ID: 1122241783

View in Genome Browser
Species Human (GRCh38)
Location 14:100373371-100373393
Sequence TGAAGAAAACAGACTAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 396}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122241783_1122241787 7 Left 1122241783 14:100373371-100373393 CCAACCTTAGTCTGTTTTCTTCA 0: 1
1: 0
2: 0
3: 25
4: 396
Right 1122241787 14:100373401-100373423 CTAACATCTGCCCACCATCCTGG 0: 1
1: 0
2: 2
3: 12
4: 134
1122241783_1122241790 20 Left 1122241783 14:100373371-100373393 CCAACCTTAGTCTGTTTTCTTCA 0: 1
1: 0
2: 0
3: 25
4: 396
Right 1122241790 14:100373414-100373436 ACCATCCTGGTCACTATTTTTGG 0: 1
1: 0
2: 0
3: 14
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122241783 Original CRISPR TGAAGAAAACAGACTAAGGT TGG (reversed) Intronic
902176861 1:14657005-14657027 TGAAGAAGACAGCCCTAGGTTGG - Intronic
904781866 1:32955932-32955954 TGAAGAATACAGACACAGCTGGG + Intronic
905217514 1:36419700-36419722 TTAAGAAACCAGAGTGAGGTTGG - Intronic
905490557 1:38340243-38340265 TGCTGAAAACAGACTGGGGTAGG + Intergenic
906541675 1:46591592-46591614 TGTAGAAAGCTGACAAAGGTGGG + Intronic
909527566 1:76643897-76643919 AAAAGAAAACAGACTAAGAGAGG - Intergenic
909852601 1:80487389-80487411 TGAAGAAAATAGGTTGAGGTGGG + Intergenic
909955276 1:81771583-81771605 TGCTGAAAACACAGTAAGGTTGG - Intronic
910015946 1:82523660-82523682 TGAAGTAACCAGATTAAGGAAGG - Intergenic
910045023 1:82902980-82903002 AGAAGAAAACAGACTAAGACAGG + Intergenic
910268481 1:85366987-85367009 ATAAGAAAACACACAAAGGTTGG - Intronic
911169806 1:94758584-94758606 GAAAGAAAACAGACTAGGTTCGG - Intergenic
912186381 1:107281287-107281309 TGAAGATAGCAGACTGAGGCTGG - Intronic
912622942 1:111183436-111183458 TGAATAAAACAGAATAACGTAGG - Intronic
916147441 1:161752211-161752233 TTGAGAAATCAGGCTAAGGTAGG - Intronic
916328408 1:163589299-163589321 AGAAGAAAATAGACTATGCTTGG - Intergenic
918252688 1:182717658-182717680 TGAAGAAAACACAATAGGGGAGG - Intergenic
919218225 1:194588907-194588929 TCAAGAATACACACTAAGGAGGG + Intergenic
919240582 1:194911185-194911207 TTAAGAAAACAGAATAATATTGG - Intergenic
919753882 1:201054565-201054587 TGGAGAAAAGAGACGAAGGGAGG + Intronic
922812096 1:228422456-228422478 TGAAGAACAGAGTCTAAGTTGGG - Intergenic
922950595 1:229556004-229556026 TGAAGAAACAAGCCTAGGGTTGG - Intronic
924428422 1:243974982-243975004 TGAAGAATAAAGAATAAAGTGGG + Intergenic
1063180104 10:3590462-3590484 TGAAGAAAACCGAATAAATTGGG + Intergenic
1063451500 10:6153373-6153395 TGAACAAAACAGACAAACCTCGG + Intronic
1063783396 10:9352317-9352339 TGAAGAATAAAGATTAAGGGAGG + Intergenic
1065589104 10:27248032-27248054 TGAAGAAAGCAGATTAATGAAGG + Intergenic
1066227673 10:33400001-33400023 TGGAGAAATCAGAATAAGATTGG - Intergenic
1066238458 10:33509909-33509931 TAAAGAAAACAGTCTTACGTGGG - Intergenic
1069825450 10:71252676-71252698 TGAAGGAAACAGACTCAGAGAGG + Intronic
1070231892 10:74576573-74576595 TCAAGAAGAAAGACTGAGGTTGG + Intronic
1071168880 10:82840177-82840199 TGTAGGAAACTGACAAAGGTAGG + Intronic
1071719230 10:88126202-88126224 TGTAGAGACCAGACAAAGGTGGG + Intergenic
1072286456 10:93920586-93920608 TGAGGAAAACAGACCAGGGAGGG + Intronic
1072509905 10:96110734-96110756 AGAAGAAAACTGACTTAGGAAGG + Intergenic
1073539141 10:104304073-104304095 TTCAGAAAACAAACTAAGCTAGG - Intronic
1074606410 10:114973205-114973227 TGAAAAAAACACACTTAGGAAGG + Intronic
1074920550 10:118004470-118004492 TGAAGAAAGTAGAATAGGGTTGG - Intergenic
1077915016 11:6605760-6605782 TGAAGAAATCAGACTACATTGGG + Intronic
1081066653 11:38549688-38549710 AGAAGAAAAAATACTAAGGTAGG + Intergenic
1081161232 11:39751799-39751821 TGAAAAAAAGAAAATAAGGTAGG + Intergenic
1081424333 11:42908349-42908371 TGAAGAAAATAGTCTGTGGTTGG - Intergenic
1081538477 11:44013095-44013117 TGAAGGAAAGAGAATGAGGTAGG + Intergenic
