ID: 1122235142

View in Genome Browser
Species Human (GRCh38)
Location 14:100327145-100327167
Sequence CAGGCTAGGGCCCCGCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122235142_1122235154 15 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235154 14:100327183-100327205 GCTAGGTGTGGGGCTTCTACCGG 0: 1
1: 0
2: 0
3: 11
4: 124
1122235142_1122235152 5 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235152 14:100327173-100327195 GATCCTGTCTGCTAGGTGTGGGG 0: 1
1: 0
2: 0
3: 9
4: 139
1122235142_1122235148 -2 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235148 14:100327166-100327188 TGACCTGGATCCTGTCTGCTAGG 0: 1
1: 0
2: 0
3: 23
4: 173
1122235142_1122235156 17 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235156 14:100327185-100327207 TAGGTGTGGGGCTTCTACCGGGG 0: 1
1: 0
2: 1
3: 6
4: 61
1122235142_1122235150 3 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235150 14:100327171-100327193 TGGATCCTGTCTGCTAGGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 129
1122235142_1122235155 16 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235155 14:100327184-100327206 CTAGGTGTGGGGCTTCTACCGGG 0: 1
1: 0
2: 0
3: 5
4: 99
1122235142_1122235151 4 Left 1122235142 14:100327145-100327167 CCTCCTGGCGGGGCCCTAGCCTG 0: 1
1: 0
2: 3
3: 13
4: 138
Right 1122235151 14:100327172-100327194 GGATCCTGTCTGCTAGGTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122235142 Original CRISPR CAGGCTAGGGCCCCGCCAGG AGG (reversed) Intronic
900350813 1:2233666-2233688 CAGGCAGGTGCCCAGCCAGGTGG + Intronic
900429117 1:2593631-2593653 CAGGCTGGGGCCCTGTCTGGGGG - Intronic
900429277 1:2594279-2594301 CAGGCTGGGGTGCCCCCAGGAGG + Intronic
900506664 1:3032740-3032762 CAGGCTGGGGCCCCACGAGCAGG + Intergenic
900515155 1:3078260-3078282 CATGCTAGGGGCCCACCTGGAGG + Intronic
900935098 1:5759912-5759934 CAGGGCAGGGCCCAGCCATGGGG - Intergenic
902771871 1:18649814-18649836 CAGGCTAGGGCCTCTGCATGGGG - Intronic
903261599 1:22134470-22134492 AAGGCTAGGGCACCATCAGGGGG - Intronic
903543273 1:24108549-24108571 CAGGCTGGAGCACCGGCAGGAGG - Exonic
904557227 1:31373166-31373188 CAGGCTAGGGCTCACCCAGGAGG + Intronic
905875066 1:41427202-41427224 CAGGCAGGGACCCCGACAGGAGG - Intergenic
907051087 1:51330375-51330397 CGGGCTGGGGCCCGGGCAGGTGG - Intronic
914376873 1:147079844-147079866 CAGACTAGGGCCCCGCGTGTGGG - Intergenic
915458178 1:156053965-156053987 CCGGCCAGGGTCTCGCCAGGCGG + Intergenic
915542002 1:156573287-156573309 CATGCTAGGGCCCTGGCATGGGG + Intergenic
921816438 1:219569247-219569269 CAGGCCATGGCCCCGTGAGGTGG + Intergenic
1063650337 10:7929912-7929934 CAGGCTAGGGCCAGGCGTGGTGG + Intronic
1065685512 10:28280706-28280728 CAGGCTAGGGCGCAGCCTAGAGG + Intronic
1067132074 10:43574246-43574268 CAGGCCAGAGCTCGGCCAGGAGG + Intronic
1071460130 10:85885984-85886006 CATGCTAGGGCAACCCCAGGGGG + Intronic
1073049183 10:100656677-100656699 CCGGCTAGGGCCGCGGCGGGCGG + Intergenic
1073540924 10:104315712-104315734 CAGGTGAGGGCCCCTCCTGGTGG + Exonic
1075675509 10:124293190-124293212 CAGGCCAGGGCCCAGCCAGGAGG + Intergenic
