529 ATGGGGCAAGGCCAGGATGACGG - Intronic
1097185974 12:57196670-57196692 CTGAGCAACAGCCAGGAGCAGGG + Intronic
1097398248 12:59102127-59102149 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1100121621 12:91375267-91375289 CTGGGCAAAGGGAAGGCGGGTGG + Intergenic
1100381937 12:94070600-94070622 TTGAGCAAAGGCCTGGAGGAGGG + Intergenic
1100386196 12:94106301-94106323 CTGAGCAAAGTCCTGAAGGAAGG - Intergenic
1100759817 12:97794907-97794929 CTGGGCAAAAGGCAGGGAGAGGG - Intergenic
1100781902 12:98035652-98035674 CAAGGCAAAGGCCAAGGGGAAGG + Intergenic
1101253199 12:102955092-102955114 TTGGCCTCAGGCCAGGAGGAAGG - Intronic
1101696390 12:107131286-107131308 CTGGGCAGAGGCCACTGGGAAGG + Intergenic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101850415 12:108397457-108397479 CAGTGCAAAGGCCAGGAGGCAGG + Intergenic
1102028861 12:109728571-109728593 CTGAGCAAAGGCACAGAGGAAGG - Intronic
1102167835 12:110820676-110820698 CTGGGGAGAGGGGAGGAGGAGGG - Intergenic
1102199553 12:111047978-111048000 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1102207297 12:111099240-111099262 CTGGCCAAAGGCTCGGAGGTGGG + Intronic
1102224487 12:111218169-111218191 CTGGGCAAAGTCGAGGGAGAGGG - Intronic
1102259583 12:111436042-111436064 CTGGGGACAGGGCAGGTGGATGG + Intronic
1102813723 12:115845347-115845369 CTGGGAGAATGCCAGGTGGAAGG - Intergenic
1102822245 12:115917646-115917668 CTGTGCAAAGGCCTGGAGATAGG + Intergenic
1103066713 12:117904822-117904844 TTTGGCAAAGGTCAGAAGGACGG - Intronic
1103332592 12:120164520-120164542 CTGGGGGAAGGCCAAGAGCAGGG + Intronic
1103499210 12:121387964-121387986 CTGTGCAAAGGCCCAGAGGTAGG + Intronic
1103643450 12:122371675-122371697 CAGGACACAGGCGAGGAGGATGG + Intronic
1103800265 12:123533485-123533507 CGGGGGACAGGCCAGGAGGGTGG - Exonic
1103846855 12:123907915-123907937 CAGGGCAACAGCCAGGAGGGAGG - Intronic
1103903280 12:124314568-124314590 CTGGGGAGAAGCCGGGAGGATGG + Exonic
1104475333 12:129066419-129066441 ATGGGCAAAGGCCTTGAGGTGGG + Intergenic
1104831072 12:131751831-131751853 CTGAGAAAAGGCCGGGAGCAGGG - Intronic
1106898966 13:34334858-34334880 CAGGGCAAAGGCCATGTGGTAGG + Intergenic
1107976516 13:45693615-45693637 CTGGGGATAGGCCAGGGTGATGG + Intergenic
1110418828 13:75281434-75281456 CTTGGGAAAGGGTAGGAGGAGGG - Intergenic
1112312340 13:98330118-98330140 CTGTGCAAAGGCCTGGAGGTGGG + Intronic
1112489355 13:99848071-99848093 ATGGGCAAAGGACAGCAGCAGGG - Intronic
1113109065 13:106802542-106802564 CAGAGCTAAGGCCAGGAGGTAGG + Intergenic
1113313632 13:109156668-109156690 CTGGGGAAAGGCCAGGAAGCAGG - Intronic
1113721475 13:112560990-112561012 CCTGGCAAAGGCCAGGAGTCAGG + Intronic
1113723649 13:112581057-112581079 CTGGGCTGGGGCCAGGAGGTTGG - Intronic
1113767936 13:112892672-112892694 CTGGGCTCAGGGAAGGAGGAGGG - Intergenic
1113788836 13:113016693-113016715 CTGTGCAAAGGCCCCGAGGTTGG - Intronic
1114657353 14:24324077-24324099 CATGGCAAAGACAAGGAGGATGG + Exonic
1114978671 14:28134040-28134062 CTGGTCAATGGCCTGGAGGCTGG + Intergenic
1115430158 14:33308079-33308101 CAGGGCCAAGGACAGGAGAATGG + Intronic
1116179111 14:41513345-41513367 CAGGGCAAAGTCCAGTGGGAAGG - Intergenic
1116573189 14:46544519-46544541 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1117667299 14:58070017-58070039 CTGGCTGAAGGCAAGGAGGATGG + Intronic
1118438497 14:65792241-65792263 CTGGGCAAAGCCCCTGAGGTGGG + Intergenic
1118657192 14:67965344-67965366 CAGGGCAATGGCTAGGAGAATGG - Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119557790 14:75566912-75566934 CTGAGCAGAGGGAAGGAGGAAGG + Intergenic
1120000607 14:79298937-79298959 CTGGGAGAAGGCCAGGGGGCTGG + Intronic
1120642354 14:87030440-87030462 CTGGGGAAAGGACAGGTGAAAGG - Intergenic
1120907124 14:89630447-89630469 CGAGGCAAAGGCCAGAGGGATGG - Intronic
1121242574 14:92440905-92440927 CCAGGCAAAGGCAGGGAGGAGGG + Intronic
1121383972 14:93500162-93500184 CGGGGCAATGGCCACGGGGATGG - Intronic
1121390642 14:93570538-93570560 CTGGGCCATGTGCAGGAGGAAGG + Intronic
1121789043 14:96685103-96685125 CTGGGCCAAGGCCATGGGAAGGG + Intergenic
1122061443 14:99139183-99139205 CTGCCCAAAAGCCTGGAGGAGGG + Intergenic
1122234748 14:100325293-100325315 CTGGGCAAAGGCCAGGAGGAGGG - Intronic
1122400140 14:101462131-101462153 CTGGGCACAGGACAGGAGCCAGG - Intergenic
1122548748 14:102538956-102538978 CTGGGGCCAGGCCTGGAGGAGGG - Intergenic
1122599585 14:102914654-102914676 CTGGGCACAGGGCAGGAAGAGGG + Intergenic
1122774926 14:104112917-104112939 CTGGGCAAAGGCAGGGTGGCAGG - Exonic
1122781132 14:104144002-104144024 CTGGGGAAGGGCCGGGAGGGAGG + Intronic
1123450488 15:20356806-20356828 CAGGGCGAAGGCCCGGAGGAGGG - Intergenic
1124190147 15:27567647-27567669 CCGGGGAAAGGGCGGGAGGAGGG - Intergenic
1124492307 15:30165533-30165555 ATGTGCAAAGGCCCCGAGGAGGG - Intergenic
1124603266 15:31151845-31151867 CTCAGCCAAGGCCAGGAGGTGGG - Intronic
1124696555 15:31869307-31869329 CTGGGCGAAGGCGGGGAGGCAGG - Intronic
1124751228 15:32372784-32372806 ATGTGCAAAGGCCCCGAGGAGGG + Intergenic
1125045436 15:35239112-35239134 CGGAGCAAAGAGCAGGAGGACGG - Intronic
1125322998 15:38508653-38508675 CTGAGCAAAGGACAGGAGAGAGG + Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126142813 15:45451488-45451510 CTGAGCCAGGGCCAGGAGGCAGG + Intergenic
1126864560 15:52922855-52922877 CTGGGAAAAGCCCAGGAAGATGG + Intergenic
1127209879 15:56762686-56762708 CTGGGCAGAGGGCAGCAGGATGG - Intronic
1127381023 15:58430597-58430619 CTGTGCAAAGGCCCTGAGGTAGG - Intronic
1128095060 15:64947741-64947763 CTGTGCAGAGGCCTGGAGGAGGG - Intronic
1128234878 15:66060467-66060489 CTGCGCAAAGGCGTGGAGGCTGG - Intronic
1128360114 15:66956086-66956108 ATGGGCAAAGGCCCGGGGGTGGG - Intergenic
1128866827 15:71120577-71120599 CTGGCCAAGGGCCAGGAGGGTGG - Intronic
1129028477 15:72601481-72601503 TTGTGCAAAGGCCCTGAGGATGG - Exonic
1129683669 15:77672278-77672300 GTTGGGAAAGGCCAGGAGGGAGG - Intronic
1129749611 15:78052231-78052253 CTAAGCCAAGGCCTGGAGGATGG - Intronic
1129876660 15:78979786-78979808 CTGGTCCAAGGCCACGTGGACGG - Intronic
1130302173 15:82688649-82688671 CTGGGGAGAGGCCATGAGCATGG - Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1130543654 15:84839722-84839744 CTGGGCAGAGGCCTGGTAGATGG - Exonic
1130883094 15:88071850-88071872 CTGGACAGAGGCAAGGAGTATGG - Intronic
1130913193 15:88284834-88284856 CTGGACCCAGGCAAGGAGGAGGG - Intergenic
1131815528 15:96217504-96217526 CTGGAGAAAGGCCAGTGGGAAGG - Intergenic
1132175509 15:99711069-99711091 CTGGTCAGAGGGCAGAAGGATGG - Intronic
1132463156 16:65495-65517 CTGAGCAAAGGCTTGAAGGAGGG + Intronic
1132501067 16:284900-284922 CTGGGCCAAGGCCAAGAAGGTGG - Exonic