1082125639 11:48428590-48428612 TGAAGGAAACATACTATAGTAGG + Intergenic
1082139785 11:48595556-48595578 TGAAGAAATCAGCCTAAGAAAGG + Intergenic
1082160474 11:48883584-48883606 GGAAGAAAACAGGCAAAGGAAGG - Intergenic
1082161892 11:48896822-48896844 GGAAGAAAACAGGCAAAGGAAGG + Intergenic
1082236088 11:49821392-49821414 AGAAGAAAACAGGCAAAGGAAGG - Intergenic
1082242609 11:49888413-49888435 AGAAGAAAACAGGCAAAGGAAGG + Intergenic
1082259500 11:50067325-50067347 TGAAGAAACTAAAGTAAGGTGGG - Intergenic
1082559252 11:54599620-54599642 TGAAGGAAACATACTATAGTAGG + Intergenic
1082609589 11:55281312-55281334 AGAAGAAAACAGGCAAAGGAAGG - Intergenic
1082657096 11:55869216-55869238 AGAAGAAAACAGGCAAAGGAAGG + Intergenic
1082732312 11:56814989-56815011 TGATGAAAACAGACTCAAATAGG + Intergenic
1083033273 11:59614271-59614293 TGAGGAAAACAGACTTAGCATGG - Intronic
1083213236 11:61202503-61202525 TGGAGAAATCAGACCCAGGTGGG + Intergenic
1083216117 11:61221248-61221270 TGGAGAAATCAGACCCAGGTGGG + Intergenic
1083219001 11:61240074-61240096 TGGAGAAATCAGACCCAGGTGGG + Intergenic
1083258491 11:61510521-61510543 AGAAGAGAACAGAATAGGGTGGG - Exonic
1084054121 11:66620699-66620721 TGAATAAAACTCACTAAGGAGGG + Intronic
1085805529 11:79632562-79632584 TGAAGAATACAGCCTTAAGTAGG - Intergenic
1086001992 11:81995438-81995460 TTCAGAAAATAAACTAAGGTTGG - Intergenic
1086355249 11:85990903-85990925 TGAAGAAAAAAATCTAAGGATGG + Intronic
1086872854 11:92060275-92060297 GGAAGAAGACCGACTAAAGTTGG + Intergenic
1086983570 11:93224911-93224933 TGAAGAAAACAAACTAAGCAGGG + Intergenic
1087045328 11:93839470-93839492 TGAAGAAAACAGATTCAGGGAGG - Intronic
1087229755 11:95647095-95647117 TAAAGAGAACAGCCTAAGGAGGG + Intergenic
1087977598 11:104569011-104569033 AGAAGAAAAAAGAGTATGGTGGG + Intergenic
1088845970 11:113668011-113668033 TGAAGAAAACAGAATGAGTCTGG - Intergenic
1089035370 11:115384221-115384243 TGAATAAAACAGGAGAAGGTAGG - Intronic
1090590629 11:128263079-128263101 TGAAGAACACAGAACAAGGTAGG + Intergenic
1090601427 11:128376149-128376171 TGAATATAACAGACCACGGTGGG + Intergenic
1090728664 11:129550997-129551019 TGAAGACAATACACAAAGGTGGG - Intergenic
1091604703 12:1940337-1940359 TTAAGGAAACATACTAAGCTTGG + Intergenic
1091920620 12:4301875-4301897 AGAAGAAAACAAACTACGGAAGG - Exonic
1092006224 12:5072676-5072698 TGAAGAAAAGTAACTAGGGTTGG + Intergenic
1092963550 12:13619401-13619423 TGATGAACACAGAGCAAGGTAGG - Intronic
1093157957 12:15710811-15710833 TGAAGAGAATATAATAAGGTAGG - Intronic
1094059423 12:26297748-26297770 TGAAGAAAGCAGACATAGGATGG - Intronic
1094228989 12:28081240-28081262 AGAAGAAACCAGACAAAGGAAGG + Intergenic
1094408961 12:30149320-30149342 TGAAGAAAAGTGCCCAAGGTTGG + Intergenic
1096636285 12:52961801-52961823 TGAAGAAAACAGGGTAGGCTGGG - Intergenic
1097606763 12:61764580-61764602 TGAAGAAATCAGACTAGATTTGG + Intronic
1098732974 12:74062483-74062505 GGAAGGAAAGAGACAAAGGTAGG - Intergenic
1098743782 12:74208796-74208818 TAGAGAAAAAACACTAAGGTTGG + Intergenic
1101695865 12:107125875-107125897 TGAAGAAAACAGAGCAGAGTTGG - Intergenic
1103001862 12:117390879-117390901 CTATGAAAACAGACCAAGGTTGG - Intronic
1106888694 13:34218820-34218842 AGCAGAAAACAGACTAAGAGAGG - Intergenic
1106984632 13:35331264-35331286 TGAAGAAGACAGACTTTGATTGG - Intronic
1107583586 13:41819183-41819205 TTAAGAAAATAGACTAAGATTGG + Intronic
1107629534 13:42328990-42329012 TCAAGAAAACAGAATATTGTTGG - Intergenic
1108372502 13:49784486-49784508 GGGAGACAACAGACTAAAGTTGG + Intronic
1108936878 13:55892219-55892241 TGAAGAAGACAGAAAAATGTTGG - Intergenic
1110081542 13:71320203-71320225 GGAAGAAGACAGAATAAGATGGG - Intergenic
1110470062 13:75849448-75849470 TGAGGAAAACATATTGAGGTAGG + Intronic
1111139664 13:84099418-84099440 TGAAGAAAAAAGACAATGTTGGG + Intergenic
