ID: 1122239456

View in Genome Browser
Species Human (GRCh38)
Location 14:100352605-100352627
Sequence CAATGAACCCACTCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122239452_1122239456 1 Left 1122239452 14:100352581-100352603 CCAGCCTGGGCTGCAGGAGCATA 0: 1
1: 0
2: 19
3: 787
4: 14060
Right 1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 127
1122239449_1122239456 13 Left 1122239449 14:100352569-100352591 CCTGCTCAGAGCCCAGCCTGGGC 0: 1
1: 0
2: 10
3: 85
4: 603
Right 1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 127
1122239453_1122239456 -3 Left 1122239453 14:100352585-100352607 CCTGGGCTGCAGGAGCATAGCAA 0: 1
1: 0
2: 0
3: 18
4: 197
Right 1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 127
1122239451_1122239456 2 Left 1122239451 14:100352580-100352602 CCCAGCCTGGGCTGCAGGAGCAT 0: 1
1: 0
2: 5
3: 191
4: 4214
Right 1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG 0: 1
1: 0
2: 1
3: 18
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122239456 Original CRISPR CAATGAACCCACTCCTCCTG GGG Intronic
905950919 1:41949861-41949883 CATTGAAGGCACCCCTCCTGAGG + Intronic
907602351 1:55784057-55784079 CATCGAAGGCACTCCTCCTGAGG - Intergenic
910591480 1:88931439-88931461 CATTGAAGGCACCCCTCCTGAGG + Intergenic
912944929 1:114076942-114076964 CAATGATCCCACTGCCCCTGTGG - Intergenic
913153737 1:116073297-116073319 CTCTGGATCCACTCCTCCTGTGG - Intergenic
919435739 1:197557788-197557810 CCATGAACCAACTCCACTTGGGG - Intronic
923006705 1:230055703-230055725 CCATGAATCACCTCCTCCTGAGG - Intergenic
923109025 1:230876371-230876393 CATTGAGCCCACTGCTCCTGTGG + Intergenic
924669746 1:246111562-246111584 GAATGAAACCAGTCTTCCTGAGG - Intronic
1062760311 10:12344-12366 CAGTGAACCCGCTGCTTCTGGGG - Intergenic
1063309581 10:4939712-4939734 CAGTGAACACACTCATTCTGAGG - Intronic
1063317717 10:5022389-5022411 CAGTGAACACACTCATTCTGAGG + Intronic
1063395906 10:5687243-5687265 CAGGGAACGCATTCCTCCTGGGG - Intronic
1066323354 10:34327840-34327862 GAAAGAACCCACTTCCCCTGAGG + Intronic
1067292956 10:44957764-44957786 CAATGGACCCTCCCCTTCTGAGG + Intergenic
1067535661 10:47107952-47107974 CAAGGAAGTCCCTCCTCCTGTGG + Intergenic
1067713064 10:48665732-48665754 CATCGAAGTCACTCCTCCTGAGG - Intergenic
1072471460 10:95717799-95717821 CATTGAAGGCACCCCTCCTGAGG - Intronic
1072552585 10:96490390-96490412 TAATGAAGCCAGTCCTCCTTTGG - Intronic
1072622793 10:97090968-97090990 CATTGAACAAACCCCTCCTGGGG - Intronic
1073323585 10:102629934-102629956 GAATGAAGCCACGCCTCCCGCGG + Intronic
1073407665 10:103312007-103312029 CACTGCACCTCCTCCTCCTGGGG - Intronic
1076120341 10:127931707-127931729 AAATGACCCCACTCCACCTTAGG + Intronic
1076375213 10:129979134-129979156 CAAAGAAGCCCATCCTCCTGAGG - Intergenic
1076707775 10:132311084-132311106 CCATAAAGCCACGCCTCCTGAGG + Intronic