1132682057 16:1146450-1146472 CTGGGCCAAGGCCTTGAGGCCGG - Intergenic
1132770761 16:1561666-1561688 CGGGGAAAAGGCAAGGGGGAAGG + Intronic
1132841352 16:1979810-1979832 CCGGGCCAAGGCCGGGAGGGAGG - Exonic
1132873124 16:2124373-2124395 GTGGGCAGAGCCCAGGGGGAGGG - Intronic
1132959080 16:2612309-2612331 CAGGGCCAAGCCCAGGAGGCAGG + Intergenic
1132972140 16:2694284-2694306 CAGGGCCAAGCCCAGGAGGCAGG + Intronic
1133070873 16:3246137-3246159 CTGGGCTAAGCCCAGCAGGAAGG - Intronic
1133118631 16:3592721-3592743 CAGAGCTAAGGCCAGGAGGAAGG + Exonic
1133172907 16:3992772-3992794 CAGGGCACAGGCAAGGTGGATGG + Intronic
1133335437 16:5004052-5004074 GTGGGCAAAAGCCTGGAGGCTGG + Intronic
1133410933 16:5568265-5568287 TTGGGCAAAGGCAAGGAGGTGGG - Intergenic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133928961 16:10216682-10216704 ATGTGCAAAGGCCCTGAGGAGGG + Intergenic
1134084289 16:11345877-11345899 AGGGGCAGAGGCCCGGAGGAGGG - Intronic
1134286205 16:12864165-12864187 CTTGACAAAGAGCAGGAGGAGGG + Intergenic
1134304286 16:13018437-13018459 CTGGGCAAATGCTAGCAGGTGGG - Intronic
1134457645 16:14406352-14406374 ATGGGCAAAGGCCATGAAGTGGG - Intergenic
1134513513 16:14868008-14868030 ATGTGCAAAGGCCCCGAGGAGGG - Intronic
1134552213 16:15143554-15143576 GTGGGCAGAGCCCAGGGGGAGGG - Intergenic
1134701150 16:16266503-16266525 ATGTGCAAAGGCCCCGAGGAGGG - Intronic
1134829980 16:17315096-17315118 CTGGGGAAAAGGCAGAAGGAGGG + Intronic
1134970678 16:18528143-18528165 ATGTGCAAAGGCCCCGAGGAGGG + Intronic
1135196820 16:20401768-20401790 CTGAGCAAAAGCCAGGCGGGAGG + Intronic
1135567340 16:23521618-23521640 CTTGTCAAAGGCCAGGAGTTTGG - Intronic
1135657315 16:24262223-24262245 CTGGGAGAAGGTCAGGAGTAGGG - Intronic
1136110174 16:28059628-28059650 CTGAGGAGAGGCCTGGAGGAGGG - Intronic
1136454553 16:30372867-30372889 CTGAGCAAAGGCCTGGAGAGCGG - Intronic
1137031766 16:35531399-35531421 GTGGGCAGAGGGCAGGAGGGTGG - Intergenic
1137526245 16:49239009-49239031 TTGTGCAAAGGCCAGGGGGAGGG - Intergenic
1137609339 16:49808646-49808668 CTGGGCAGAGGACAGTGGGAGGG + Intronic
1137769509 16:51004705-51004727 CTGGGGACAGTCCAGGAGCAGGG - Intergenic
1138299266 16:55912630-55912652 CAGGGAAAAGACCAGGAGGAGGG + Intronic
1138445602 16:57061320-57061342 GAGGGCAAAGGCCTGGAGCAGGG - Intronic
1138653336 16:58474389-58474411 AAGCGCAAAGGCCAGGAGGCAGG - Intronic
1139108659 16:63861817-63861839 GTGGCCAAAGGAGAGGAGGAAGG + Intergenic
1139404582 16:66707863-66707885 AAGGGCAGAGGCCAGGAGGCTGG + Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140404703 16:74700921-74700943 GTGTGGAAAGGACAGGAGGAAGG - Intronic
1140456046 16:75106177-75106199 CTGTGCAGAGCCCAGGAGAATGG - Intronic
1140735693 16:77895963-77895985 CTGGGCAAAGGCCTGGAAGTTGG + Intronic
1141179589 16:81743466-81743488 GTGGTCAAAAGCCAGGAGGCTGG + Intronic
1141464418 16:84196685-84196707 CTGGTGAAAGGCCCGGAGAAAGG - Exonic
1141624418 16:85253752-85253774 GCGTGCAAAGGCCAGGAGGTGGG + Intergenic
1141624432 16:85253825-85253847 GTGTGCAAAGGCCAGGAGGTGGG + Intergenic
1141687515 16:85578745-85578767 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1141779993 16:86152957-86152979 CTGGGCAAAGACCTGAAGGATGG + Intergenic
1141815901 16:86409093-86409115 CTGGGCACAGGCCTGGAGCCTGG - Intergenic
1142854438 17:2722002-2722024 CTGGGGGGAGGCCAGGCGGACGG + Intergenic
1143014770 17:3885810-3885832 CAGGGCAAAGGCATGGAGGTGGG - Intronic
1143389647 17:6552693-6552715 TTGAACAAAGGCTAGGAGGATGG - Intronic
1143491934 17:7289895-7289917 TGGGGCAAGGGACAGGAGGATGG - Intronic
1143492052 17:7290326-7290348 CTGGGCAACGGCCCCGACGATGG - Exonic
1143777708 17:9210188-9210210 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1143807318 17:9440099-9440121 CTGGGAAAAGGGCAAAAGGAAGG + Intronic
1144707826 17:17381004-17381026 CTTGGCAAAGGCCCTGAGGAAGG - Intergenic
1144954037 17:19010254-19010276 CTGGGCATTGGCCATGGGGAGGG + Intronic
1144994818 17:19260273-19260295 ATGGGAGAGGGCCAGGAGGAAGG + Intronic
1144998685 17:19288554-19288576 CTGTGCAAAGGCCCTGAGGTGGG + Intronic
1145007383 17:19345222-19345244 GTGGGCAGAGGCCATGAGGTAGG + Intronic
1145061507 17:19737191-19737213 CGGGGCACGGGCCAGGTGGAGGG + Intergenic
1145261256 17:21356031-21356053 CTGGGCAAAAGCCTGGAGGTGGG + Intergenic
1145262012 17:21360118-21360140 ATAGGCAAAGGCCTGGAGGCAGG - Intergenic
1146173801 17:30652001-30652023 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146282728 17:31555635-31555657 CAGGGGAAAGGCAAGCAGGAAGG - Intergenic
1146347257 17:32068022-32068044 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1146442338 17:32908018-32908040 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
1146596476 17:34173404-34173426 GTGGGGAAATGCAAGGAGGAGGG + Intronic
1146659698 17:34657536-34657558 CAGGGCAAAGGGCAGAAGGGAGG - Intergenic
1146679026 17:34793685-34793707 CTGGGCAAAGGCATGGAGGATGG - Intergenic
1146935862 17:36812430-36812452 CAGTGCAAAGGCCTGGAGGAGGG - Intergenic
1146984668 17:37203834-37203856 CTGGCCAAGGGCAAGAAGGAAGG + Intronic
1147006290 17:37406760-37406782 CCGGGAAAAGGCCAAGAGGGCGG + Intronic
1147333043 17:39710060-39710082 TTGGGCAAAGGGCAGGATGAGGG - Intronic
1147336155 17:39727900-39727922 CTGGGCTGAAGGCAGGAGGAGGG - Exonic
1147667966 17:42160545-42160567 CTGGGAAAAAGGCAGGATGAGGG + Intronic
1147823459 17:43255584-43255606 CGGAGCTGAGGCCAGGAGGATGG - Intergenic
1148040748 17:44704880-44704902 GTGGGCAAAGGCCAGATGCAGGG - Intergenic
1148047566 17:44753446-44753468 CTGGGCAAGGGCCAGGGAGCCGG + Intergenic
1148074606 17:44928228-44928250 CTGGGCAAACGCGAGGGGAATGG + Exonic
1148103093 17:45104651-45104673 CTGGGCAGAGGCCAGGCTGGAGG + Intronic
1148204213 17:45769388-45769410 GTGAGCAAAGGCCGGGAGGTGGG - Intergenic
1148247127 17:46039954-46039976 CTGGGCAAATTAAAGGAGGATGG - Intronic
1148564627 17:48625703-48625725 CAGGCCGAAGGCCAGGAGGGGGG - Intronic
1148602253 17:48903262-48903284 ATGGGCAAAGGCTTGGAGGGGGG + Intergenic
1148773588 17:50080599-50080621 CTGGGGAAAGGCATGGAGGTGGG - Intronic
1148874750 17:50680331-50680353 CTGGGCAAAGGAGTGGAGGTGGG + Intronic
1148913409 17:50955320-50955342 GTCGGCATAGGCCTGGAGGAAGG - Intergenic
1148941828 17:51221071-51221093 CTGGCTCAAGGCCAGGAGTATGG + Intronic
1149422008 17:56520513-56520535 ATTGGCAGAGGCCAGAAGGATGG + Intergenic
1149548524 17:57522368-57522390 CTGGTCAAATGCAAGGAGGGAGG - Intronic
1149634489 17:58155837-58155859 CTCGGGAAAGGCAAGGAGGAAGG + Exonic
1149986749 17:61353268-61353290 TTGGGGACAGGCCAGGGGGAGGG + Intronic
1150010084 17:61495147-61495169 GTGGACCAAGGCCAGGAGGTTGG - Intergenic