1111645183 13:91023349-91023371 TGCAGAACACAGACCCAGGTGGG - Intergenic
1112450816 13:99507876-99507898 TGATGATAGCAGAATAAGGTGGG + Intronic
1113048928 13:106187021-106187043 TGAAGGAAACAGAATTAAGTGGG + Intergenic
1113366664 13:109682941-109682963 TGAGGAAAGGAGACTCAGGTTGG - Intergenic
1113440999 13:110327753-110327775 TGACGAAAACAGAATTAGCTGGG - Intronic
1115643477 14:35350493-35350515 AGAGGAAAACAGAATAATGTGGG - Intergenic
1115785617 14:36822062-36822084 AGAAGAGAACAAACCAAGGTAGG + Intronic
1115796133 14:36937644-36937666 TGAAGGAAACAAACAAAGATCGG + Intronic
1116802598 14:49458922-49458944 TGCTGAAACCAGTCTAAGGTAGG + Intergenic
1116822723 14:49641157-49641179 TGAAGAAAACAGGCATAGGTAGG - Intergenic
1117060747 14:51960152-51960174 TGAACAAAACACACTGAGATAGG - Intronic
1117304737 14:54462312-54462334 TTAAAAAAACAGTCTAAGATCGG + Intergenic
1118076134 14:62301215-62301237 TGAAGAATAAAGACAGAGGTTGG - Intergenic
1118254129 14:64190423-64190445 TAAAGAAAAAATATTAAGGTGGG - Intronic
1118279888 14:64418850-64418872 AAAAGAAAAAAGACAAAGGTCGG - Intronic
1118694488 14:68371177-68371199 TGAAGAGAACAGATTGGGGTGGG + Intronic
1121186770 14:91979446-91979468 TGATGAAAACTTACTAAGATTGG + Intronic
1121775189 14:96585724-96585746 TGAAGAAAACAGACCAAATGTGG - Intergenic
1121859220 14:97300604-97300626 AGAAGTCAAGAGACTAAGGTGGG - Intergenic
1122241783 14:100373371-100373393 TGAAGAAAACAGACTAAGGTTGG - Intronic
1123108152 14:105852538-105852560 TGCAGCACACAGACCAAGGTGGG + Intergenic
1124068360 15:26367543-26367565 TGGAGAAAACAGACTATGCATGG - Intergenic
1124433322 15:29626105-29626127 TGAAGAAACCATTCTAAGTTTGG - Intergenic
1124647172 15:31446250-31446272 TAAAGAAAAAAAATTAAGGTGGG - Intergenic
1124723797 15:32136734-32136756 TGAAGAAAACAGGAGAAGGCCGG + Intronic
1125343479 15:38696746-38696768 AGAAAAAAACAGAGCAAGGTGGG - Intronic
1125369928 15:38963718-38963740 AGAAGAAAACAAACAAATGTTGG - Intergenic
1127400528 15:58581123-58581145 GGTAGAAAACAGACAAACGTGGG - Intergenic
1128386738 15:67154577-67154599 TGAAAAGAACAGGCTAATGTTGG + Intronic
1129484336 15:75854781-75854803 AGCAGAAAAAAGACCAAGGTAGG + Intronic
1130011564 15:80156609-80156631 TGAGGGAAACAAACTAAGGAGGG - Intronic
1131078153 15:89511854-89511876 AGAAGCAAACAGAGTAGGGTGGG + Intergenic
1131835321 15:96384374-96384396 TGAACAAAACTGGCTAAGGCAGG - Intergenic
1132182231 15:99765542-99765564 CGAAGAAAACAGTCTGGGGTGGG - Intergenic
1132940277 16:2502871-2502893 TGAAGAGATCAGACTCAGCTTGG - Exonic
1133080555 16:3315699-3315721 TGTAGAAAACAGACTGTGGGAGG - Intronic
1133735375 16:8611041-8611063 TGAGGAAAGCAGACTAGGGAAGG - Intergenic
1134851545 16:17482965-17482987 TGGAGAGAACAGAGCAAGGTTGG - Intergenic
1135007762 16:18842376-18842398 TGAAGAAATCAGTCCATGGTTGG - Exonic
1137774903 16:51046361-51046383 TGAAGAAAAGGGAATGAGGTGGG + Intergenic
1139385822 16:66569692-66569714 TTAAGGAGAGAGACTAAGGTTGG + Intronic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1141490100 16:84367150-84367172 TGAAGAAAATTGCCCAAGGTCGG + Intergenic
1141872435 16:86796935-86796957 AGAGGAAAACAGACAAAGGCAGG - Intergenic
1142734736 17:1889701-1889723 TTAAGAAAACAGTTTAAGGCCGG + Intronic
1142769248 17:2084752-2084774 TAAAGACAAGAGACTTAGGTGGG - Intronic
1144401349 17:14905737-14905759 TGAAGAAAGAAGGCTCAGGTGGG + Intergenic
1145193840 17:20869509-20869531 TGAAGAAAACAGTTTTTGGTTGG + Intronic
1145245738 17:21268255-21268277 TGAGGAAAACAGAATTAGGGAGG - Intergenic
1145295745 17:21591675-21591697 GGAGGAAAACAGACTAGTGTTGG + Intergenic
1145352063 17:22091735-22091757 TGAAGAAAACAGTTTTTGGTTGG + Intergenic
1145368036 17:22280382-22280404 GGAGGAAAACAGACTAGTGTTGG - Intergenic
1149281948 17:55115183-55115205 TGAAGGAAACAGACCACTGTAGG + Intronic
1149424290 17:56540140-56540162 TGATGAACAGAGACTAAGGCAGG + Intergenic
1150041970 17:61872358-61872380 TGAAGGAAACAGAGCAAGATAGG - Exonic
