ID: 1122238575

View in Genome Browser
Species Human (GRCh38)
Location 14:100346722-100346744
Sequence TAAGAGGCCCACTGCTGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122238575_1122238578 22 Left 1122238575 14:100346722-100346744 CCACAGCAGCAGTGGGCCTCTTA 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1122238578 14:100346767-100346789 AGCCGAAAATGCCTTTCACTTGG 0: 1
1: 0
2: 0
3: 12
4: 178
1122238575_1122238580 29 Left 1122238575 14:100346722-100346744 CCACAGCAGCAGTGGGCCTCTTA 0: 1
1: 0
2: 1
3: 16
4: 194
Right 1122238580 14:100346774-100346796 AATGCCTTTCACTTGGTTGAAGG 0: 1
1: 0
2: 1
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122238575 Original CRISPR TAAGAGGCCCACTGCTGCTG TGG (reversed) Intronic
900612172 1:3548840-3548862 AAAGGAGCCCACTGCAGCTGGGG + Intronic
900790410 1:4676136-4676158 CATGATGCCCACTGCTGCAGAGG + Intronic
902321323 1:15669176-15669198 TGAGAGGCCCACTTCTTCTGGGG - Intergenic
902368055 1:15990182-15990204 TGAGATGCCCTCTGCTGATGGGG - Intergenic
904707441 1:32402045-32402067 AGAGAGGCCCTCAGCTGCTGGGG - Intergenic
904855586 1:33495848-33495870 TAGGAGAACCACTGCTGATGGGG - Exonic
905061010 1:35139069-35139091 TAACAGGGTCACTGCTGCTAGGG + Intergenic
906532366 1:46531101-46531123 TTAGATGCCACCTGCTGCTGTGG - Intergenic
906643067 1:47453027-47453049 GAAGAGGCCCACTGTGGGTGTGG + Intergenic
906772550 1:48498265-48498287 TCAGACGCCCCCTGCTGGTGAGG + Intergenic
910935065 1:92480732-92480754 TGAGAGGCCCACGGCAGCGGCGG - Exonic
913510647 1:119558691-119558713 AGAGAGGCCCTCAGCTGCTGGGG - Intergenic
913514862 1:119596104-119596126 AGAGAGGCCCTCAGCTGCTGGGG - Intergenic
915596806 1:156900893-156900915 CAATGGGCCCATTGCTGCTGTGG + Intronic
918043376 1:180926701-180926723 CCAGAGGCCCACGGCTGCAGGGG + Intronic
919049042 1:192489864-192489886 GATGAGGCACACTGATGCTGGGG - Intergenic
919849993 1:201666153-201666175 TCGGAGGCCCAGTGTTGCTGGGG - Intronic
920444527 1:206005862-206005884 TGTGGGGCCCACTGCTGCCGAGG + Intergenic
921476089 1:215612106-215612128 TAAGAGTTTCACTGATGCTGTGG + Intronic
923566220 1:235077808-235077830 TAAGCGGCCCTCTGGAGCTGCGG + Intergenic
924302093 1:242650256-242650278 TAGGGGTCACACTGCTGCTGTGG - Intergenic
924707988 1:246513559-246513581 TGAGATGCCCTCTGCTGATGGGG + Intergenic
1068338306 10:55667277-55667299 AAAGAGGCCCTCAGCTGCTGGGG - Intergenic
1068434583 10:56973869-56973891 TAAAAGGGCCACTGCTTCAGAGG - Intergenic
1069758784 10:70793153-70793175 TAAGAGGGCCACTGTTGCTAAGG + Intergenic
1069882924 10:71604767-71604789 AAAGGGGCCCAGTCCTGCTGAGG - Intronic
1071517544 10:86308727-86308749 TGAGGGGCCCACATCTGCTGAGG + Intronic
1071554621 10:86592721-86592743 TAGTGGGCCCACTGCTGCTCTGG + Intergenic
1074910448 10:117903715-117903737 TGAGAGGTCCACAGCTGATGTGG - Intergenic
1078598996 11:12714327-12714349 TAAATGGCCCAGAGCTGCTGGGG - Intronic
1080034828 11:27700277-27700299 TGAGACACCCACCGCTGCTGTGG - Intronic
1085055438 11:73400605-73400627 TAAGGGTCTCACAGCTGCTGGGG - Intronic
1086073476 11:82824651-82824673 TATGAGGGCCACTGATGGTGTGG + Exonic
1086970429 11:93075173-93075195 CAAAAGGACCACTACTGCTGAGG + Intergenic