1077153616 11:1082036-1082058 CAGGCCAGGGGCCGGGCAGGAGG - Intergenic
1077223567 11:1427824-1427846 CAGGCTACGGCCCAGTCAGGAGG + Intronic
1077249397 11:1554349-1554371 CGGGCCAGGGCCCCACCTGGTGG - Exonic
1077351019 11:2093216-2093238 CAGCTTGGGGCCTCGCCAGGTGG + Intergenic
1077375732 11:2204391-2204413 CAGGCTAGGGACGCACGAGGGGG - Intergenic
1079009130 11:16814015-16814037 CAAGCTAGGGCCGAGGCAGGTGG + Intronic
1084212173 11:67629373-67629395 GAGGTTCGGGCCCCGCCCGGCGG - Intronic
1089768244 11:120784193-120784215 CAAGCTAGGGCCCCACAATGGGG - Intronic
1091460613 12:641551-641573 CAGGCTAGGGCCGGGCGCGGTGG + Intronic
1095476280 12:42589911-42589933 CCGGCTCGGGCCGCGCCCGGGGG + Intronic
1102968738 12:117149138-117149160 AAGGCCAGGGCCCTGGCAGGTGG - Intronic
1103085744 12:118060987-118061009 CGGGCCAGGGCCCCGCCGGGCGG + Intronic
1103441048 12:120963438-120963460 CAGGTGAGGGCCCCGCAAGAAGG - Intergenic
1107560794 13:41555133-41555155 CAGGCTGGGGCCCAGCCAGGAGG + Intergenic
1113378287 13:109783503-109783525 CACGCCAGGGCCCAGCCAGGCGG - Exonic
1119663218 14:76465962-76465984 CAGCCTGGGCCCCTGCCAGGTGG + Intronic
1121441856 14:93954518-93954540 CAGGCCAAGGCCAGGCCAGGGGG + Intronic
1121584564 14:95054489-95054511 CAGGCCAGGGCCTGGACAGGCGG + Intergenic
1122235142 14:100327145-100327167 CAGGCTAGGGCCCCGCCAGGAGG - Intronic
1122411491 14:101528270-101528292 CAGGGTGGGGTCCTGCCAGGTGG + Intergenic
1123000805 14:105293127-105293149 AGGACTAGAGCCCCGCCAGGAGG + Intronic
1123932123 15:25177011-25177033 CAGGATTGGGCCCCTCCATGAGG - Intergenic
1128700066 15:69797474-69797496 CAGTCTAGGGCTCCCCGAGGTGG + Intergenic
1130276119 15:82477176-82477198 GAGGCTAGGGCACCGCTGGGGGG - Intergenic
1130468482 15:84204569-84204591 GAGGCTAGGGCACCGCTGGGGGG - Intergenic
1130485266 15:84395187-84395209 GAGGCTAGGGCACCGCTGGGGGG + Intergenic
1130495784 15:84468973-84468995 GAGGCTAGGGCACCGCTGGGGGG + Intergenic
1130539359 15:84811145-84811167 CAGGCTAGGGCCCCTCCACCAGG + Intergenic
1130590775 15:85209168-85209190 GAGGCTAGGGCACCGCTGGGGGG - Intergenic
1130952482 15:88604098-88604120 CAGGCGAGGACCCGGGCAGGTGG + Intergenic
1132546191 16:534467-534489 AAGGCCAGGGCCCCGCCCTGGGG - Intronic
1133225238 16:4337692-4337714 CAGGCCAGGTCCCCACCCGGGGG - Exonic
1136236134 16:28914652-28914674 CAGGTGAGGGCACGGCCAGGGGG - Exonic
1137988554 16:53130731-53130753 CTGGGTCGGGCCGCGCCAGGAGG + Intronic
1138185138 16:54971079-54971101 CAGGCTTGGGCCCAACCAGGGGG - Intergenic
1139596087 16:67959181-67959203 CAGAGTAGGGGCCAGCCAGGAGG + Intronic
1141606004 16:85153809-85153831 CAGCCTGGGGCCCCAGCAGGGGG + Intergenic
1144768461 17:17745883-17745905 CAGGCTTGGGCCCTGCGAGGTGG + Intronic
1144808488 17:17983491-17983513 CAGGCCAGGGACTCTCCAGGAGG - Intronic
1146062261 17:29613585-29613607 CTGGCGAGGGTCCCGGCAGGGGG - Exonic
1147193127 17:38748538-38748560 CTGGCTAGGGACCCGGCAGCCGG - Intronic
1149516941 17:57287938-57287960 CAGGCCAGGGCGGCACCAGGAGG + Intronic
1152844842 17:82593438-82593460 CAGGGCTGGGCTCCGCCAGGGGG - Intronic
1155972255 18:32092963-32092985 CGGGCTCGGTTCCCGCCAGGCGG - Intronic