1150259781 17:63779557-63779579 AGAAGAAAACAAAATGAGGTGGG - Intronic
1150959023 17:69894027-69894049 TGAATAAAGGAGACTTAGGTAGG + Intergenic
1155180433 18:23340646-23340668 AGAAAAAAACAGACAAAGGCTGG + Intronic
1155815661 18:30305685-30305707 TGAACAAAACAGAGTAAGATGGG - Intergenic
1155985281 18:32224250-32224272 TGAAGAAAAAATAATAAAGTGGG - Intronic
1156322230 18:36037661-36037683 TGAAGAAAACAGAAAGATGTGGG + Intronic
1156529297 18:37799368-37799390 TGTGCAAAACAGACTAAGATGGG + Intergenic
1158749609 18:60243678-60243700 TGAAGAAAATAAAGTGAGGTAGG - Intergenic
1159621211 18:70640887-70640909 TGAAGAAAAAAGATGAAGGAAGG - Intronic
1160111810 18:76039713-76039735 TGAATAAAACAGACTTAGTGTGG + Intergenic
1162713716 19:12614988-12615010 TGAACATAGGAGACTAAGGTGGG - Intronic
1162855501 19:13465225-13465247 TGAAGAAAAGGAACTAAGGCTGG - Intronic
1163056314 19:14721531-14721553 TGAAGAAAACAGACACAAGAGGG - Exonic
1164516528 19:28941175-28941197 TGATGGAAACAGTCTAAGGAAGG + Intergenic
1164530860 19:29047215-29047237 TGAAGAAAACAGCCTCAGCCAGG - Intergenic
1164775059 19:30846504-30846526 TGAAGAGAACAGAATCAGGTTGG - Intergenic
1165226168 19:34356796-34356818 TGAAGAAAATGGAGTAATGTGGG + Intergenic
1165780226 19:38428810-38428832 TTAAGAAAAAAGAGTCAGGTTGG - Intergenic
1165824371 19:38697503-38697525 GGAAGGAAACAGACTTAAGTAGG + Intronic
1166018254 19:40000326-40000348 AGTAGAAAACAGAATAAGGGTGG + Intronic
1166079254 19:40433726-40433748 TGAAGAAAACAAAATAAGACGGG + Intergenic
1166649896 19:44564731-44564753 TGAAAAAAAAAGAATAAAGTAGG - Intergenic
925303378 2:2832744-2832766 AGCAGAAAACAGACTAAGACAGG - Intergenic
925333702 2:3077757-3077779 TGAAGAAAACACTCTAGGCTGGG - Intergenic
925688159 2:6493984-6494006 AGAAGAAAAAAGATTTAGGTGGG - Intergenic
926017020 2:9462229-9462251 TGAACTGAACAGACTAAGATAGG - Intronic
926889904 2:17629989-17630011 TGAAGACAACACCCAAAGGTGGG + Intronic
928383711 2:30846070-30846092 TGAAGAAAAGAGAGTTGGGTTGG - Intergenic
928936499 2:36684313-36684335 TGAATAAAACAAACTAAGGAGGG + Intergenic
929909954 2:46081447-46081469 TGAAGCACACAGACTACGGCGGG + Intronic
929957251 2:46467529-46467551 TGGAGAAATCAGACTGAGGAGGG - Intronic
930437780 2:51367686-51367708 TGAAGATGACAAACTATGGTAGG - Intergenic
931035326 2:58235262-58235284 TGAGGAAAACACCCAAAGGTGGG + Intronic
933144746 2:78837926-78837948 GAAAGCAAACATACTAAGGTTGG + Intergenic
933275454 2:80279118-80279140 TGAAGAAGACAGAATAATGAAGG + Intronic
933444702 2:82365059-82365081 TGAAGACACCACACAAAGGTAGG + Intergenic
935884134 2:107597314-107597336 TGAAAAACATAGACCAAGGTTGG - Intergenic
936669588 2:114641281-114641303 TCAGGAAAAAAGACAAAGGTCGG - Intronic
936960077 2:118063790-118063812 AGAAGAAAAGAGATTAAGTTAGG + Intergenic
937620511 2:123979933-123979955 AGAAGGAAACAGAAAAAGGTGGG + Intergenic
938899668 2:135789492-135789514 AGAAGAAAACAGACTGAGAGAGG + Intronic
939096051 2:137834710-137834732 TGTAGAAAACTGAAAAAGGTAGG - Intergenic
939598043 2:144152270-144152292 TTAAGAAAACAGCCTTATGTTGG - Intronic
941335116 2:164232474-164232496 TGAAAACAACAGTCTAAAGTGGG + Intergenic
941495113 2:166190816-166190838 TGAAGCACACAGATTAAGATAGG + Intergenic
941623233 2:167802318-167802340 GGAAGAAAACAGACTGAGAGAGG + Intergenic
943066838 2:183096530-183096552 TGAAAAAAACAAAATGAGGTCGG - Exonic
944397519 2:199285864-199285886 AAAAAAAAACAGACTAAGGCTGG - Intronic
944488827 2:200236413-200236435 TGAAGAAAACAGACAATTATAGG - Intergenic
945141798 2:206694584-206694606 TGAAGAAATCATACTTACGTTGG + Intronic
945545076 2:211139783-211139805 TTAAGACAACAGACTAAGAAGGG + Intergenic
946523745 2:220495643-220495665 TGAAGAAAACTGACAGAGCTAGG - Intergenic
948116185 2:235495314-235495336 TTAAGCAAACACACTAAGGAGGG - Intronic
1170985916 20:21258371-21258393 GGAAGAAAAAAGATTAGGGTGGG + Intergenic