1088080268 11:105903408-105903430 TAAGAGGCCCAGCCCTCCTGGGG + Intronic
1088396933 11:109379302-109379324 TAAGAGGGCCTCTGAAGCTGAGG + Intergenic
1089279505 11:117363434-117363456 TAAGAGGCTCACTTGAGCTGTGG - Exonic
1092538607 12:9406477-9406499 TAGGAGCCCCATTGCTGGTGAGG + Intergenic
1097039184 12:56144293-56144315 TAAGAGGCTCACAGCTGGAGAGG - Intronic
1097912871 12:64989501-64989523 TAGGATGCCAACTGCTCCTGGGG - Intergenic
1099307076 12:80970830-80970852 TGGGAGCCACACTGCTGCTGAGG + Intronic
1102262963 12:111456192-111456214 TAAATGGCTGACTGCTGCTGTGG + Exonic
1114186554 14:20406758-20406780 TAAGCAGCCCAAGGCTGCTGGGG - Intronic
1114658232 14:24328955-24328977 TAAGTGGCTCACTGGTGGTGGGG + Intronic
1114746777 14:25156758-25156780 TAAGAGGTCCAATCCTGATGAGG + Intergenic
1116598784 14:46890570-46890592 TGAGAGACCCACTGATGCTGTGG - Intronic
1120014633 14:79456968-79456990 TAAGAGACACACAGCTGCCGTGG - Intronic
1122238575 14:100346722-100346744 TAAGAGGCCCACTGCTGCTGTGG - Intronic
1122577805 14:102752762-102752784 CAAGAGTCCCTCTGGTGCTGAGG - Intergenic
1122660068 14:103289219-103289241 TAAGAGGCTCACTGCTGGCCAGG + Intergenic
1124851406 15:33342134-33342156 TAATACGCCCACTACAGCTGTGG - Intronic
1125424466 15:39535231-39535253 TCAGAGGGCCACTGATGCTGAGG - Intergenic
1126175681 15:45733248-45733270 TAAAAGGACCACTGGTGCTCAGG - Intergenic
1126783188 15:52155790-52155812 CATGAGTCCCACTGCTGGTGGGG + Intronic
1128888955 15:71313738-71313760 TAGGAGGTCCGCTGCTTCTGGGG - Intronic
1132208566 15:100003333-100003355 TACGAGGCTCACTGCTGCAGAGG + Intronic
1132791295 16:1690166-1690188 TGAGGGCCCCACTGCTGCGGCGG - Intronic
1132931044 16:2459440-2459462 TCACAGGCCAAGTGCTGCTGAGG - Intergenic
1133852165 16:9515695-9515717 TGAGAGGCCCACATCTGCTGAGG + Intergenic
1135238048 16:20776889-20776911 TAAGAGGCACTCAGCTGATGTGG + Intronic
1135253367 16:20920306-20920328 TGAGAAGCCCAGAGCTGCTGTGG + Intronic
1137610486 16:49814180-49814202 CTGGAGTCCCACTGCTGCTGAGG - Intronic
1137612324 16:49826956-49826978 GAAGAGGACCACTGTTGCAGCGG - Exonic
1142348741 16:89570354-89570376 TAATGGTGCCACTGCTGCTGGGG - Intergenic
1142506098 17:364243-364265 TAAGATGCACACTGAGGCTGAGG + Intronic
1143205160 17:5136121-5136143 TGAGATGCCCTCTGCTGATGGGG - Intronic
1143625547 17:8108649-8108671 ACCGAGGCCCACTGCTGCTCAGG + Intronic
1144213683 17:13036081-13036103 TTAGTGCCCCATTGCTGCTGGGG + Intergenic
1144876211 17:18398813-18398835 TGAGATGCCCTCTGCTGATGGGG - Intergenic
1145023913 17:19453396-19453418 CACGAGGCCCACAGCAGCTGGGG - Intergenic
1145156017 17:20545607-20545629 TGAGATGCCCTCTGCTGATGGGG + Intergenic
1146843482 17:36169675-36169697 TGAGATGCCCTCTGCTGATGGGG + Intronic
1146855790 17:36257613-36257635 TGAGATGCCCTCTGCTGATGGGG + Intronic
1146864830 17:36330762-36330784 TGAGATGCCCTCTGCTGATGGGG - Intronic
1146871697 17:36381524-36381546 TGAGATGCCCTCTGCTGATGGGG + Intronic
1146879056 17:36432606-36432628 TGAGATGCCCTCTGCTGATGGGG + Intronic
1146882996 17:36453752-36453774 TGAGATGCCCTCTGCTGATGGGG + Intergenic
1147067689 17:37931356-37931378 TGAGATGCCCTCTGCTGATGGGG - Intronic
1147074583 17:37982148-37982170 TGAGATGCCCTCTGCTGATGGGG + Intronic