1157446876 18:47752932-47752954 CAGGCTTTGGCACAGCCAGGTGG + Intergenic
1160556824 18:79730942-79730964 CAGGCCAGGGCCAGGCCACGAGG - Intronic
1163015327 19:14451045-14451067 CGGGAAAGGGCCCGGCCAGGCGG - Exonic
1163703454 19:18798791-18798813 CAGGCCAGGGCCGGGCCAGTAGG + Intergenic
1164879577 19:31720799-31720821 CAGGGTGGGTCCCAGCCAGGCGG - Intergenic
1165803076 19:38564916-38564938 CAGGATAGGGCGCCGTCAGCGGG - Intronic
1165890706 19:39110507-39110529 CTGGCAAGGGCATCGCCAGGTGG + Exonic
1166408670 19:42541813-42541835 CAGCCTAGGGCCTTTCCAGGGGG - Intronic
1166849711 19:45753666-45753688 CAGCCTGGGGCCCAGCCAGGCGG + Exonic
1167551408 19:50163244-50163266 CAGGCGAGGGCGCGGTCAGGAGG + Intergenic
1168078168 19:53991755-53991777 CAGGCCAGGGCCCCCCCTCGGGG - Intergenic
925407107 2:3613034-3613056 CAGACTAGGAGCCCGCCAAGAGG + Intronic
926320232 2:11744298-11744320 CAGCCAAGGGCCCTCCCAGGGGG + Intronic
927513700 2:23659902-23659924 CAGGGGAGGGCCTGGCCAGGTGG - Intronic
932886916 2:75556905-75556927 CAGGCCAGGGACCAGCCAAGGGG + Intronic
937313086 2:120914278-120914300 CAGGCCAGGGCTAGGCCAGGTGG - Intronic
941925022 2:170885784-170885806 CAGGCTTGGGCCCTGCTAGCTGG - Intergenic
947498665 2:230657007-230657029 CAGGTGAGGGCCCCAGCAGGAGG + Intergenic
948778372 2:240301764-240301786 GGGGCTAGGGCCAGGCCAGGGGG + Intergenic
1170819042 20:19740229-19740251 CAGGCTGGGGCCCAGCGATGTGG - Intergenic
1173166462 20:40689848-40689870 CAAGCGAGGGCCCCTCCTGGCGG + Intergenic
1175971181 20:62687532-62687554 CCGGCAAGGGCCACGCCAGGAGG + Intergenic
1176035728 20:63035571-63035593 CAGGCCTGGGTGCCGCCAGGAGG + Intergenic
1179888526 21:44324734-44324756 CAGGGCAGGGCCCGGGCAGGTGG + Intronic
1180801637 22:18634650-18634672 CCGCCTGGGGCCCCGCAAGGTGG + Intergenic
1180852881 22:19030189-19030211 CCGCCTGGGGCCCCGCAAGGTGG + Intergenic
1181220086 22:21360611-21360633 CCGCCTGGGGCCCCGCAAGGTGG - Intergenic
1181694698 22:24587263-24587285 CAGGCTGGGGGCCGGCCATGAGG + Intronic
1181694890 22:24588094-24588116 CAGGTGAGGGCCTCACCAGGTGG + Intronic
1182487287 22:30647052-30647074 CAGGCCAGGGCCATCCCAGGTGG - Exonic
1183672918 22:39283540-39283562 CAGGCCAGGGGCTGGCCAGGAGG - Intergenic
1184362102 22:44024709-44024731 CAGGCGCGGGCCCCGCACGGTGG - Intronic
1185185683 22:49398276-49398298 AAGCCCAGGGCCCCGTCAGGAGG - Intergenic
1185281588 22:49972151-49972173 CAGGCCAGGGCTCCTCCACGCGG - Intergenic
950197807 3:11021666-11021688 CAGGCAATGGCACCACCAGGCGG + Intronic
950519040 3:13485376-13485398 CAGCCTAGGGCTGGGCCAGGAGG + Intronic
951981762 3:28575107-28575129 CAGGGCAGGGCTCCACCAGGAGG - Intergenic
952819237 3:37471614-37471636 CAGGCTGGGGCCAGGCCACGTGG + Intronic
953886587 3:46717669-46717691 AAGGCGAGGGCCGCGTCAGGCGG + Intronic
954626662 3:52025582-52025604 CAGGCTAGAGCCTCCCCAGCTGG + Intergenic
955539027 3:59954571-59954593 GAGGCTAAGGGCCCTCCAGGTGG + Intronic
960747664 3:120908135-120908157 CAAGCTAGGGGCCGGCCCGGGGG + Exonic
961328342 3:126124688-126124710 CCGGCTGGAGCCCTGCCAGGAGG - Intronic