1150134612 17:62689018-62689040 CTGGGACCATGCCAGGAGGAAGG + Intronic
1150272107 17:63873305-63873327 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150273461 17:63881485-63881507 CAGGCCAAAAGCCAGGAGCAGGG + Exonic
1150275655 17:63896201-63896223 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150277787 17:63910890-63910912 CAGGGCAAAAGCCAGGAGCAGGG + Exonic
1150279073 17:63918472-63918494 CAGGCCAAAAGCCAGGAGCAGGG + Exonic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151365352 17:73613224-73613246 CTGGGCAGGGGGCAGGAAGATGG + Intronic
1151475644 17:74343047-74343069 CTGGGCACAGACCAGGAGCCTGG + Exonic
1151560700 17:74868074-74868096 TTGGGCAAAGGCGAAGAGGTGGG - Intronic
1151831416 17:76554366-76554388 CTGGGCAGTGGCCAAGAGGCTGG - Intergenic
1151893145 17:76963037-76963059 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152218707 17:79049166-79049188 CTGGTCAGAGGCCTGGATGAGGG - Exonic
1152348945 17:79772501-79772523 CTGGGGACAGGGAAGGAGGAAGG + Intergenic
1152370349 17:79884072-79884094 ATGGCGAAAGGCAAGGAGGAAGG - Intergenic
1152386404 17:79977414-79977436 CTGGGAAGGGGCCAGGTGGAGGG - Intronic
1152555699 17:81052166-81052188 CAGGGCAAAGGCCCCGAGGCAGG - Intronic
1152584373 17:81182421-81182443 CTGGCCACAGGCCTGGAGGGTGG + Intergenic
1152641346 17:81450550-81450572 CTGAACACAGGTCAGGAGGAAGG - Intronic
1152686587 17:81696725-81696747 CTGGGCGTAGGGCAGGGGGAAGG - Exonic
1152743650 17:82029496-82029518 CTGGGCCAGGGACAGGAGAACGG + Intronic
1152819016 17:82426298-82426320 CTGGGCAAAGGCCCAGCTGAAGG - Intronic
1152950345 17:83226608-83226630 CTGGCCAGAGGCCAGCAGGAGGG - Intergenic
1153289393 18:3485521-3485543 CTGAGCCAAGGCCGTGAGGAAGG - Intergenic
1154051732 18:10966766-10966788 CGGGGGAAAGGGCAGGAGGTGGG - Intronic
1154105953 18:11523297-11523319 ATGGGCACAGGCCAGGAATATGG - Intergenic
1154107383 18:11534272-11534294 CTGGGCAGTGGCCAGGTGGTAGG + Intergenic
1154415528 18:14173637-14173659 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1155047119 18:22112624-22112646 ATGGGCAAGGCCCAGGAGGCAGG + Intergenic
1155324944 18:24655987-24656009 CTGGGCACTGGCAAGAAGGAAGG - Intergenic
1156472597 18:37387198-37387220 CCGGGAAAAGGCAGGGAGGAAGG - Intronic
1156486784 18:37471490-37471512 AGGGGCAAAGGCAAGGAGGAGGG - Intronic
1156550612 18:38012423-38012445 CTGAGCAAAGGCCACATGGACGG + Intergenic
1156756723 18:40536732-40536754 CTGAGCCATGGCCAGGAGGAAGG - Intergenic
1157272038 18:46283571-46283593 GTGGGCAAAGTCCTGGAGGTGGG - Intergenic
1157331309 18:46705674-46705696 CTGAACAACCGCCAGGAGGAGGG - Intronic
1157564214 18:48668749-48668771 TTGGGCGAGGGGCAGGAGGAAGG - Intronic
1158336050 18:56415935-56415957 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1158668568 18:59454782-59454804 CTTGGCCAAGGCCAGGTGGAAGG - Intronic
1159952085 18:74492033-74492055 CTGAGCAATGGCCAAGAGGATGG + Intergenic
1160036982 18:75310515-75310537 CAGGGCAGAGGCCATGAGGCTGG - Intergenic
1160703180 19:517911-517933 CTGGGTAGAGGCTGGGAGGAGGG + Intronic
1160703197 19:517960-517982 CTGGGTAGAGGCTGGGAGGAGGG + Intronic
1160718448 19:586999-587021 CTGGGAGAAGGCCTGAAGGAGGG - Intergenic
1160752040 19:738917-738939 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1160851361 19:1194514-1194536 CAGGGCAAGAGGCAGGAGGAGGG - Intronic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1160916824 19:1500741-1500763 CTGTGCAAAGGCCTTGAGGCAGG + Intergenic
1160975870 19:1792124-1792146 CTGGGCAAAGGCCTGGGGGCCGG + Exonic
1160978581 19:1806272-1806294 GGGGGCAAAGGCCCGGAGGTGGG - Intronic
1161073560 19:2274191-2274213 TTGGGCAAAGGCGTGGAGGCTGG + Intronic
1161075296 19:2282333-2282355 CTGGACAGAGACCAGGAGGTGGG + Intronic
1161250039 19:3275623-3275645 CTGGGCAAAGGCCGGGAGATGGG + Intronic
1161301150 19:3543776-3543798 CTGGCCAACGGCGAGGAGGTGGG + Intronic
1161307654 19:3576825-3576847 CCGGGCAAAAGCCCGGAGGTAGG + Intronic
1161426338 19:4205520-4205542 CTGGGCAAATGGCAGTAGGAGGG + Intronic
1161483282 19:4521485-4521507 CTCAGCAAAGGCCCGGAGGTGGG + Intergenic
1161533842 19:4806587-4806609 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161621443 19:5299347-5299369 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1161634203 19:5377106-5377128 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161637210 19:5396441-5396463 ATAAGCAAAGGCTAGGAGGAAGG + Intergenic
1161650345 19:5480482-5480504 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161658830 19:5533446-5533468 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1161664234 19:5565216-5565238 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1161727892 19:5940977-5940999 CTGAGCACAGGCCTGGAGGTCGG - Intronic
1162111857 19:8403828-8403850 CTGGCCAGAGGCGAGGAGGACGG + Exonic
1162156370 19:8680860-8680882 CTGTGCAAAGGCCCTGAGGTGGG + Intergenic
1162300711 19:9843270-9843292 CTGGCCCAAGGCCAGCAGGCTGG - Intronic
1162400657 19:10444635-10444657 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1162449807 19:10747953-10747975 CTGGGCAAAGGCCCTGGGGCAGG + Intronic
1162544666 19:11321571-11321593 CTGGGCAAAGGCCTTGGGGCAGG + Intronic
1162737522 19:12754816-12754838 CCGGGCAAGGACCAGGTGGAGGG + Intronic
1162752488 19:12837474-12837496 AAGGGCAAAGGCCTGGAGGCGGG - Intronic
1162794254 19:13078462-13078484 CTGGGCAAGGAGCAGCAGGAGGG + Intronic
1162850983 19:13430954-13430976 CTGTGCAAAGGCCCTGAGGCTGG + Intronic
1162906970 19:13829929-13829951 CTGGACAAAGGCCTAGAGGCTGG + Intronic
1162988615 19:14288039-14288061 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1162996284 19:14337807-14337829 CTGGGCCAGGGGGAGGAGGAGGG + Intergenic
1163268347 19:16234539-16234561 CTGGGCAGAGGCTGGGAGGGTGG - Exonic
1163448176 19:17359951-17359973 CAGGCCAAAGGCCTGGAGGCTGG - Intronic
1163483522 19:17572906-17572928 GTGGGCAAAGGCCGGGAGGCTGG + Intronic
1163536234 19:17878186-17878208 CTGTGCAAAGGCCAAGAAGTAGG + Intronic
1163581913 19:18144345-18144367 ATGAGCAAAGGCCAGGAGGCTGG + Intronic
1163729887 19:18942804-18942826 TTGGGCAAAGGCCTGGATGGGGG - Intergenic
1163730805 19:18948219-18948241 ATGGGCAAAGGCCCTGAGGTGGG + Intergenic
1163861519 19:19745577-19745599 TTGGGGCAAGCCCAGGAGGAGGG - Intergenic
1164155316 19:22592280-22592302 CTGGTCCATGGCCAGGAGGTTGG + Intergenic
1164493342 19:28735257-28735279 CAGGGCAAGAGCCAGCAGGAGGG + Intergenic
1164539931 19:29114680-29114702 CTGAGCAAAGGTCACGAGTAGGG + Intergenic
1164555411 19:29247243-29247265 CTCAGCAAAGGACAGGTGGAAGG - Intergenic
1164590712 19:29505331-29505353 CTGGGGGAGGGACAGGAGGAGGG + Intergenic
1165001495 19:32767056-32767078 TTGCACAAAGGCCAGGAGGGAGG - Intronic
