ID: 1122244414

View in Genome Browser
Species Human (GRCh38)
Location 14:100391870-100391892
Sequence CCTTCTCTCCTGAGTGTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122244411_1122244414 -10 Left 1122244411 14:100391857-100391879 CCTTTTCCATTCTCCTTCTCTCC 0: 1
1: 1
2: 22
3: 275
4: 2124
Right 1122244414 14:100391870-100391892 CCTTCTCTCCTGAGTGTACATGG 0: 1
1: 0
2: 1
3: 11
4: 150
1122244410_1122244414 5 Left 1122244410 14:100391842-100391864 CCTAGGAGTTATTTGCCTTTTCC 0: 1
1: 1
2: 3
3: 30
4: 359
Right 1122244414 14:100391870-100391892 CCTTCTCTCCTGAGTGTACATGG 0: 1
1: 0
2: 1
3: 11
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122244414 Original CRISPR CCTTCTCTCCTGAGTGTACA TGG Intronic
900631939 1:3641189-3641211 CCTTCCCTCCTGAGTGCTCTGGG - Intronic
903406493 1:23101649-23101671 CCTTCTCCCCAGAGTAAACAAGG + Intronic
905220897 1:36446550-36446572 CCTTTCCTCCTGAGAATACAGGG + Intronic
906657283 1:47557749-47557771 CCTTCTCCCCAGACTGTACTGGG + Intergenic
907897472 1:58705248-58705270 CCTTTTCTCCTAAAAGTACAAGG + Intergenic
908792229 1:67794264-67794286 CCATCTCTCCTGAGCTCACAGGG - Intronic
916434539 1:164765520-164765542 CCTTCTCTCCTGTGTTTACTAGG - Intronic
919406575 1:197191858-197191880 GCTTCTCACCTGTGTGAACACGG + Exonic
1065788684 10:29240115-29240137 CCTTCTTTCCTGCGGGTCCAGGG - Intergenic
1068099631 10:52535649-52535671 GGTTCTCTCCTGTGTTTACAGGG + Intergenic
1069331762 10:67301385-67301407 CCTTCCCACCACAGTGTACAAGG - Intronic
1069601443 10:69710767-69710789 TCTTCTCTTCTGAGTGAAAAAGG + Intergenic
1070379454 10:75867523-75867545 CCTTCCCTACTGTGTCTACATGG - Intronic
1073068501 10:100778727-100778749 CCTTCTCCCCAGGATGTACAGGG + Intronic
1073565960 10:104535916-104535938 CCCCCTCTCCTCTGTGTACATGG + Intergenic
1073721257 10:106175110-106175132 CCTTCTCAACCAAGTGTACATGG - Intergenic
1074790887 10:116886953-116886975 CCTTCCCTCCTGTGTGTCCCTGG + Intronic
1075857224 10:125640013-125640035 CCTTCTCTGCTGAGAACACATGG - Intronic
1076178150 10:128384559-128384581 CCCTTTCCCCTGAGTGGACATGG - Intergenic
1076514089 10:131033429-131033451 CCGTCTCTCCTGGGAGCACATGG + Intergenic
1077159375 11:1105743-1105765 ACTTGTCTCCTGGGTGTCCATGG + Intergenic
1079156599 11:17953857-17953879 TCCTCTCTTCTGAGTGTTCATGG + Intronic
1079172910 11:18113075-18113097 ACCTCTCTCCTGACTGTCCAAGG + Intronic
1080660084 11:34288752-34288774 ACTCCTCTCCTGGGTGCACAAGG + Intronic
1080924603 11:36743237-36743259 CATTCTCTCATGAGTGAATAGGG + Intergenic
1083592851 11:63905350-63905372 CCTTCTCTCCTGGGTTCCCATGG + Intronic
1084303684 11:68267542-68267564 CCTTATCTTCTGAGTGGACTGGG - Intronic
1084937551 11:72595231-72595253 CCTTCTCTGCTGAGGGCAAAGGG - Intronic
1085193379 11:74648935-74648957 TCTCCTCTCCTGAGTTTCCAAGG - Intronic
1091128671 11:133124933-133124955 ACTTCTTTCCTGTGTGTACTTGG + Intronic
1094797070 12:33986849-33986871 CCTTGGCTCCTGAGTGAATAAGG - Intergenic
1095887865 12:47207488-47207510 CTTTCTCTCCTGATAGGACAAGG + Intronic
1102367483 12:112351264-112351286 CCTTGTCTCCTTTGTGCACAGGG - Intronic