1078112153 11:8404427-8404449 CAGTCAACCCTCTTCTCCTGGGG + Intronic
1078921024 11:15830819-15830841 AACTGAACCCATTCCTGCTGAGG + Intergenic
1079657116 11:22997893-22997915 CAAAGAACACATTCATCCTGAGG - Intergenic
1092534524 12:9375949-9375971 CAAGGAACCCACGCCGCCTCTGG + Intergenic
1096040290 12:48509287-48509309 CAATAAACCAACTGTTCCTGAGG - Intronic
1096109149 12:49018867-49018889 CAAGGAACCCACCCTTCCGGCGG + Intronic
1097156456 12:57015700-57015722 CCAGGAACCACCTCCTCCTGTGG + Exonic
1098252879 12:68587919-68587941 CAATGAAGCATCTCCTTCTGGGG - Intergenic
1101571519 12:105958178-105958200 CAGTAAACACACTGCTCCTGCGG + Intergenic
1104851052 12:131874078-131874100 CATTGAAGACACCCCTCCTGAGG - Intergenic
1106189915 13:27442628-27442650 CAGTGAACACACCCCTCCTCTGG + Intronic
1106216455 13:27706084-27706106 CAATGAAGCCACTTCACCTGGGG + Intergenic
1114031651 14:18584748-18584770 CAGTGAACCCGCTGCTTCTGTGG - Intergenic
1115809471 14:37090895-37090917 CACTGAACCCACTGCTCCTAGGG + Intronic
1118086153 14:62419704-62419726 CAATGAAGCCACTGCTGCTCTGG + Intergenic
1120824812 14:88945513-88945535 CATTCAACCCACTCTGCCTGTGG - Intergenic
1122239456 14:100352605-100352627 CAATGAACCCACTCCTCCTGGGG + Intronic
1125827087 15:42685627-42685649 TAAAGAACCCACTATTCCTGGGG - Exonic
1126905323 15:53358860-53358882 GAATGCACCCACTACTCCTTTGG - Intergenic
1128690989 15:69724850-69724872 CAAGGAACAGAGTCCTCCTGGGG + Intergenic
1132391260 15:101439843-101439865 CATTGAACCCAAGCCTCCTACGG + Intronic
1135390977 16:22092895-22092917 GGAGGAAACCACTCCTCCTGTGG - Intronic
1141801196 16:86310560-86310582 TAATGAAACCATACCTCCTGAGG - Intergenic
1143899256 17:10161390-10161412 CAATGAACCCACTGCATCTGTGG + Intronic
1143901183 17:10176009-10176031 CAATGAACCCTCTGATCCTAGGG + Intronic
1150241352 17:63636089-63636111 TAATGAACCCACAGCTCCTCTGG - Intronic
1150576302 17:66433831-66433853 CACTGCACCCAGTCCACCTGAGG + Intronic
1151781730 17:76251141-76251163 CAATGTACCCAGCCCTTCTGGGG - Intergenic
1152953219 18:12698-12720 CAGTGAACCCGCTGCTTCTGGGG - Intergenic
1157439292 18:47697674-47697696 CACAGAACCCACTCCTCTTCTGG + Intergenic
1160624226 18:80192227-80192249 CAATGAACACTCTCCTTCGGTGG + Intronic
1161170684 19:2810978-2811000 CAGGGAACACACTCCTCCTGGGG - Intronic
1162585434 19:11555382-11555404 CAAGGAAGCCACTGTTCCTGGGG + Intronic
1163104704 19:15116506-15116528 GAAGGAACCCACATCTCCTGGGG + Exonic
1163923785 19:20319620-20319642 CAATAGACCAACTCTTCCTGAGG + Intergenic
1164294917 19:23901390-23901412 CAATGCACCCAGTCTGCCTGTGG + Intergenic
925661410 2:6207227-6207249 CCATGCTCCCTCTCCTCCTGTGG + Intergenic
926277288 2:11414020-11414042 CAATTAACCAACACGTCCTGTGG - Intergenic
929027011 2:37614585-37614607 CAGGGAAGCCACTCCTCCTCTGG - Intergenic
932283662 2:70515439-70515461 CAAAGGACCCACTCCCTCTGGGG + Intronic