1165323888 19:35102868-35102890 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1165343004 19:35225571-35225593 AGAGGCAAAGGCAAGGAGGATGG + Intronic
1165374488 19:35432141-35432163 CTGGGGAAAGGAGAGGAGGTGGG + Intergenic
1165497276 19:36160506-36160528 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1165510615 19:36264719-36264741 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1165722661 19:38090696-38090718 CTGGGCAAAGGCCAGGCCCAAGG - Intronic
1165784636 19:38453736-38453758 ATGTGCAAAGGCCATGAGGTGGG + Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1166314274 19:41980077-41980099 CTGTGCAAAGGCCCAGAGGCGGG - Intronic
1166672537 19:44719507-44719529 CAGTGCAAAGGCCCCGAGGAAGG - Intergenic
1166959874 19:46490943-46490965 CAGTGCAAAGGCCATGAGGCAGG + Intronic
1166980581 19:46629851-46629873 CAGGGCCAGAGCCAGGAGGACGG - Intergenic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167094850 19:47369703-47369725 CTGGGCAGAGGCCTGAAGGAGGG + Intronic
1167347470 19:48955362-48955384 ATGGAGAAAGGCCAGGAGGCTGG - Intronic
1167408106 19:49327498-49327520 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1167487891 19:49773836-49773858 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1167490666 19:49791122-49791144 CTGTGCCAAGGCCATCAGGAAGG - Intronic
1167562228 19:50232788-50232810 CTGTGCAAAGGCCCTGAGGCAGG + Intronic
1168061639 19:53896204-53896226 GTGGGCAAAGGCCTAGAGGCAGG + Intronic
1168263782 19:55209970-55209992 CTAGGCAAAGGCCAAGAGGCAGG - Intergenic
1168332024 19:55576147-55576169 AGGGGCAAAGGCTAGGAGGTAGG - Intergenic
1168405475 19:56108237-56108259 CTGGGCAGGGGCGAGGTGGAGGG - Intronic
1202715503 1_KI270714v1_random:40165-40187 CTGGGCAAAGACTTGCAGGAAGG + Intergenic
925121500 2:1421990-1422012 CTGGGGCAAGGGCAGGAGGGAGG - Intronic
925364531 2:3302904-3302926 CAGGGCCAAGGTCAGCAGGAGGG + Intronic
925899725 2:8500174-8500196 CTGAGCAAAGGACAGTAGCATGG - Intergenic
925989866 2:9246010-9246032 CTGTGAAAAGGACAGGAGGGTGG + Intronic
926222361 2:10944645-10944667 CAGGGAAGGGGCCAGGAGGAAGG - Intergenic
926301359 2:11605620-11605642 GTGGGAAAAGGACAGGAGGAAGG - Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926976210 2:18519429-18519451 CTGGGCAAGGGCCACGACGTAGG + Intergenic
927068079 2:19493795-19493817 CTGTGCAAAGGCCCAGAGGCAGG + Intergenic
927177928 2:20423238-20423260 CTGAGCTAAGGCCTGGAGCAGGG - Intergenic
927256324 2:21043768-21043790 CTGGGCCTAGGCCAGAGGGAGGG - Intronic
927285340 2:21351525-21351547 TGGGACAGAGGCCAGGAGGAGGG - Intergenic
927416338 2:22884728-22884750 CTGGGAGAAGGCCAGGAGTTTGG - Intergenic
927517723 2:23681919-23681941 CTGCGCACAGCCCAGGCGGAGGG - Intronic
927518370 2:23685178-23685200 CAGGGCAGAGGGCAGGAGGGAGG - Intronic
927689211 2:25195797-25195819 CTGTGCAAAGGCCCAGAGGCAGG - Intergenic
928116965 2:28552312-28552334 TTGGGCAAAGGCCTGGATGCAGG + Intronic
928176491 2:29037593-29037615 CTGGGCTCAGGCCAGGAAGTGGG - Intronic
928259777 2:29756134-29756156 ATGTGCAAAGGCCTGGAGGCGGG - Intronic
928285578 2:29987406-29987428 CTGGGGAGAGGAGAGGAGGAAGG - Intergenic
928455484 2:31416827-31416849 CTGGGGAATGCCTAGGAGGAAGG - Intergenic
928571422 2:32613069-32613091 ATGTGTAAAGGCCTGGAGGAGGG - Intronic
929031480 2:37653543-37653565 CAGGGCAGCAGCCAGGAGGAAGG + Intronic
929907617 2:46060320-46060342 CCGGGCAGTGCCCAGGAGGAAGG - Intronic
929952836 2:46429280-46429302 GTGAGCAAAGTCCTGGAGGAGGG + Intronic
930049738 2:47205752-47205774 CAGGGCAAAGGCGGAGAGGAGGG + Intergenic
931384590 2:61786630-61786652 CTGAGCAAAGGCATGGAGGTGGG + Intergenic
931460906 2:62449169-62449191 ATGGGCAATGGCCAGTGGGAAGG + Intergenic
932475501 2:72003377-72003399 AGGGGCAGAGGCCAGGAGGTGGG + Intergenic
932974266 2:76579180-76579202 CGGAGCAAAGAACAGGAGGACGG + Intergenic
933552653 2:83793999-83794021 CAGAGCAAAGAACAGGAGGATGG + Intergenic
933749563 2:85594436-85594458 TTGGGCAAAGGCATGGAAGAAGG + Intergenic
933996599 2:87674600-87674622 CTGGGTGAACCCCAGGAGGAGGG - Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
934736285 2:96691448-96691470 CTGGCCAAGGGCGAGGAGGAGGG + Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
934778033 2:96951242-96951264 CTGGGCTCAGGCTGGGAGGAGGG - Intronic
935868285 2:107416219-107416241 CTATCCAAAGGCCAGGAGGAAGG - Intergenic
936297253 2:111276310-111276332 CTGGGTGAACCCCAGGAGGAGGG + Intergenic
937264484 2:120607292-120607314 CAGGGCATAGAGCAGGAGGATGG + Intergenic
937394232 2:121520515-121520537 CTGGACAGAGCTCAGGAGGAGGG - Intronic
937883678 2:126886281-126886303 CTGGGCTAGGGCCAGGTGGCCGG - Intergenic
938240910 2:129741733-129741755 CTGGGGAACAGGCAGGAGGAAGG - Intergenic
938395560 2:130945185-130945207 CTGGGAGAATGCCAAGAGGAGGG - Intronic
939214421 2:139217819-139217841 CTGGCAGAAGGCCAAGAGGAAGG - Intergenic
939218184 2:139267113-139267135 ATGGGGAAACTCCAGGAGGATGG + Intergenic
941078311 2:161031466-161031488 CTGAACAATGGCCATGAGGATGG + Intergenic
941336739 2:164254975-164254997 CTGGGCAAACTCAAGGAGGTAGG + Intergenic
944371444 2:198988076-198988098 CTTGGCAGAAACCAGGAGGATGG - Intergenic
944851205 2:203721460-203721482 CTGGGCAAGGGAGATGAGGAGGG - Intronic
945143761 2:206715065-206715087 CTGGGCAAAGGCATGGAGGATGG + Intronic
945177008 2:207053123-207053145 TGGGGCAAGGCCCAGGAGGAAGG + Intergenic
945701761 2:213179256-213179278 TTGGGGAAAGGGCAAGAGGAAGG + Intergenic
946063681 2:216968021-216968043 CTGGACAGAGGCCAGCAGGGTGG + Intergenic
946141000 2:217690557-217690579 ATGTGCAAAGGCCTGGAGGTGGG - Intronic
946173967 2:217911493-217911515 CAGGGCCAGGGCCAGGATGAGGG - Intronic
946418217 2:219551151-219551173 CTGGGCAGAGGGCAGGAAGGAGG + Intronic
946528719 2:220548480-220548502 CTGAGCCAAGGCCTGGAGGCAGG + Intergenic
946537501 2:220647445-220647467 TTGGACAAGAGCCAGGAGGATGG + Intergenic
946635477 2:221720547-221720569 CTAGGCAGAGGGCAGGAGCAAGG + Intergenic
946862155 2:224010482-224010504 ATGGGAAAAGGCTAGGGGGAAGG + Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947731734 2:232435068-232435090 CAGGGCCCAGGGCAGGAGGAAGG - Intergenic
947808351 2:232983511-232983533 CTGAGCAGAGGCCTGCAGGAGGG + Intronic
947839360 2:233197877-233197899 CTGGCCCCAGGCCGGGAGGAGGG - Intronic
948084953 2:235239687-235239709 CTGGACAAAGGCTAGGATGAAGG - Intergenic
948131319 2:235602578-235602600 CTGAGCAAAGGCTTGAAGGAAGG - Intronic
948589400 2:239039520-239039542 CTGTGCAAAGGCCTGGAGGCAGG + Intergenic
948888235 2:240894395-240894417 CTGTGCAGGGGCCAGGATGATGG - Intronic
948951456 2:241254829-241254851 CTGGTTAAAGGCCAGAAGGATGG + Intronic
1168837766 20:889049-889071 ATGTGCAAAGGCCCGGAGGGAGG - Intronic