1147079220 17:38010911-38010933 TGAGATGCCCTCTGCTGATGGGG - Intronic
1147086106 17:38061687-38061709 TGAGATGCCCTCTGCTGATGGGG + Intronic
1147095159 17:38134853-38134875 TGAGATGCCCTCTGCTGATGGGG - Intergenic
1147102051 17:38185652-38185674 TGAGATGCCCTCTGCTGATGGGG + Intergenic
1147700049 17:42388204-42388226 CCAGAGGCCCCCTGCCGCTGCGG + Intronic
1149846643 17:60012163-60012185 TGAGATGCCCTCTGCTGATGGGG + Intergenic
1150084989 17:62268737-62268759 TGAGATGCCCTCTGCTGATGGGG + Intergenic
1151757695 17:76083949-76083971 GAAGAGGCCCACTGGGGCTGTGG + Intronic
1155434311 18:25795421-25795443 TAGGAGGCAGCCTGCTGCTGCGG - Intergenic
1155933264 18:31728328-31728350 TAGGAACCTCACTGCTGCTGTGG + Intergenic
1158292164 18:55954599-55954621 TAACAGGGCCATTGCTGCTAGGG - Intergenic
1159026312 18:63184937-63184959 CAAGATGCCCACTGCTTCTGGGG - Intronic
1160399695 18:78601225-78601247 TAAAGCGCCCACTGATGCTGTGG - Intergenic
1161796415 19:6389328-6389350 TCAGATTCCCACTGCTGCAGTGG - Intronic
1162420735 19:10565003-10565025 TAAAAGTCCCGCTCCTGCTGGGG + Exonic
1164566852 19:29331965-29331987 TAAGAGCCCCACTGCAGTGGTGG - Intergenic
1164865236 19:31599202-31599224 TACTAGGCCCAGGGCTGCTGGGG + Intergenic
1166157854 19:40928206-40928228 TAAGATGCCAACTGCTTCTTGGG + Intergenic
1166166718 19:40995228-40995250 TAAGATGCCAACTGCTTCTGGGG + Intronic
1166399364 19:42466756-42466778 GAAGAGGCCCACTGTGGGTGTGG + Intergenic
929781903 2:44962488-44962510 GAAGAGCCCCACTGCGGCCGGGG - Intergenic
932511172 2:72293187-72293209 TAATAAGCCAACTGCTGGTGAGG - Intronic
932750811 2:74370597-74370619 TAAGGGGCCCACAGCTGCTGGGG - Intronic
933769606 2:85734682-85734704 TAGGAGGTCCAGGGCTGCTGCGG + Intergenic
935175998 2:100649123-100649145 TCAGAGGGCTCCTGCTGCTGAGG + Intergenic
935204666 2:100887419-100887441 CAAGAGGCTCACTGGAGCTGAGG - Intronic
935367381 2:102308680-102308702 TAAGCTGCCCACGGCTGCTCAGG + Intergenic
937090265 2:119201515-119201537 TAAGAGGGGCACAGGTGCTGGGG + Intergenic
942181541 2:173385321-173385343 TAGCAAGCACACTGCTGCTGTGG + Intergenic
943557356 2:189421795-189421817 TGTGAAGCCCACAGCTGCTGAGG - Intergenic
946476116 2:220008081-220008103 GAAGAGGCCCACTGCCTCTCAGG + Intergenic
1168793433 20:595690-595712 CAGGAGGCGCACTGCAGCTGCGG + Intergenic
1170311402 20:14996642-14996664 CAAGCAGCCCACTGCTGCTGGGG - Intronic
1171171212 20:23017118-23017140 TGAGAGGACCACAGCTGCTAGGG - Intergenic
1175984524 20:62757937-62757959 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984531 20:62757975-62757997 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984537 20:62758013-62758035 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984546 20:62758070-62758092 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984552 20:62758108-62758130 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984558 20:62758146-62758168 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984564 20:62758184-62758206 TCAGAGACCCACTGCACCTGAGG - Intronic
1175984571 20:62758222-62758244 TCAGAGACCCACTGCACCTGAGG - Intronic
1177088832 21:16740719-16740741 TAAGAATCTCAGTGCTGCTGAGG - Intergenic