932452690 2:71824616-71824638 CAATGCACCTACTCCTCTGGAGG + Intergenic
933330558 2:80887833-80887855 CAATGAACCCACCCATTGTGTGG - Intergenic
934907494 2:98217998-98218020 CAAGGATCCCACTCCCCCAGAGG + Exonic
937839022 2:126507004-126507026 CCATGAACCCTCACCTCCAGGGG + Intergenic
938496547 2:131801045-131801067 CAGTGAACCCGCTGCTTCTGGGG + Exonic
940537916 2:154969804-154969826 CATTGAAACCACTCTTTCTGAGG - Intergenic
946129040 2:217591283-217591305 CATTGGAGCCACCCCTCCTGAGG - Intronic
1169014093 20:2277591-2277613 CAATGATCCCACTCCTTTTGTGG - Intergenic
1170446595 20:16434314-16434336 CATTGAGCCGAGTCCTCCTGTGG - Intronic
1171404039 20:24897836-24897858 CCAGGAACCCAGTCCTTCTGGGG + Intergenic
1171500509 20:25589256-25589278 CACTGAACCCTGTCCTCTTGGGG + Intergenic
1175342558 20:58243021-58243043 CAGTGACCCCCTTCCTCCTGTGG - Intergenic
1175863341 20:62161686-62161708 CATGGGACCCACTCCTCCTGGGG + Intronic
1176717021 21:10360642-10360664 GTTTGAACCCACTCTTCCTGTGG - Intergenic
1177557788 21:22714690-22714712 CAATGAACCAACTCCCCCTGGGG - Intergenic
1180455763 22:15511805-15511827 CAGTGAACCCGCTGCTTCTGTGG - Intergenic
1180601315 22:17019333-17019355 GTTTGAACCCACTCTTCCTGTGG + Intergenic
1181939508 22:26464375-26464397 CCTGGAACCCACGCCTCCTGAGG - Exonic
1181973449 22:26711259-26711281 CAATGAGCTCAGTCCTGCTGGGG + Intergenic
1182741065 22:32567839-32567861 CAATAAACCTCCTCTTCCTGGGG - Intronic
1182904242 22:33921827-33921849 CATTTCACCCACTTCTCCTGTGG - Intronic
950581879 3:13867662-13867684 CAAGGAACCCACTCATCCCTAGG + Intronic
953096957 3:39787109-39787131 CAATGAGTCCACTGATCCTGAGG - Intergenic
953189492 3:40670219-40670241 TCATAAACCCACTCCTCCTGGGG + Intergenic
953848147 3:46445108-46445130 CAGTGCACCCACGCCTCCAGGGG + Intronic
955345453 3:58157910-58157932 TGATGAACACACTTCTCCTGCGG - Intronic
957408856 3:79810244-79810266 CAAAGAACCCAAACATCCTGAGG - Intergenic
963059578 3:141214356-141214378 CTGTGAACACACTCCTTCTGGGG - Intergenic
969397753 4:6933749-6933771 CAATGAAATCACTACTCCTATGG - Intronic
973295536 4:48515982-48516004 TAATTAACCCACTCGTCCTGTGG + Intronic
975313299 4:72926534-72926556 CATTGAAGGCACCCCTCCTGAGG - Intergenic
980613145 4:135184237-135184259 CAATGATCACAGTGCTCCTGAGG + Intergenic
982118162 4:152115052-152115074 CAATGTACCACCTCCTGCTGTGG - Intergenic
983936608 4:173507043-173507065 CAATGCCCCCACCCCTCCTCTGG - Intergenic
985621362 5:957835-957857 CATTCCACCCACTCCTCTTGAGG + Intergenic
985664770 5:1176420-1176442 CAATGCACCCCCTCGCCCTGTGG + Intergenic
990233901 5:53745865-53745887 CAATGAATGCACTGCTTCTGTGG + Intergenic
999552191 5:152701522-152701544 CAATGTAGCCACTCCTGCTGCGG + Intergenic
1003005515 6:2377413-2377435 AAATGAACCAGCTTCTCCTGGGG - Intergenic
1003403797 6:5811683-5811705 CCACTCACCCACTCCTCCTGTGG + Intergenic
1013137925 6:107300286-107300308 CATTGAAGGCACCCCTCCTGAGG + Intronic