1169210612 20:3764435-3764457 CTGGGCAAAGGCAGGGCGGGGGG - Intronic
1169278909 20:4250762-4250784 CTGGGCAATGGGGAGGAGGGAGG - Intergenic
1169375235 20:5061587-5061609 CTTGGAAAAGGACAGGAGCAAGG - Intergenic
1170069146 20:12345434-12345456 CGGAGCAAAGAGCAGGAGGATGG + Intergenic
1170165583 20:13358382-13358404 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1170597647 20:17817710-17817732 TGGGGCACAGGCCAGGAGGCTGG - Intergenic
1172014119 20:31862879-31862901 CATGGCAAAGGCCTGGAGGTGGG - Intronic
1172197124 20:33099607-33099629 ATGGGCAAAGGCCAGGAGGCAGG - Intronic
1172779073 20:37425087-37425109 CTGGGTAAAGGGGAGGAGGAGGG - Intergenic
1172783763 20:37452388-37452410 TTGAGCAAAGGCCAGAAGGTGGG - Intergenic
1172847009 20:37935522-37935544 CTGTGCAAAGGCCTGGAGGTGGG - Intronic
1172873004 20:38147423-38147445 CTGTGCAAAGGCCCTGAGAAGGG - Intronic
1173843985 20:46176707-46176729 CTGGGGACAGGCCCGGAGGGAGG + Intronic
1173859046 20:46270103-46270125 CTGAGCAAAGTCTTGGAGGAAGG + Intronic
1173873933 20:46358039-46358061 TTGGGCATAGGCCGTGAGGAAGG - Intronic
1173972595 20:47164170-47164192 CCGCGCAGAGGCCACGAGGATGG - Intronic
1174089838 20:48038051-48038073 CTGGGGAAAGGTCAGGGGGCGGG + Intergenic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174200309 20:48802418-48802440 CTGTGCAAAGGCCCCGAGGCAGG - Intronic
1174670730 20:52305458-52305480 CTGTGCAAAGGCCCTGAGGCAGG - Intergenic
1175104227 20:56602985-56603007 CTGGGAAAAAGCCAGGAAGATGG + Intergenic
1175117222 20:56691063-56691085 CTGGGCAAAGGCCACGTGCTCGG + Intergenic
1175222485 20:57425434-57425456 CTGTGCAAATGCCTGGAGGTTGG + Intergenic
1175402541 20:58708720-58708742 CTGGGCAGAGGCAAGGAGGAGGG - Intronic
1175523501 20:59618148-59618170 CAGTGCAAAGGCCAGGTGGTGGG + Intronic
1175794325 20:61762064-61762086 GTGGGGATAGGCCAGGAGGCAGG + Intronic
1175872335 20:62214401-62214423 CTGGACAAAGGCCTGGAGGGGGG - Intergenic
1175911305 20:62406744-62406766 CTGGACAGAGGCCAGGACAAAGG - Intronic
1176857792 21:13985631-13985653 CTGGGTCAGGGCCAGGAGCAAGG - Intergenic
1176866798 21:14058558-14058580 CTGGGTCAGGGCCAGGAGCAAGG + Intergenic
1178473627 21:32917490-32917512 CTGCTCAGAGCCCAGGAGGAAGG + Intergenic
1178522922 21:33301560-33301582 CCAGGCAGAGGCCAAGAGGAGGG - Intergenic
1179068665 21:38051385-38051407 CTGTGCAAAAGAAAGGAGGAGGG - Intronic
1179409781 21:41153798-41153820 CTGGGCCAAGGCAGGGAGGAAGG + Intergenic
1179531343 21:42021772-42021794 GTGGGCAAAGGGCAGGAGTCAGG + Intergenic
1179643337 21:42761055-42761077 CTGGGCAAAGTCCAGAAGCCAGG - Intronic
1179826946 21:43971546-43971568 CTGGGCAGAGGCCAGGAGGGTGG + Intronic
1180233839 21:46444311-46444333 CTGGCGGAAGGCTAGGAGGAAGG + Intronic
1180244625 21:46538920-46538942 CAGGACAAAGGGCAGGAGGGTGG - Intronic
1180560608 22:16611797-16611819 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1180700740 22:17780300-17780322 CAGGGCAGAGGTCAAGAGGAGGG + Intergenic
1180847349 22:18991145-18991167 CTGGGAAAAGGCCAGGCAAAGGG - Intergenic
1181182502 22:21077969-21077991 GTGGGCCCAGGGCAGGAGGAGGG - Intergenic
1181313868 22:21959842-21959864 TAGGGCAGAGGCCAGGAGGACGG - Intronic
1181455002 22:23054153-23054175 ATAGGCAAAGGTCAGGAGGCAGG - Intergenic
1181727886 22:24824247-24824269 ATGGGCAAGGACCAGGAGGTGGG + Intronic
1181774113 22:25147518-25147540 CAGGGCAAAGGACTGGAGGTGGG - Intronic
1181801788 22:25352477-25352499 CGGAGCACAGGCCAGGAGGCTGG - Intronic
1181960086 22:26616540-26616562 ATGGTCAAAAGCCTGGAGGAAGG - Intronic
1182105513 22:27686264-27686286 ATGTGCAAAGGCCAGGAGGTGGG + Intergenic
1182113190 22:27738861-27738883 CTGGGAGAAGGGCAGGAGAATGG + Intergenic
1182137213 22:27917928-27917950 CTGAGCAAAGACCTGGAAGAAGG + Intronic
1182356985 22:29726672-29726694 TTAGGCAAAGGCCAGGTGGCTGG + Intronic
1182455251 22:30446334-30446356 CTGAGCAAAGGCAGGGAGGCAGG - Intergenic
1182459633 22:30474579-30474601 ATGGGCAAAGGCATGGAGGTGGG + Intergenic
1182547252 22:31083404-31083426 TGGGGGAAAGGTCAGGAGGAGGG + Intronic
1182776887 22:32837905-32837927 TTGGGCAGAGGCCCGGAGGCTGG - Intronic
1183086035 22:35487812-35487834 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1183090365 22:35518257-35518279 CTGAGCAAAGGCTGGGAGGTAGG + Intergenic
1183252880 22:36742851-36742873 CTGGGCAAGGGCCCTGAGGAGGG + Intergenic
1183292181 22:37009705-37009727 CCGTGCAAAGGCCCCGAGGAGGG - Intergenic
1183322420 22:37173115-37173137 ATGGGTCAAGGCCAGGAGGTAGG - Intronic
1183652998 22:39169754-39169776 CTGGAAAAAGGGGAGGAGGAGGG - Intergenic
1183721034 22:39561468-39561490 CTGGCCAGAGTCCAGGAGAAGGG - Intergenic
1183733295 22:39630072-39630094 CTGGACAAAGGCCTAGAGGCGGG - Intronic
1183913032 22:41092764-41092786 CTGGGCCCAAGCCCGGAGGAGGG - Exonic
1183998838 22:41657094-41657116 TTGGGCATAGGCCAAGAGAATGG + Intronic
1184104589 22:42360079-42360101 GTGGGCAAAGGCCCCGAGGTGGG - Intergenic
1184243321 22:43222880-43222902 CAGGGAAGTGGCCAGGAGGAAGG + Intronic
1184268815 22:43365849-43365871 GTGAACAAAGGCCAGCAGGAGGG + Intergenic
1184270387 22:43377999-43378021 CTTTTCAAGGGCCAGGAGGAAGG - Intergenic
1184371351 22:44084129-44084151 CTGGGTCAAGGCCAGTGGGAAGG + Intronic
1184419143 22:44369459-44369481 AAGGGCAAAGGCCTGGAGGCAGG - Intergenic
1185065005 22:48627784-48627806 CAGGGCCATGGCCAGGACGAGGG + Intronic
1185143584 22:49117266-49117288 CTGGGGAAAAGCCAGGGGCAGGG + Intergenic
1185208051 22:49551523-49551545 CTGGGCACTGGCAAGGAGGGAGG - Intronic
1185219898 22:49624019-49624041 CTGGGGAGAGGCCAGGAGAGTGG - Intronic
1185269638 22:49923112-49923134 CTGGGGAAGGGCAGGGAGGAGGG - Intronic
1185280254 22:49966832-49966854 CAGGGCCCTGGCCAGGAGGAGGG + Intergenic
1185330907 22:50251634-50251656 CAGGGCAAAGGCCACGAGGCGGG + Intronic
1185333092 22:50260375-50260397 CTGGGCCCAGACCAGGGGGAGGG + Intronic
1185349309 22:50326418-50326440 CTGGGCATAGGCGAGGCTGACGG - Intronic
949483740 3:4518160-4518182 CTGTGCACAGTCAAGGAGGAGGG - Intronic
949927915 3:9056833-9056855 CTGGGCCGAGGGCTGGAGGAGGG + Intronic
950112605 3:10429101-10429123 GTGGGCAAAGGCTGGGAGGTGGG - Intronic
950158338 3:10740599-10740621 CAGTGCAAAGGCCTGGAGAAGGG - Intergenic
950171231 3:10840269-10840291 AAGGGCAAAAGCCAGGAGGCTGG - Intronic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
950462819 3:13135448-13135470 CTGGGCAAAGGCCTGGGGTCAGG + Intergenic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950480049 3:13238431-13238453 CTGAGTAGAGGCCTGGAGGAAGG - Intergenic
950641807 3:14353426-14353448 CTGGGCAGGGGACTGGAGGAGGG - Intergenic
950662937 3:14477823-14477845 GTGAGCAGGGGCCAGGAGGAGGG + Intronic
950723738 3:14902389-14902411 CTGGGCAAAGACATGGAGGTTGG + Intronic