1173990415 20:47298095-47298117 TGAAGAAAACAAATTCAGGATGG - Intronic
1174093197 20:48066623-48066645 AGAAGAAAGCAGAGTGAGGTGGG + Intergenic
1174191759 20:48745617-48745639 AGAAGAAAACACAATAAGGAAGG + Intronic
1175728112 20:61333156-61333178 TAAAGAAAAGAAACAAAGGTAGG + Intronic
1176648940 21:9528645-9528667 TGAAGAAAACAGTTTTTGGTTGG - Intergenic
1176694968 21:9964966-9964988 TGAAGAAAATAAAGTAAGGCAGG - Intergenic
1177096812 21:16845683-16845705 GGAAGAAAAGAGCCTAAGGAAGG - Intergenic
1177197699 21:17920095-17920117 AGAAGAAAACAGAAAAATGTGGG - Intronic
1177568174 21:22850436-22850458 TACAGAAAACAGACTAACTTGGG - Intergenic
1177767248 21:25473013-25473035 AGAAGAAAACAGAAAAATGTGGG + Intergenic
1178348340 21:31851227-31851249 TGAGGGAAACAGACAAAGGAGGG - Intergenic
1178704231 21:34859596-34859618 AGAACAAAACAGAATGAGGTTGG + Intronic
1179553669 21:42159406-42159428 AGAAGGAAACAGACAAAGGAAGG + Intergenic
1180005951 21:45020650-45020672 TGAAGAAACCAAACCAAGATGGG + Intergenic
1181373804 22:22440321-22440343 AGAAGAAAATAGACAAAGGCAGG + Intergenic
1182606728 22:31511576-31511598 TGAAGAAACCAGGCTGAGGCAGG - Intronic
1182702501 22:32251882-32251904 GCAAGAGAACAGACTAGGGTTGG + Intronic
1182933700 22:34199738-34199760 TAGAGAACACAGACTAATGTAGG + Intergenic
1183123297 22:35749219-35749241 GGAAGAAAACAGAACAGGGTTGG + Intronic
1183366978 22:37412038-37412060 TTCAGAAAGCAGACTGAGGTTGG + Intronic
1183430404 22:37762362-37762384 TGAGTAAAACGGACAAAGGTGGG - Intronic
949347057 3:3086199-3086221 TGAGGAAAAGAGACTTATGTGGG - Intronic
949933565 3:9099415-9099437 TGAAGAAAACAGAATGAGGCTGG + Intronic
950448058 3:13049428-13049450 GGAAGAACACAGCCTGAGGTGGG - Intronic
951018804 3:17759690-17759712 TGAGGAAGAGAGACTAAGTTAGG + Intronic
952902501 3:38119463-38119485 TGAAGAAAAGAGAATAGTGTTGG - Intronic
953287539 3:41627181-41627203 TGAATAAATAGGACTAAGGTGGG - Intronic
953818449 3:46183045-46183067 TGAATAAAACAGTGTGAGGTAGG - Intronic
955856276 3:63277423-63277445 TCAAGAAAACAGTCTAACTTTGG + Intronic
955892029 3:63660425-63660447 TACAGAGAACAGACTAGGGTTGG + Intronic
956376363 3:68617538-68617560 TGTAGAAATCAGACTAAACTAGG - Intergenic
956925067 3:73977314-73977336 TGAAGAAAATAACCTAAGTTGGG + Intergenic
957280174 3:78141035-78141057 TGAATATAAGAGACTAAGATAGG + Intergenic
957541808 3:81580683-81580705 TCGAGAAGACAGACTAAGGCTGG + Intronic
957682726 3:83458514-83458536 TGGAGAAAAAAGACTGAAGTGGG - Intergenic
957717839 3:83954295-83954317 GAAAGAAAACAGAGAAAGGTGGG + Intergenic
958049611 3:88328607-88328629 AGAAGAAACCAGATTAAAGTAGG + Intergenic
958143788 3:89598078-89598100 TGCAGAAAACAGCCTAAAGATGG + Intergenic
959901605 3:111667789-111667811 GGAAAAAAACAGAGTACGGTTGG + Intergenic
961835622 3:129656140-129656162 TGAAGAAGACCGACTGAGGTAGG + Intronic
961941239 3:130639291-130639313 TGCAGGAAACAGACTATGTTGGG - Intronic
963387091 3:144611157-144611179 TGAAGCAATCAGTCTAGGGTAGG + Intergenic
963660073 3:148114214-148114236 TGAAGAAAAAAGACTAAAAGAGG + Intergenic
964890698 3:161531349-161531371 TGAAGAAAACAAAGTGAGGAGGG - Intergenic
965086450 3:164105096-164105118 TGAGGAAAACAGAAAAAGGCAGG - Intergenic
965517149 3:169633755-169633777 TCAAGAAGAGAGGCTAAGGTTGG + Intronic
965809399 3:172576662-172576684 TGGAGAAGACAGACTAAAGATGG + Intergenic
966781479 3:183588054-183588076 TGTAGAAAACAGACTAAACAGGG + Intergenic
967155169 3:186685227-186685249 AGAAGAAAACAGAAAAATGTGGG - Intergenic
967960862 3:194922775-194922797 AAAAGAAAACAGACTAAGTATGG - Intergenic
968084810 3:195869503-195869525 TGAAGAAGGCAGGCTGAGGTGGG + Exonic
970084491 4:12331359-12331381 AGAAGAAAATAGACTAAGACAGG + Intergenic
970351070 4:15202246-15202268 TGAAGAACAAAGCCCAAGGTTGG - Intergenic
971498081 4:27289028-27289050 TGAAGGAGAGAGACTAAGGTGGG - Intergenic