961357940 3:126350803-126350825 CAGGCCTGGGCCTCGCCAGCAGG - Intronic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
963752889 3:149201406-149201428 CAGGCTAGGGCCAGGCGTGGTGG - Intronic
968574106 4:1357046-1357068 CAGGCCTGGGCCCCTCCAGCTGG + Intronic
968574127 4:1357128-1357150 CAGGCCTGGGCCCCTCCAGCTGG + Intronic
968574148 4:1357210-1357232 CAGGCCTGGGCCCCTCCAGCTGG + Intronic
968574171 4:1357292-1357314 CAGGCCTGGGCCCCTCCAGCTGG + Intronic
968578286 4:1378001-1378023 CTGGCTAGGGGCCAGCCAGGAGG - Intronic
969392792 4:6902193-6902215 CAGCCCAGGGCCCCCACAGGAGG - Intergenic
969655496 4:8495369-8495391 CAGGGAAGAGCCCTGCCAGGAGG - Intergenic
977666880 4:99653163-99653185 CAGGCAAGGGCTCAGTCAGGGGG + Exonic
986813667 5:11385187-11385209 CGGGCTCGGGCCCCGCCAGGTGG + Exonic
994184432 5:96802783-96802805 CAGATTAGGGCCCAGCCTGGTGG - Intronic
997363768 5:133312290-133312312 CAGGCTAGGGCCTGGCCATGTGG - Intronic
997512293 5:134462042-134462064 CAGGCAAGGGTGCTGCCAGGGGG - Intergenic
998040327 5:138947329-138947351 CATGCTCGGGCAGCGCCAGGAGG + Exonic
1001310507 5:170606903-170606925 CAGCCTAGGGCGCTGCCTGGTGG - Intronic
1001436747 5:171705166-171705188 CAGTCTTGGGTCCCGCCAAGTGG - Intergenic
1002526645 5:179819148-179819170 GAGGAGAGGGCCCTGCCAGGGGG + Intronic
1003424588 6:5989587-5989609 CAGGCTGGAGGCCAGCCAGGAGG + Intergenic
1003676572 6:8210197-8210219 CAGGCTAGGCCAAAGCCAGGAGG + Intergenic
1011945512 6:92896819-92896841 AAGGCTAGGGCATCGCTAGGTGG - Intergenic
1017823414 6:158064747-158064769 CAAGGTAGGGCCCCGCCGAGGGG + Exonic
1018709351 6:166486625-166486647 CAGCATGGGGCCCTGCCAGGTGG + Intronic
1019051889 6:169189958-169189980 CAGGCTAAGGCCCTGCCTGGTGG - Intergenic
1019419855 7:945890-945912 CAGGCTGGGGCACGGGCAGGGGG + Intronic
1019471952 7:1225661-1225683 CAGGCTGGATCCCCACCAGGCGG + Intergenic
1021351199 7:19595955-19595977 CAGGCTAGGGCCCCAGGAGTGGG + Intergenic
1026295365 7:69047494-69047516 CAGGCTAAGGCCTCCCTAGGGGG + Intergenic
1033202363 7:139384037-139384059 CAGGCCAGGGCCAGGCAAGGTGG - Intronic
1035404547 7:158588658-158588680 CAGGACAGGGACCCGGCAGGGGG - Intergenic
1035568633 8:658367-658389 CAGGCCAGAGCCCCGGAAGGGGG + Intronic
1036628886 8:10496554-10496576 TAGGCTAGGGCCCCCCCATTTGG + Intergenic
1036754595 8:11463950-11463972 CATGCCAGGGCCCTGCCACGTGG - Intronic
1037457693 8:19080608-19080630 CAGGCAAGGAGCCAGCCAGGGGG - Intronic
1038147704 8:24913691-24913713 CGGGCCAGGGCCCCGCCCCGTGG - Exonic
1049311199 8:141934818-141934840 CAGACTAGGGCAGCCCCAGGGGG - Intergenic
1061816391 9:133199853-133199875 CAGGCCAGGGGCCGGCCAGCGGG - Intergenic
1061882900 9:133576928-133576950 CAGGCCAGGGCTCTGCCCGGCGG - Intergenic
1061994984 9:134178660-134178682 CAGCCGAGGGCCCTGCCAGGTGG + Intergenic
1062476225 9:136728694-136728716 CGGGCGAGGGTCCCGGCAGGCGG + Intergenic
1062562609 9:137148401-137148423 CAGGCTAGGGTCACGGCGGGTGG - Intronic
1198517861 X:137427212-137427234 CAGCCTCGGGCCCCGGCAGTCGG + Intergenic
1199512297 X:148635784-148635806 CAGGGTAGGGCCACTCCAGAGGG + Intronic
1200153243 X:153961779-153961801 CAGGAGAGGGCCACGTCAGGAGG - Intronic