952198007 3:31096394-31096416 CTGGGAAAAGGCCATGGGTATGG - Intergenic
952257978 3:31711925-31711947 AATAGCAAAGGCCAGGAGGAAGG + Intronic
953433282 3:42857079-42857101 CTGGGCAGAAGCCAGCAGCATGG - Intronic
953469823 3:43157043-43157065 GTGGGCCTAGGGCAGGAGGAGGG + Intergenic
954425068 3:50438848-50438870 GTGGGGAAAAGCAAGGAGGAAGG + Intronic
954537510 3:51372343-51372365 CAGGGCAGAGGGCAGGGGGAGGG + Intronic
954640422 3:52094406-52094428 CTGGGCCAATGCCAAGAGAAAGG + Intronic
954652680 3:52174988-52175010 CTGTGCAAAGGCCCTGAGGAGGG - Intergenic
954687263 3:52377663-52377685 AAGGGCAAAGGCCTGGAGGTGGG - Intronic
955056600 3:55460808-55460830 TTGAGCAAAGGCCAAGAGGTGGG - Intergenic
955896440 3:63705697-63705719 GTGAGCAAAGGCAAGGAGGAAGG + Intergenic
956436283 3:69237428-69237450 TTGGCCAGAGGCCAGGAGAAAGG - Intronic
956750747 3:72342120-72342142 CTGTGCAGAGGCCTGGAGGCAGG + Intergenic
958709571 3:97700963-97700985 CAGGCCAAAGTCCAGGAGGCAGG + Intronic
959925071 3:111911661-111911683 GTGGGAAGAGGCCATGAGGACGG + Intronic
959972563 3:112422840-112422862 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
960605269 3:119498505-119498527 CGGGGCAAAGGCCAGGGGGCGGG - Intergenic
961012762 3:123447448-123447470 CAGGGCGATGGCCAGGTGGAGGG + Exonic
961083922 3:124050273-124050295 CTGGGCAAAGGCCTGGAGTCAGG - Intergenic
961302263 3:125929843-125929865 TTGGCCAGAGGCCAAGAGGAGGG - Intronic
961486225 3:127218627-127218649 TTGAGCAGAAGCCAGGAGGAAGG - Intergenic
961499355 3:127320859-127320881 CAGGGCAAAGGCCAGGACTGGGG - Intergenic
961730292 3:128960301-128960323 CGGAGCAAAGAGCAGGAGGACGG - Intronic
961788021 3:129359131-129359153 CAGGGCAAAGGCCCGGAGGCTGG + Intergenic
961818793 3:129564774-129564796 AAGGGCAGAGGCCGGGAGGAGGG - Intronic
961863658 3:129937996-129938018 TTGAGCAAAGGCCTGAAGGAGGG - Intergenic
962832772 3:139158843-139158865 TTGGGCAGAGGCAGGGAGGAGGG + Intronic
964704030 3:159599404-159599426 TTGGGGAAAGGGCAGGAGGTGGG - Intronic
964808077 3:160633380-160633402 TTGGGCAAAGGCCCAGAGGCGGG + Intergenic
967102603 3:186228665-186228687 CCGGGGAAATGCTAGGAGGAGGG - Intronic
967890022 3:194358225-194358247 CTGGGAAAAGCCCAGGATGGGGG + Exonic
967893360 3:194378897-194378919 CTGAGCAAAGGCCTGGAGGCAGG + Intergenic
967942275 3:194775449-194775471 CTGGCCAAAGGCAAAGAGCATGG - Intergenic
968235277 3:197027573-197027595 CCGGGCCCAGGCCAGGAGGTGGG - Intronic
968502137 4:955732-955754 CTGGGGACACGCCAGGAGGGTGG - Intronic
968641559 4:1717484-1717506 CTGGGCCAGGGCCGGGTGGATGG - Intronic
968759378 4:2434132-2434154 TTGGGCCAAGCCCAGGAGGCTGG + Intronic
968812449 4:2806090-2806112 TGGGCCACAGGCCAGGAGGAGGG + Intronic
968909997 4:3472818-3472840 CTGGGCAGTGGCCGGGTGGATGG + Intronic
968995387 4:3942093-3942115 TTGGCCAGAGGCCAAGAGGAGGG + Intergenic
969339630 4:6532029-6532051 CTTTGCAAAGGGCAGGAGGCTGG + Intronic
969348310 4:6582842-6582864 CAGGGCAGAGGCCAGGATGCAGG - Intronic
969413030 4:7042346-7042368 CCGGCCAAAAGCCAGGAAGAGGG - Exonic
969624544 4:8295622-8295644 CTGGGCGTTGGCCAGGAGGTGGG - Intronic
969625677 4:8304137-8304159 CTGGGCAAAGGCTCAGGGGAGGG + Intronic
969675159 4:8610425-8610447 CAGGGCAAGGGCAGGGAGGAGGG + Intronic
970037367 4:11753033-11753055 CTGGGCAGAGGCTTGGAGTAGGG + Intergenic
970050239 4:11906015-11906037 GAGTGCAAAGGCCAGGAGAATGG - Intergenic
970123582 4:12784354-12784376 CTAGCCAAAGGCCATGAGGGGGG + Intergenic
970549732 4:17167162-17167184 ATGGGCAAAGGCAAGGGGAAGGG - Intergenic
970778580 4:19707679-19707701 ATGGGCAAAGGACATGAGTAGGG + Intergenic
970959570 4:21856771-21856793 GTGGGGAAAGGCCAGGCAGAAGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971199826 4:24501477-24501499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
973798020 4:54448811-54448833 TTGGTCAATGGGCAGGAGGAGGG - Intergenic
973855399 4:55006071-55006093 CTGAGCAAAGGCCCTGAGGCAGG + Intergenic
975928783 4:79492376-79492398 CTGGGCAGAGTCCAGGGGGTTGG - Intergenic
976204204 4:82609245-82609267 CTTGGCAAAGGCAACGGGGAAGG - Intergenic
977041710 4:92026292-92026314 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
977177262 4:93832572-93832594 CTCAGAAAAGGACAGGAGGAAGG + Intergenic
980533694 4:134087797-134087819 GAGGGAAAAGGCCAGGAGGAAGG - Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
981718442 4:147775272-147775294 CTGGGGACTGGCCAGGAGGAGGG - Intronic
983360086 4:166716627-166716649 CGGAGCAAAGAACAGGAGGACGG - Intergenic
984858669 4:184217778-184217800 CAGGGCAAGGGCCAGCAGGAGGG + Exonic
984968531 4:185164972-185164994 CTGGGGAAAGGCCAGCAGGGAGG + Intronic
985382897 4:189414056-189414078 CTGTGAAAAGGACAGCAGGAGGG - Intergenic
985505902 5:280231-280253 CAGGGCAAAGGCCTGGAGTCAGG + Intronic
985699341 5:1361121-1361143 GAGGGCAGAGGGCAGGAGGAGGG + Intergenic
985742295 5:1625695-1625717 CAGGGCAAAGGCCTGGAGTCAGG - Intergenic
985825995 5:2192055-2192077 CAGGGCAGAGGCCAGGTGGAAGG - Intergenic
986142055 5:5040255-5040277 CTGGACAAAGGCCCCGAGGCTGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986311099 5:6551723-6551745 CTGGGCAAAGGCGTGGAGAAGGG - Intergenic
986919895 5:12667810-12667832 CAGAGCAAAGAACAGGAGGACGG + Intergenic
987619031 5:20315374-20315396 ATTGGCAAAGGCCTGGAGAATGG - Intronic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988435479 5:31169572-31169594 CTGTGCAAAACCCAGGAGGCAGG + Intergenic
989131715 5:38113631-38113653 GTAAGCAAAGGCCAGGAGGCAGG + Intergenic
989561683 5:42859284-42859306 TTGGGGAAAGGGCAGGAGGTGGG - Intronic
989997182 5:50849741-50849763 GGGGGCAAAGTACAGGAGGAAGG - Intergenic
990376472 5:55175897-55175919 CTGGACAAAGGCCAATAAGAAGG + Intergenic
991400254 5:66244356-66244378 CTCTGCAAAGGCCTGGAGGTGGG - Intergenic
991499929 5:67267132-67267154 ATGTGCAAAGGCCCGGATGAGGG + Intergenic
992892084 5:81213115-81213137 CAGGGAGAAGGCCAGGAGAAAGG - Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
993179033 5:84524988-84525010 TTGGGTTAAGGCCAGGAGGCAGG - Intergenic
993857719 5:93096736-93096758 TTGGGAAATGGCCAGGAGGGAGG + Intergenic
995840413 5:116438517-116438539 CTGCCCCAAGGGCAGGAGGAAGG + Intergenic
996330107 5:122319045-122319067 CTTGGCAGTCGCCAGGAGGAAGG - Intronic
996535447 5:124572448-124572470 ATGGGCAAAGCCCAAGAGAAAGG + Intergenic
997701095 5:135899941-135899963 AAGGGTAAAGGCCTGGAGGATGG - Intergenic
998139966 5:139694178-139694200 CTTGGCCAAGGCCAGGGTGAGGG + Intergenic
998150851 5:139756596-139756618 TTGGGCACAGGCGAGGAGGCAGG + Intergenic
998623763 5:143822991-143823013 ATGAGCAAAGGCCTGGAGGAGGG + Intergenic
999247721 5:150164047-150164069 CTTGGCAAGGGCCAGGAATAGGG - Intergenic