971591871 4:28479153-28479175 TGGAGAACACTGACTAAGATAGG - Intergenic
971623925 4:28894570-28894592 TGAAGCAAACTGAGTAATGTTGG + Intergenic
972980991 4:44701014-44701036 TGAATAAAAAAGACTAAGACTGG - Intronic
974075738 4:57166720-57166742 TGAAGAGGACAGACTAAACTGGG - Intergenic
975164933 4:71167921-71167943 AGCACAAAACAGACTAAGGCAGG - Intergenic
976282963 4:83343247-83343269 AGCATAAAACAGACTAAGATAGG + Intergenic
976364241 4:84215230-84215252 TGAGGAAAATAGAGTAATGTGGG + Intergenic
976521645 4:86034880-86034902 TGTAGAAAACAGAATAGGGGTGG + Intronic
976725062 4:88207838-88207860 TGAAAAAAACAAAATGAGGTTGG - Intronic
977831500 4:101599290-101599312 TGAAGAAAATAGACTGAGTAAGG - Intronic
978237424 4:106475808-106475830 TGAAGAAAAGAGACACATGTTGG - Intergenic
978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG + Intergenic
979137404 4:117127271-117127293 AGAAGAAAACAGAAAAATGTGGG + Intergenic
979485823 4:121269192-121269214 ATAAGAAAAGAGACTAAGTTAGG - Intergenic
980048541 4:128015319-128015341 TGATGAAAACAGACTTAAGATGG - Intronic
980367595 4:131825188-131825210 TGAAGAAAATAAAGTAAGGAAGG - Intergenic
980437044 4:132790538-132790560 TGAAAAAAAAAGAATAAAGTTGG + Intergenic
980709189 4:136541999-136542021 TGAAGAAGAAATAATAAGGTGGG + Intergenic
981569884 4:146140311-146140333 TGGAGAAAGTAGACTAAGATTGG - Intergenic
981831029 4:149002029-149002051 TGTAGAAAACAGACCATGGAAGG - Intergenic
984090834 4:175373373-175373395 CAAATAAAATAGACTAAGGTAGG + Intergenic
984251735 4:177344163-177344185 TGTAGAAAACAGAATCAGGTCGG - Intronic
984347131 4:178542666-178542688 GGAAGAAAAAAGATTAAGTTTGG + Intergenic
984998040 4:185455103-185455125 TAAACAAAATAGACAAAGGTAGG + Intronic
986733876 5:10654021-10654043 AGAAGAAAACAGACAAAGGAAGG - Intergenic
987483410 5:18490611-18490633 TGCAGCAAACTGAATAAGGTGGG + Intergenic
988070838 5:26285991-26286013 AGAAGAAGACAGAATAATGTGGG - Intergenic
988995877 5:36714534-36714556 TGAAGAAAACTAGCTAAGGAAGG + Intergenic
989191976 5:38679244-38679266 TGAAGAAAACATCCTATGATTGG - Intergenic
989396273 5:40960381-40960403 TAAAGAAAAAAGAATAAGTTGGG + Intronic
990505631 5:56441467-56441489 TGAAGAAAACAGATGCAGGCAGG - Intergenic
990792204 5:59494989-59495011 TGAAAATAACAGCCTTAGGTGGG - Intronic
990844656 5:60123162-60123184 AGAAGAAGACAGAATAATGTGGG - Intronic
991057608 5:62336676-62336698 TAAAGAAAATAGAATAAGGATGG + Intronic
991721352 5:69496700-69496722 TGAAAAAAACAGGCTGAGGCTGG - Intronic
992279601 5:75161144-75161166 AGAAGAAGACAGAAAAAGGTGGG + Intronic
993454363 5:88110492-88110514 TGAAGCTAACAGACTGGGGTGGG - Intergenic
994185525 5:96810946-96810968 TGTAGAAAACAGACAAAAGCAGG + Intergenic
995066895 5:107872678-107872700 AGAAGGAAAGAGACGAAGGTAGG + Intronic
995088360 5:108141708-108141730 TGAAGCAAACAGGTTCAGGTGGG - Intronic
995702735 5:114954545-114954567 AGAAGAAAACAGAAAAATGTGGG + Intergenic
998350055 5:141494680-141494702 AGAAGAAAACGGACTAAGAGGGG - Intronic
998490873 5:142545226-142545248 TGAAGACAACAGACTAAATAAGG - Intergenic
999863031 5:155668850-155668872 GGAAGAAAACAGACTATGAATGG - Intergenic
999982281 5:156969115-156969137 TGAAGAAAACAGGCAAAGTGAGG + Intergenic
1000526939 5:162369868-162369890 TGAAGAATACAGAAAAATGTGGG - Intergenic
1000656700 5:163887956-163887978 TTAAGAAAACAGAAAATGGTAGG - Intergenic
1001147796 5:169200042-169200064 TGATGAAGACAGACTCAGGTAGG - Intronic
1001593552 5:172882894-172882916 TGAAGACAACAGGCTAAGTGGGG + Intronic
1002987261 6:2202588-2202610 TGATGGAAACTGAGTAAGGTGGG + Intronic
1003360640 6:5421860-5421882 AGAAGAAAACAGAAAAATGTGGG - Intronic
1003945280 6:11069947-11069969 AGCATAAAACAGACTAAGATAGG - Intergenic
1003963953 6:11235583-11235605 GGAGGAAAACAGACCAGGGTGGG + Intronic
1004620597 6:17327147-17327169 TGAAGGAAAAAGAAAAAGGTGGG + Intergenic
1005168773 6:22957184-22957206 TGAAGAAATCCGTCTGAGGTAGG + Intergenic