1013300278 6:108798823-108798845 CACTGAGCCCGCTCCTGCTGCGG - Intergenic
1015748978 6:136540996-136541018 AAATGAACCCACCACGCCTGTGG + Intronic
1017135219 6:151142007-151142029 CACTGAAGGCACTCCTCCTGGGG - Intergenic
1019312254 7:368613-368635 CAGTGACCCCACTTCTCCAGGGG + Intergenic
1020068150 7:5205558-5205580 CAGTGAGCCACCTCCTCCTGTGG - Intronic
1026058099 7:67002463-67002485 CAATGAAGCTACGCCTTCTGAGG - Intronic
1026719990 7:72822561-72822583 CAATGAAGCTACGCCTTCTGAGG + Intronic
1029148194 7:98461785-98461807 CTAAGAACCCTCTCCTCTTGGGG + Intergenic
1031471924 7:122176678-122176700 CATTGAAGTCACCCCTCCTGAGG + Intergenic
1034690528 7:153010194-153010216 AAATAAACCCCCTCTTCCTGCGG - Intergenic
1038074561 8:24057194-24057216 CAATGAAGCCACCACTGCTGTGG + Intergenic
1039879292 8:41614123-41614145 CAATGATGCCACTCAACCTGGGG - Intronic
1042107746 8:65347297-65347319 CAATGAGCATACTCCTCCTTGGG + Intergenic
1042364702 8:67923172-67923194 CATTGAAGTCACCCCTCCTGAGG + Intergenic
1042910623 8:73822144-73822166 CATTGAAGGCACCCCTCCTGAGG + Intronic
1043369956 8:79579384-79579406 CAAAGACCCAACTCCTGCTGTGG + Intergenic
1044011049 8:86994599-86994621 GAAAGAACCCACTCTTGCTGTGG - Intronic
1044221005 8:89669562-89669584 CAATGAAGCAACTCCCCATGAGG + Intergenic
1044884330 8:96760468-96760490 CACTGAGCCCACTCCTACTTAGG - Intronic
1046504278 8:115117136-115117158 CAATGGACGCACTCCTGCTGGGG - Intergenic
1047895303 8:129359961-129359983 CAATGAACCTCCTTTTCCTGAGG - Intergenic
1048973364 8:139657478-139657500 CAGTGAACCCTCTCTGCCTGTGG + Intronic
1049416611 8:142498306-142498328 CCCTGAACAAACTCCTCCTGAGG - Intronic
1050734528 9:8748063-8748085 CATTGAAGGCACCCCTCCTGAGG + Intronic
1055212284 9:73811268-73811290 AAATGCACCCACACCTCCTGAGG + Intergenic
1057058387 9:91981621-91981643 CATTGAAGCCACCCCTCCTGAGG + Intergenic
1057293268 9:93820469-93820491 CCATGCCCCCACCCCTCCTGGGG + Intergenic
1061008141 9:127939951-127939973 CATTCACCCCACTCCTCCTCAGG - Intergenic
1185690545 X:2151716-2151738 CAACAAACCCTCGCCTCCTGAGG + Intergenic
1187756745 X:22536096-22536118 CAAAGAACAAACTCTTCCTGCGG + Intergenic
1189301795 X:39957613-39957635 GAATGAACACACTCATCCTTGGG - Intergenic
1191103665 X:56759262-56759284 CTATGATCCCAGTCCACCTGTGG + Intergenic
1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG + Intergenic
1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191108569 X:56787989-56788011 CTATGATCCCAGTCCTCCTGTGG + Intergenic
1191109394 X:56793252-56793274 CTGTGATCCCAGTCCTCCTGTGG + Intergenic
1191110914 X:56802693-56802715 CCATGATCCCAGTCTTCCTGTGG + Intergenic
1197158910 X:123301805-123301827 TTATGAGCCCAATCCTCCTGTGG + Intronic
1200001958 X:153066716-153066738 CAATGCTCCCACTCAACCTGTGG + Intergenic
1200005774 X:153083309-153083331 CAATGCTCCCACTCAACCTGTGG - Intergenic