1000104319 5:158044415-158044437 TTGGGGAAAGGGCAGGAGGGGGG + Intergenic
1001288020 5:170437819-170437841 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1001315323 5:170637586-170637608 CTGAGCAAAGGCCTTGAGGCAGG - Intronic
1001442082 5:171750813-171750835 GTGAGCAAAGGCCTGGAGGCAGG - Intergenic
1001450509 5:171820894-171820916 GTGGGCCGGGGCCAGGAGGAGGG - Intergenic
1001545587 5:172568730-172568752 ATGTGCAAAGGCCCAGAGGATGG + Intergenic
1001589917 5:172858200-172858222 ATGGGCAAAGGCCCTGAGGTGGG + Intronic
1001597531 5:172907648-172907670 ATGTGCAAAGGCCTGGAGGTTGG - Intronic
1001953912 5:175834987-175835009 AGGGGCAAAGGCCAGGGGGCAGG + Intronic
1002167592 5:177358083-177358105 CCGGGCCAGGGCCACGAGGAGGG + Intronic
1002417285 5:179127170-179127192 CCGGGGAATGGCCAGGAAGATGG + Intronic
1002468094 5:179417821-179417843 CAGGGCAGAGGCCAGCAGCACGG + Intergenic
1002575774 5:180172876-180172898 ATGGGCAAAGGCATGGAGGCGGG - Intronic
1002592890 5:180303422-180303444 CAGCGCAAAGGCCCGGAGGCGGG + Intronic
1002613033 5:180433764-180433786 CTGGAGAAACGCCTGGAGGAAGG - Intergenic
1002744578 5:181460423-181460445 CTGGCCAGAGGCCAGCAGGAGGG - Intergenic
1002759714 6:192032-192054 CTGGGCAGAGGGCAGCAGGAAGG + Intergenic
1002906300 6:1452005-1452027 CTGGGCATAGGCCAGGCTAACGG - Intergenic
1003337276 6:5185904-5185926 CTGGGCCAGGGCCAGCAGAAGGG + Intronic
1003514134 6:6804310-6804332 TAGGGCAAGGGGCAGGAGGAGGG + Intergenic
1003727636 6:8783575-8783597 CTGGGTAAAGGCTGGGAGGTGGG - Intergenic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1005870906 6:29974202-29974224 CTGGGAGAAGGCCCAGAGGAGGG + Intergenic
1006179509 6:32146144-32146166 CTGGGCAAATACCTGGAGGTGGG + Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006450781 6:34104642-34104664 GTAGGCAAAGGGCAGGAGGCTGG - Intronic
1006478348 6:34272511-34272533 CAGGGCCAAGGCTAGGGGGAGGG + Intergenic
1007267647 6:40609454-40609476 GTGGGCAAAGGCATGGAGCATGG + Intergenic
1007749473 6:44063180-44063202 AGGGGCCAAGGCCAGGAGGCTGG - Intergenic
1008348019 6:50453473-50453495 CTTGGCAAAGGCCCTGAGGTAGG - Intergenic
1009915389 6:69988958-69988980 CTGTGCAAAGCCCAGAAGGATGG - Intronic
1010827206 6:80487635-80487657 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1011157489 6:84349092-84349114 GTAGGGAAAGGCCAGGAAGAAGG + Intergenic
1011986302 6:93451030-93451052 CTAGTCAAAGGGCAGGAAGAAGG + Intergenic
1012005174 6:93704924-93704946 CAGGGCAAAGGCAAGGCAGAGGG - Intergenic
1012644009 6:101657202-101657224 CTGGGCAGAGACCTGGTGGAAGG + Intronic
1012900413 6:104999045-104999067 ATGGGCAAAGGACAGGAATATGG + Intronic
1013891383 6:115032295-115032317 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1014891269 6:126849326-126849348 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1015142849 6:129955311-129955333 CTGGGCACAGGCCAACAGAAAGG - Intergenic
1015863216 6:137702048-137702070 CTGGGGAAAGTCCAGGAGTTAGG - Intergenic
1016518505 6:144923658-144923680 CGGAGCAAAGAGCAGGAGGATGG - Intergenic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1017749644 6:157479490-157479512 CAAGGCAAATGCCAGCAGGAGGG - Intronic
1018829112 6:167428978-167429000 CTGTGCAGATGCCTGGAGGATGG - Intergenic
1019063573 6:169276058-169276080 GTGGGAGAAGACCAGGAGGAGGG - Intergenic
1019249488 6:170733964-170733986 CTGGCCAGAGGCCAGCAGGAGGG - Intergenic
1019506344 7:1393376-1393398 CAGGGCCAGGGCCAGGCGGAGGG + Intergenic
1019949907 7:4362960-4362982 CTGTGCAAAGGCCCTGAGGTGGG - Intergenic
1020004047 7:4772257-4772279 CTAGCCAAGGGCCAGCAGGAAGG - Intronic
1020281712 7:6653337-6653359 CTGGGCAACGGCCTGGGGGAGGG + Exonic
1020451595 7:8325964-8325986 AAGAGCAAAGGCCATGAGGAAGG - Intergenic
1020642102 7:10768241-10768263 CTGGGATAAGACCAGGAGAATGG - Intergenic
1022193915 7:28045078-28045100 CTGGGAGGAAGCCAGGAGGAAGG + Intronic
1022470484 7:30679091-30679113 CTGAGCAAAGGCAAGGAGACAGG - Intronic
1022500500 7:30879596-30879618 GTGCACAAAGGCCAGGAGGTGGG - Intronic
1022509341 7:30925328-30925350 CTGGGCAATGGCCAGGGGCCAGG + Exonic
1022690764 7:32650531-32650553 ATGTGCAAAGGCCCTGAGGAAGG + Intergenic
1022918330 7:34984365-34984387 ATGTGCAAAGGCCCTGAGGAAGG + Intronic
1022984397 7:35636724-35636746 ATGGGGAAAGGTCTGGAGGAAGG + Intronic
1023119047 7:36890949-36890971 CAGGGCAAAGGCCCTGAGGTTGG - Intronic
1023119989 7:36899452-36899474 ATGAGCAAAGGCAAGGAGGTAGG + Intronic
1023313192 7:38908887-38908909 CTGGGCAAAGGCCACAGGGATGG + Intronic
1023880553 7:44318084-44318106 CTGGGCAAAGGGTAGGAGTCTGG - Intronic
1024218298 7:47266518-47266540 CAGGGCAAAGGGCAGAAAGAGGG + Intergenic
1025190731 7:56893642-56893664 CTGTCCCAAGGCCAGCAGGAGGG + Intergenic
1025681212 7:63683282-63683304 CTGTCCCAAGGCCAGCAGGAGGG - Intergenic
1026050243 7:66940607-66940629 GTGGCCAAAGCCCAGGAGGGAGG + Intronic
1026518311 7:71092410-71092432 GAGGGCAAAGGCTGGGAGGAGGG + Intergenic
1026879625 7:73900421-73900443 CTGGGCAGAGGCCAGGGGCGTGG - Intergenic
1027232227 7:76279523-76279545 GAGGGCCAAGGACAGGAGGAGGG + Intronic
1029572509 7:101379510-101379532 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1029612086 7:101631749-101631771 GTGGCCAAAGGCTTGGAGGAAGG - Intergenic
1030017015 7:105232993-105233015 CTAGGCAAAGGAAAGGAGGGAGG + Intronic
1030125549 7:106149605-106149627 CTCGGCACAGGCCATGATGATGG + Intergenic
1030189304 7:106794671-106794693 CTGGGAGAAGGCCAGAAGGGAGG + Intergenic
1030656505 7:112173995-112174017 GTGGGGAAAGGCAATGAGGAAGG - Intronic
1030718923 7:112846055-112846077 AAGGGCAGAGGTCAGGAGGAGGG + Intronic
1030751800 7:113238766-113238788 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1032095894 7:128938398-128938420 CTGGGCGATGGCGAGGGGGAGGG - Intronic
1032515715 7:132504641-132504663 CAGGGCAAGGCCCAGGAGGTTGG - Intronic
1032583909 7:133129173-133129195 CTGGGGAAAGGGCATGTGGATGG + Intergenic
1032653412 7:133903068-133903090 CAGGGCAAAGGCCAGGAGGCAGG + Intronic
1033157648 7:138970740-138970762 TTGGGCAAAGCCCAGGAGACAGG - Intronic
1033986074 7:147227185-147227207 AAGTGCAAAGGCCAGGAGGCAGG + Intronic
1034429372 7:151033631-151033653 GTGGGCCACGGCCCGGAGGAGGG - Exonic
1034741132 7:153474585-153474607 CTGGGCAGGGCCCAGGAGCAAGG - Intergenic
1034958686 7:155351006-155351028 ACGGGGAGAGGCCAGGAGGAGGG - Intergenic
1035242391 7:157540717-157540739 CTGGGGAAGGGCCTTGAGGATGG + Exonic
1035498608 8:73686-73708 CTGGCCAGAGGCCAGCAGGAGGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036657359 8:10685622-10685644 ATTGCCAAGGGCCAGGAGGAGGG + Intronic
1037116534 8:15236100-15236122 CTGGGCAAAGGGAAGTAGGGAGG - Intronic
1037780111 8:21862234-21862256 CTGAGCAAAGTCCAGCAGGAGGG - Intergenic