1178096749 21:29223310-29223332 AGAGAGGCCCTCAGCTGCTGGGG + Intronic
1179725930 21:43341225-43341247 TGGCCGGCCCACTGCTGCTGGGG + Intergenic
1179727467 21:43348423-43348445 CAAGAGGCCCCCTACTGATGTGG - Intergenic
1179924642 21:44527768-44527790 TAAAAGGCTCACTGCTTCTACGG + Intronic
1181005864 22:20013225-20013247 GAACACGCCCACTTCTGCTGTGG + Intronic
1181596226 22:23916692-23916714 TGAGAGGCCCACTGGTGAAGAGG + Intergenic
1182518719 22:30873282-30873304 GCAGAGGCCCCCTCCTGCTGTGG + Intronic
1182727282 22:32458016-32458038 TAAGAGGCTCACTCTGGCTGTGG - Intronic
1184152281 22:42646119-42646141 TACTTGGCCCACTGCTGGTGAGG - Intronic
1185299768 22:50073179-50073201 GAAGAGCCCCACTGCTGCCCAGG + Intronic
950198482 3:11026328-11026350 CAAGAGGTCCATTGCTGATGTGG + Exonic
951248408 3:20366938-20366960 TAACAGGGCCATTGCTGCTAGGG + Intergenic
951768866 3:26232157-26232179 TTAGAGGACCACTGCTTCTAGGG + Intergenic
955598050 3:60613306-60613328 TAAGAGAGCCACCACTGCTGAGG + Intronic
957592006 3:82211394-82211416 TGAGAGGCCCAAGGGTGCTGAGG - Intergenic
958036182 3:88172819-88172841 TAAGAATGCCACTGCTTCTGGGG - Intergenic
959052083 3:101534163-101534185 TAAGAGGGCCATGGCTGCTAAGG + Intergenic
961793060 3:129390326-129390348 TAAAAGGCCCAGCTCTGCTGGGG - Intergenic
961806940 3:129496222-129496244 TAAAAGGCCCAGCTCTGCTGGGG - Intronic
963018737 3:140851048-140851070 TAAGAGCACCACCTCTGCTGGGG - Intergenic
963115388 3:141724611-141724633 AGAGAGGCCCTCAGCTGCTGGGG + Intergenic
964095452 3:152926427-152926449 TAAGAGGACAGCTGCTGCTCAGG - Intergenic
964255591 3:154771804-154771826 TGAGATACCCACTGCAGCTGTGG + Intergenic
964931692 3:162032602-162032624 TGAGACACCCAGTGCTGCTGGGG - Intergenic
965167151 3:165209600-165209622 AAAGAGGAGCACTGCTGTTGCGG - Intergenic
967138519 3:186532849-186532871 AAAGGGGCACACTGGTGCTGGGG + Intergenic
972566557 4:40274743-40274765 CAAGAGGCCCACATCTGGTGAGG + Intergenic
972615707 4:40696000-40696022 AAAGAGGACCACTGTGGCTGGGG - Intergenic
974582009 4:63815077-63815099 CAAGAGGTCCCCTCCTGCTGGGG + Intergenic
982061375 4:151607302-151607324 TAAAAGGCCCAGTCCTGTTGTGG + Intronic
982533513 4:156578372-156578394 AAAGAGCCCCTGTGCTGCTGGGG - Intergenic
986899238 5:12412131-12412153 TAGGAGGCCCAATAATGCTGTGG + Intergenic
988363252 5:30263393-30263415 TCAAAGTCCCACTGCTGCTGTGG + Intergenic
988410352 5:30878104-30878126 TGTGAGCCCCACTGCTACTGTGG + Intergenic
989348654 5:40458644-40458666 TCAGGGGCCCACTTCTGGTGAGG - Intergenic
996253846 5:121373593-121373615 GAAGAGGCCCACCCCTCCTGAGG + Intergenic
1001199418 5:169702429-169702451 TAAGGGACTCACTGCTGCTCTGG + Intronic
1001494663 5:172179363-172179385 TCTCAGGCCCCCTGCTGCTGAGG - Intronic
1001732369 5:173969807-173969829 TTAGAGGCCCACAGCTTATGGGG + Intergenic
1002422344 5:179155159-179155181 TAACAGCCACACTGCAGCTGGGG + Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1003039503 6:2673989-2674011 TAAGAGGATCACTGATGGTGAGG + Intronic
1006175370 6:32118022-32118044 AAGGAGGCTCACTGATGCTGTGG + Exonic
1007696405 6:43736845-43736867 TAAGAGGTCCCCTGGAGCTGTGG + Intergenic
1009895778 6:69746894-69746916 AGAGAGGCCCTCAGCTGCTGGGG + Intronic