1005971653 6:30766505-30766527 TGAAGAAAACAGGATAGGGAAGG + Intergenic
1006791294 6:36702996-36703018 AGTACAAAACAGACTAAGGCAGG - Intronic
1007995912 6:46307726-46307748 TGATGAAAATAGAGTAAGGAAGG + Intronic
1009655235 6:66535836-66535858 TGAATACAACAGCCTAATGTGGG - Intergenic
1009669761 6:66731771-66731793 TGGAGAAAACAGAATTAGATTGG - Intergenic
1010555475 6:77274210-77274232 AGAAGAAGACAGACAAATGTGGG + Intergenic
1010555488 6:77274308-77274330 AGAAGAAGACAGACAAATGTGGG + Intergenic
1013905663 6:115214982-115215004 TGAAGCAATCAGACTAATTTAGG - Intergenic
1015439550 6:133232460-133232482 AGCACAAAACAGACTAAGATAGG - Intergenic
1017224973 6:152010482-152010504 GGAAGGAAACAGACTATGATGGG + Intronic
1020848423 7:13317279-13317301 TGAAGTAAACAGAGGAAGGGAGG + Intergenic
1021079208 7:16343426-16343448 TGAAAAAAGCAAAATAAGGTTGG + Intronic
1021713824 7:23442686-23442708 TGAAAAAAACAGACTGGGCTCGG - Intronic
1021881341 7:25098031-25098053 TGAAGAAATCAAAAAAAGGTTGG - Intergenic
1021908504 7:25360661-25360683 TTAAGAAAACACACTTAGGAAGG + Intergenic
1023355068 7:39358278-39358300 TGAAGGAAAAAGAATAATGTGGG + Intronic
1024550682 7:50560340-50560362 TGAAGAAAACAGGCTGTGGAGGG + Intronic
1024687078 7:51757702-51757724 ATAAGAAAACAGATTAAAGTAGG - Intergenic
1024769418 7:52701406-52701428 TAAACAAAACAGACTAAGACTGG + Intergenic
1024973930 7:55096227-55096249 TGAAGAGAAAAGGCTTAGGTGGG - Intronic
1025033468 7:55575558-55575580 TGTAGAAAACAGACTAGGGCAGG + Intergenic
1025275458 7:57578694-57578716 TGAAGAAAACAGTTTTTGGTTGG - Intergenic
1025696530 7:63779135-63779157 TGAAGAAACTAAAGTAAGGTGGG + Intergenic
1025913309 7:65845496-65845518 TGAAGAAACTAAAGTAAGGTGGG + Intergenic
1026077997 7:67190972-67190994 TGATGCAAACAGACTAAGATGGG - Intronic
1027141200 7:75658943-75658965 GGAAGAAAGCAAACTAAGGCAGG + Intronic
1027499220 7:78927132-78927154 TGATGAAAAGAGACTGAAGTTGG + Intronic
1028551817 7:92076573-92076595 TCAGGAGAAGAGACTAAGGTAGG + Intronic
1028927819 7:96378874-96378896 TGGAAAAAATAGAATAAGGTAGG - Intergenic
1029948394 7:104557100-104557122 AGAAGAAAACAGTCAAATGTTGG - Intronic
1030281897 7:107784726-107784748 TGAAGAAAAGAGAACAAGGACGG - Intronic
1030863907 7:114674182-114674204 TTTAGAAAATAGACTAAGGGAGG + Intronic
1032373805 7:131388397-131388419 TTAAGCCAACAGAGTAAGGTTGG + Intronic
1032888906 7:136172169-136172191 TGTAGAAAACAGATAAATGTGGG + Intergenic
1034001211 7:147415208-147415230 TTAATAAGACAGACCAAGGTGGG - Intronic
1034718464 7:153265184-153265206 TGAAGAAAACAGAAAAATGTGGG - Intergenic
1036978021 8:13436639-13436661 TGCAGAAAACAGACGAACGGAGG + Intronic
1037137965 8:15486086-15486108 TAAAGACAACAGAGTAAGCTGGG - Intronic
1037565365 8:20113268-20113290 TTAAGAAAACAGAATAGGCTGGG - Intergenic
1039500443 8:38012345-38012367 TGAAGAAAACAGAAAAGGGCCGG + Intergenic
1039680361 8:39728761-39728783 AGAAGGAAACAAAATAAGGTTGG - Intronic
1039942943 8:42106936-42106958 GGGAGAAAAAAGACAAAGGTTGG + Intergenic
1041282763 8:56228226-56228248 TGAAGAATATAGGCTAGGGTGGG + Intergenic
1041407243 8:57513545-57513567 AGAAAAAAGCAGACTAAGGTCGG - Intergenic
1041664676 8:60430864-60430886 TTAAAAAAACAGACAAAGGCTGG - Intergenic
1042079139 8:65030831-65030853 TGAGGAAATAAGACTCAGGTAGG - Intergenic
1042994614 8:74681834-74681856 AGAAGAAAACAGGCTAATATAGG + Intronic
1043031148 8:75135071-75135093 TGAAGGAAACAGATTGAGGAGGG - Intergenic
1044111491 8:88280877-88280899 TGAAAAAAACAGAGTGAGATGGG - Intronic
1045199309 8:99963194-99963216 TTATGAAAATGGACTAAGGTAGG - Intronic
1045662456 8:104452328-104452350 TGAAGAAAACAGAGACAGGAGGG + Intronic
1046173899 8:110549554-110549576 TAAAGAAAACAGAGTACTGTGGG + Intergenic
1046883906 8:119341208-119341230 GGAAGGAAACAGACTGAGCTCGG + Intergenic
1047923688 8:129661190-129661212 TGGAAAATTCAGACTAAGGTAGG + Intergenic