1038190476 8:25315247-25315269 CTGTGCAAAGGCCCAGAGGTAGG - Intronic
1038331547 8:26613366-26613388 CAGGGCCCAGGCCATGAGGAAGG + Intronic
1038898108 8:31810525-31810547 CTGTGCAAAGGCCCTGAGGTGGG - Intronic
1039483441 8:37892848-37892870 CTGTGCAAAGGCCCTGAGGCAGG - Intronic
1040101780 8:43512472-43512494 CTGTTCCAAAGCCAGGAGGAAGG - Intergenic
1040701321 8:50069698-50069720 CTGGGGAGAAGTCAGGAGGAAGG - Intronic
1043442621 8:80289668-80289690 CTGGGCTCAAGCGAGGAGGAGGG - Intergenic
1044127434 8:88475050-88475072 CTGGGAAAAGCCCAGGAGTTTGG + Intergenic
1044416776 8:91948477-91948499 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1045036579 8:98180881-98180903 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1045064155 8:98430738-98430760 CTGGGTAGAGGCCAGGAGAAAGG + Exonic
1045162524 8:99564487-99564509 CTGGGGTAAGGCCGGGAGGCTGG + Intronic
1045644484 8:104286391-104286413 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1046061445 8:109144670-109144692 CTGGACAAAGGGAAGGAGCAGGG - Intergenic
1046794335 8:118354412-118354434 ATGAGCAAAGGCTGGGAGGAAGG - Intronic
1047177853 8:122558328-122558350 CTGGTCCAAGGCCTGGAGGTTGG + Intergenic
1047434862 8:124827673-124827695 CTGAGCAGAGGCCAGGAGCAGGG + Intergenic
1047711902 8:127560961-127560983 CCAGGCAAAGGCTAGGAGCACGG + Intergenic
1047789002 8:128183224-128183246 CTGGTAGAAGGCCAGGAGTATGG + Intergenic
1048852770 8:138660132-138660154 TTGGCCCAAGGCCAGGAGGTAGG - Intronic
1049122858 8:140755465-140755487 CAGTGCAAAGGCCATGAGGCGGG - Intronic
1049177864 8:141205570-141205592 CTGGGGAAAGGCCAGGAAAGGGG + Intergenic
1049230398 8:141478706-141478728 CTGGCCGTATGCCAGGAGGATGG + Intergenic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049475345 8:142794606-142794628 ATGTGCAAAGGCCCGGAGGTAGG - Intergenic
1049592181 8:143467767-143467789 CTGGGCAGAGGGCGGGAGGGAGG - Intronic
1049660670 8:143818430-143818452 GGGGGCAAAGGCCTGGCGGATGG + Exonic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052847253 9:33348021-33348043 CTGGGGAAAGGACGGGAGGCGGG + Intronic
1053286330 9:36851721-36851743 ATGAGCAAAGGCAGGGAGGAGGG + Intronic
1053351318 9:37415121-37415143 GTGAGCAAAGGCCTGGAGGCTGG - Intergenic
1053456319 9:38235597-38235619 ATGGGCAGAGGCCAGGACCATGG - Intergenic
1054703219 9:68435012-68435034 TTGAGCAAAGGCCTGGAGGCAGG - Intronic
1054765174 9:69036908-69036930 CTGGGCAAAGGCCAGGAAGGCGG + Intronic
1055270050 9:74547646-74547668 CTGTGCAAAGGCCCTGAGGTAGG + Intronic
1055874379 9:80924561-80924583 CTGGGCAAAGGCCCTGAGGCAGG + Intergenic
1056437571 9:86588514-86588536 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1056786378 9:89595227-89595249 CTGGGCAAAGGAGAGGATGGGGG + Intergenic
1057833003 9:98420799-98420821 CTGTGTAAAGGCCTGGAGGTGGG + Intronic
1058754864 9:108074964-108074986 ATGGGCCCAGGCAAGGAGGAGGG + Intergenic
1059454367 9:114390232-114390254 ATGAGCAAAGGCAGGGAGGAGGG - Intronic
1059574285 9:115473684-115473706 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1059697405 9:116742448-116742470 CTTCCAAAAGGCCAGGAGGAGGG - Intronic
1060054220 9:120400002-120400024 CTTGCCAAAGGCCAGTAGGAAGG - Intronic
1060104321 9:120863971-120863993 CTGAGCAAAGGCTATGAGGTAGG + Intronic
1060410388 9:123396129-123396151 CTGAGATAAGGCCAGGAGGGAGG + Intronic
1060547083 9:124468129-124468151 CTCGGCAGAGGCCAGGGAGAAGG - Exonic
1060666543 9:125435438-125435460 TTAAGCCAAGGCCAGGAGGATGG - Intergenic
1060758557 9:126229792-126229814 CTGTGCAAAGGCCCTGAGGCAGG + Intergenic
1060765434 9:126292174-126292196 CTGTGCAAAGGCCCTGAGGCTGG - Intergenic
1060978833 9:127780832-127780854 CTGAGCGAAGGCCTGGAGGCAGG - Intergenic
1061516384 9:131092840-131092862 CTGGGCAGAGGCCAGCATGCGGG - Exonic
1061532504 9:131225895-131225917 CCGGGGAGAGGACAGGAGGAAGG + Intronic
1061570306 9:131473968-131473990 CTGGGCACAGGGCAGGCGGGTGG + Intronic
1061791338 9:133060839-133060861 CTGGGGAAAGGACTGGAGGGTGG - Intergenic
1061795016 9:133081406-133081428 CTGGGGAAAGGACTGGAGGGTGG - Intronic
1061800629 9:133111826-133111848 CTGGGAGAAGGCATGGAGGATGG + Intronic
1061819397 9:133217715-133217737 CAGGGCAGAGGCCAGCAGGCAGG - Intergenic
1061955845 9:133960927-133960949 CTTGGAGAAGCCCAGGAGGATGG + Intronic
1061993025 9:134170379-134170401 CCAGGCCAAGGCCAGCAGGACGG - Intergenic
1062241289 9:135540474-135540496 CAGGGCAGAGGCCAGCAGGCAGG + Intergenic
1062339413 9:136087379-136087401 CAGGTGACAGGCCAGGAGGAGGG - Intronic
1062344555 9:136108938-136108960 GTAGGCAAAGGCCAGGGGGCAGG - Intergenic
1062443450 9:136583698-136583720 CTGGGCAAAGGCCAGGGGGCAGG - Intergenic
1062448551 9:136606000-136606022 CTGTGCCCAGGCCGGGAGGAGGG + Intergenic
1062494620 9:136825923-136825945 CTGGGCACCGTCCACGAGGATGG - Intronic
1203610387 Un_KI270748v1:90902-90924 CTGGCCAGAGGCCAGCAGGAGGG - Intergenic
1185504415 X:620518-620540 CTGGGGCACGGGCAGGAGGAAGG + Intergenic
1185566596 X:1099690-1099712 GTGGGCAGAGGGCAGGAGGAAGG + Intergenic
1185858882 X:3559656-3559678 CGGAGCAAAGAGCAGGAGGACGG + Intergenic
1187500347 X:19833606-19833628 CTGTGGAAAGGCGAGGTGGATGG - Intronic
1188451229 X:30309458-30309480 CTGGGCAAGGGCGCGGAGGCGGG + Exonic
1189095146 X:38130548-38130570 CCTGGCAAAGGCCATGAGGTGGG - Intronic
1189498264 X:41529334-41529356 CTGTGCAAGGGCAAGGAGAAAGG + Intronic
1192221927 X:69203295-69203317 CTGGGCTCTGGCCTGGAGGAAGG + Intergenic
1192343015 X:70279808-70279830 ATGGGCAAAGGCTAGAAGGTGGG + Intronic
1192664689 X:73077609-73077631 CAGGGAAAAGGACAGGAAGAGGG + Exonic
1195402102 X:104472040-104472062 CTGGTCAAAGGCCCAGAGGTGGG + Intergenic
1195543635 X:106090153-106090175 CTGGTCAAAGATCAGGTGGATGG - Intergenic
1196196217 X:112840812-112840834 CTGGGCAAAGGATGGGAGGTAGG + Intronic
1196935370 X:120725207-120725229 CTGGTCAAAGGCCACTAGGGTGG - Intergenic
1197064614 X:122222506-122222528 CGGAGCAAAGAGCAGGAGGACGG - Intergenic
1197714426 X:129696141-129696163 CAGGACAAAGGCCAGGAGCAAGG + Intergenic
1198018807 X:132638185-132638207 CTGGGTCAAAGCAAGGAGGAAGG + Intronic
1198053145 X:132968366-132968388 CTGAGAAAAGGACAGGAAGAGGG - Intergenic
1198846488 X:140917932-140917954 GCGTGCAAAGGCCAGGAAGAGGG + Intergenic
1199991192 X:152988566-152988588 CTGGGCAAGGGGCAGCAGGTGGG - Intergenic
1200032338 X:153306840-153306862 ATGGGCAAAGGCCAGAAGGCGGG - Intergenic
1200237096 X:154472921-154472943 CTGGGCACAGGGCAGGAGGGTGG - Exonic
1200691094 Y:6306687-6306709 CTGGGAAATGCCCTGGAGGAAGG + Intergenic
1201044178 Y:9868029-9868051 CTGGGAAATGCCCTGGAGGAAGG - Intergenic
1202109623 Y:21406342-21406364 CTGGGAAAATCCCTGGAGGAAGG + Intergenic