1009938256 6:70259279-70259301 TAAAAGGCTCTGTGCTGCTGGGG + Intronic
1012527266 6:100193015-100193037 TCTGAGGCCCACCGGTGCTGAGG + Intergenic
1013736666 6:113235163-113235185 TCATAGAGCCACTGCTGCTGAGG - Intergenic
1015665019 6:135619101-135619123 AGAGAGGCCCCCAGCTGCTGGGG - Intergenic
1015910014 6:138161182-138161204 TGAGAAGCCCTCTGCTGCGGCGG + Intergenic
1018877704 6:167839987-167840009 CAAGAGGAGCACTGCAGCTGCGG + Intronic
1019196416 6:170285782-170285804 CCAGAGGCTCACTGGTGCTGCGG - Intronic
1019472879 7:1230433-1230455 TCAGAGGCCCTCGGCTGCGGCGG - Intergenic
1020945475 7:14600560-14600582 TCACAGGCCCACAGCTGGTGGGG - Intronic
1022782346 7:33599139-33599161 TAAGAGGCCCAATTCACCTGGGG + Intronic
1024306183 7:47931413-47931435 AAACAGCCCCACTGCTACTGAGG + Intronic
1025158277 7:56630157-56630179 TAACAGGCCCACTTCTGCTCTGG + Intergenic
1025728319 7:64088018-64088040 TAACAGGCCCACTTCTGTTCTGG - Intronic
1025757418 7:64357866-64357888 TAACAGGCCCACTTCGGCTCTGG - Intergenic
1029486239 7:100843621-100843643 TAACAGGGCCATTGCTGCTAGGG - Intronic
1038410365 8:27353823-27353845 TAGCAGGCCCATTTCTGCTGAGG - Intronic
1039159747 8:34604025-34604047 TGAGATGCCCACTACTACTGTGG - Intergenic
1040372943 8:46794968-46794990 TAACAGGCCCACATCTGCTTTGG - Intergenic
1041515611 8:58695883-58695905 TAACAGGGCCATTGCTGCTAGGG - Intergenic
1042025881 8:64423090-64423112 AGAGCTGCCCACTGCTGCTGTGG + Intergenic
1042481391 8:69307567-69307589 TAAGGGGCCCACATCTGGTGAGG - Intergenic
1042777096 8:72444723-72444745 TCAGTGGCCTACTGCTGCTAGGG + Intergenic
1049215150 8:141404409-141404431 AGAGAGGCCCTCAGCTGCTGGGG - Intronic
1049894385 9:100145-100167 TAAGAAGCCCTCTGCTGCCTCGG - Intergenic
1050348370 9:4715963-4715985 AAAGAGGCTCTTTGCTGCTGGGG + Intronic
1056925048 9:90827305-90827327 AAAGAGGCCCCGTGCTGCTGGGG + Intronic
1057856753 9:98606833-98606855 TGCGAGAGCCACTGCTGCTGAGG + Intronic
1059664388 9:116432182-116432204 TGAGAGGACCACTTTTGCTGAGG + Intronic
1060203090 9:121663544-121663566 GAGGTTGCCCACTGCTGCTGGGG - Intronic
1060216802 9:121743378-121743400 TTAGAGGCCCTCGGCTTCTGAGG - Intronic
1060257608 9:122046473-122046495 TAATACGCCCCCTGCAGCTGAGG + Intronic
1061218611 9:129236193-129236215 TTAGGGAGCCACTGCTGCTGCGG + Intergenic
1061853810 9:133430472-133430494 TACCAGCCCCACTTCTGCTGTGG - Intronic
1189693025 X:43636672-43636694 TAAGAGGTCCTCCACTGCTGAGG + Intergenic
1189745352 X:44162863-44162885 TGAGGGGCCCACTACTGATGGGG - Intronic
1191639373 X:63413740-63413762 TAACAGGGCCATTGCTGCTAGGG - Intergenic
1195698278 X:107682866-107682888 TGAGAGGCCCACTGCTGGCCTGG - Intergenic
1196422862 X:115540690-115540712 TAACAGGGCCATTGCTGCTAGGG + Intergenic
1197679197 X:129364086-129364108 GAAGAGGCCTTCTGCTGCAGTGG - Intergenic
1200845540 Y:7828819-7828841 TAACAGGCCCACTTCTGCTCTGG + Intergenic
1200852840 Y:7903626-7903648 TAACAGGCCCACTTCTGCTCTGG + Intergenic
1200906226 Y:8485443-8485465 TAACAGGCCCATTTCTGCTCTGG - Intergenic
1202257002 Y:22931966-22931988 TAACAGGCCCACTTTTGCTCTGG - Intergenic
1202409993 Y:24565714-24565736 TAACAGGCCCACTTTTGCTCTGG - Intergenic
1202460789 Y:25104358-25104380 TAACAGGCCCACTTTTGCTCTGG + Intergenic