1048653357 8:136506020-136506042 CCAAGAAGACAGAGTAAGGTGGG + Intergenic
1049948533 9:621974-621996 AGAAGAAAAGATACTAAGTTTGG + Intronic
1051477996 9:17529903-17529925 TGAAAAAAACAAGCTAATGTGGG + Intergenic
1051914396 9:22190947-22190969 TGAACAACACACACTGAGGTGGG + Intergenic
1053056651 9:34996950-34996972 GGAAGGAAATAGACTGAGGTGGG - Intronic
1053631945 9:39950911-39950933 TGAAGAAAATAAAGTAAGGCAGG - Intergenic
1054211942 9:62299787-62299809 TGAAGAAAATAAAGTAAGGCAGG + Intergenic
1054313044 9:63549042-63549064 TGAAGAAAATAAAGTAAGGCAGG - Intergenic
1055222915 9:73959594-73959616 AGTAGAAAACAAACTTAGGTTGG - Intergenic
1055268583 9:74528875-74528897 TGAGGAAATGAGACTAAGGTAGG + Intronic
1057912739 9:99033115-99033137 GGCAGAAAACAGACTCAGGCAGG - Intronic
1059774436 9:117461521-117461543 TGAAGAAAACAATATAAGCTGGG + Intergenic
1060465387 9:123899768-123899790 TGAGGAAGTCAGACCAAGGTAGG + Intronic
1060937378 9:127523503-127523525 TCAAGAAAGAAGACTAAGGGTGG + Intronic
1061687919 9:132298551-132298573 TGAAGAAAGCACACAAAGGGAGG + Intronic
1061978483 9:134085966-134085988 AGCAGAAAACAGACTAATGCAGG + Intergenic
1203626676 Un_KI270750v1:32194-32216 TGAAGAAAACAGTTTTTGGTTGG - Intergenic
1185547478 X:956977-956999 TCAAGAAACCAGAAAAAGGTAGG - Intergenic
1185950735 X:4430378-4430400 TTAAGAAAACTGACTAACGTTGG - Intergenic
1186054237 X:5632043-5632065 TGTAGAAAACAGACTACGAAGGG - Intergenic
1186340297 X:8638183-8638205 TGAAGAAAACAAACTACTCTAGG - Intronic
1186588658 X:10904214-10904236 TGAAGAGAACAGACTGTGGTGGG + Intergenic
1186738347 X:12490392-12490414 AGAAGAAAAAAGTCTAAGTTAGG + Intronic
1186790362 X:12991478-12991500 TAATGGTAACAGACTAAGGTGGG + Intergenic
1187200451 X:17129243-17129265 TGTGGAAAGCAGAATAAGGTGGG - Intronic
1187611001 X:20942760-20942782 TGAATAAAACAAAATAAGCTTGG - Intergenic
1187770059 X:22685587-22685609 TGAAGAATACACACTGGGGTTGG + Intergenic
1187815240 X:23224672-23224694 TGAAGAGAACTGGCTCAGGTTGG - Intergenic
1188845303 X:35065096-35065118 TGTAGCAAGCAGTCTAAGGTAGG - Intergenic
1188976276 X:36679836-36679858 TGAAAAAAACAGACATGGGTTGG + Intergenic
1189192787 X:39125228-39125250 TGAAGAAAATAGAGCAGGGTAGG + Intergenic
1189634050 X:42986085-42986107 TGAAGAATACATACTCATGTTGG - Intergenic
1190690595 X:52910061-52910083 GGAAGGACACAGACTAAGATGGG - Intergenic
1190695388 X:52945731-52945753 GGAAGGACACAGACTAAGATGGG + Intronic
1191020333 X:55852347-55852369 TTTAGAAAAAAAACTAAGGTGGG + Intergenic
1191143503 X:57139796-57139818 TGAAGAAAAAGAACTAAGCTGGG - Intergenic
1191791761 X:64978614-64978636 GGAAGAAAACTGACTCAGATAGG + Intronic
1191882724 X:65858585-65858607 AGAAAAAAACAGACTATGGCTGG - Intergenic
1192856628 X:75018954-75018976 TGAAGAAGACAGGCAAATGTGGG - Intergenic
1193785758 X:85757865-85757887 TGAAAAAAAAATACAAAGGTGGG - Intergenic
1194319614 X:92428377-92428399 TGAAGATAATAGAGTAAGGCAGG + Intronic
1194607088 X:95994214-95994236 TGAATAAAACAGACTGATTTTGG + Intergenic
1194773571 X:97934909-97934931 TGAAGAAAACACCCTGGGGTTGG - Intergenic
1195167764 X:102237204-102237226 AGTAGAAAACAGACTATGGCAGG + Intergenic
1195191093 X:102449883-102449905 AGTAGAAAACAGACTATGGCAGG - Intronic
1196099744 X:111835412-111835434 TGAAGACAAAAGACAAAGTTTGG - Intronic
1197362443 X:125522424-125522446 TGATGGAAACAGACTAAGAAGGG - Intergenic
1197383514 X:125775154-125775176 CGAAGAAAACACTCAAAGGTGGG + Intergenic
1197900444 X:131366070-131366092 TGAAGAAAAGTGACCAAGGGAGG + Intronic
1198387790 X:136146087-136146109 TGAAGAAATCAAAATAAGATTGG + Intergenic
1198993626 X:142546714-142546736 TTAAGCAAAAAGACTTAGGTTGG - Intergenic
1199388281 X:147248714-147248736 AGAAGAAAAGAAACTAAGGGAGG + Intergenic
1200627740 Y:5541458-5541480 TGAAGATAATAGAGTAAGGCAGG + Intronic
1201737279 Y:17281845-17281867 TTAAGAAAACTGACTAACGTTGG - Intergenic