1102444010 12:112987425-112987447 TCTTCTCTCCTGAGGGTCTATGG - Intronic
1102669937 12:114609620-114609642 CATTCTCACCAGAGTGCACAAGG + Intergenic
1104960280 12:132485302-132485324 CCTGCTCCCCTGGGTGAACAGGG + Intergenic
1106514755 13:30444115-30444137 ACTTCTCTCCTGAGGCTATAGGG - Intergenic
1108574410 13:51779130-51779152 CATTCTTTCCTCAGTGAACATGG + Intronic
1108857768 13:54816655-54816677 CTTTCTCTAGTCAGTGTACATGG - Intergenic
1111572849 13:90109175-90109197 TCTTTTCTCCTCAGTGTACCGGG + Intergenic
1112308450 13:98296451-98296473 CGTTCTCGCCAGAGTGGACATGG + Intronic
1116888424 14:50242903-50242925 CCATGTCTCCTGTGTTTACAGGG + Exonic
1117222461 14:53619739-53619761 CCTTCTCAGTTGAGTCTACATGG - Intergenic
1121034519 14:90689538-90689560 ACTTCTCTCCTGAGTAGACACGG + Exonic
1122244414 14:100391870-100391892 CCTTCTCTCCTGAGTGTACATGG + Intronic
1122410577 14:101523844-101523866 CCTTCTCCACATAGTGTACAGGG + Intergenic
1123203572 14:106691573-106691595 CCTGCTGTCCTGAGTGTCCCTGG + Intergenic
1126112006 15:45180896-45180918 CTTCCTCTCCTGAATGAACAAGG - Intronic
1129613587 15:77081275-77081297 CCTTCTCCCCTCAGGTTACAGGG - Intronic
1132667404 16:1088442-1088464 CCTTGTCTCCTAAGTGGCCAGGG + Intergenic
1137773484 16:51036911-51036933 CTTTCCCTCCTCAGTGGACATGG + Intergenic
1141421236 16:83917899-83917921 GGTTCTCTCCTGTGTGGACAGGG + Exonic
1141642958 16:85352164-85352186 CCTCCTCCCCTGAGTCTACCAGG + Intergenic
1144303653 17:13947618-13947640 CCTTCCCTCCTCAGTCTACGTGG + Intergenic
1144362579 17:14509229-14509251 CAGTCTCTGCTTAGTGTACAGGG + Intergenic
1148000646 17:44385277-44385299 CCTACTCGCCTGAGTGACCACGG + Exonic
1148895243 17:50835693-50835715 CTCCCTCTCCTGAGTGTGCAGGG - Exonic
1149924321 17:60687856-60687878 TCCTCTCTCCTTAGTGGACATGG - Intronic
1153012183 18:549163-549185 CCTTCTATCCTCAGTGCTCAAGG + Intergenic
1153582769 18:6591764-6591786 ACTTCTCCTCTGAGTGTTCAGGG - Intergenic
1154228278 18:12528510-12528532 CCTTCATTCCTGAATGTCCAGGG - Intronic
1155149063 18:23108084-23108106 CGTTCTCTCCTGAGAGTAGAGGG - Intergenic
1156354575 18:36330079-36330101 GATTCCCTCCTGGGTGTACAGGG - Intronic
1158626466 18:59075990-59076012 CCTTCACACCTGAGTGTTCCTGG - Intergenic
1160690663 19:459518-459540 CCTTCTCAACTCAGTGTAGAGGG + Intronic
1160690690 19:459634-459656 CCTTCTCAACTCAGTGTAGAGGG + Intronic
1161920360 19:7261220-7261242 CCCCCTCTTCTGAGTGTACTTGG + Intronic
1163716279 19:18874240-18874262 TCTTCTCTCCTGAGGGTTCCTGG - Intronic
1165159200 19:33805883-33805905 CCTTCTCCCCGGAGTGGACAGGG + Intronic
1167030495 19:46956340-46956362 CCTTCTATGCTGTGTGTATAAGG + Intronic
1168148488 19:54432479-54432501 CCCTCTCTCCTCAGTGTGCATGG - Intronic
1168162991 19:54524774-54524796 CATACTGTCCTGAGTGTACGTGG + Intergenic
925266733 2:2571264-2571286 CCTTCCTTCCTGAGGGTACCTGG - Intergenic
927889789 2:26741199-26741221 CCCTCTCTCCTGAGTGCATGAGG + Intergenic
931175000 2:59845547-59845569 CCTCCTCTTCTGAGTGTGTAAGG - Intergenic
932931283 2:76042469-76042491 CTTTCTCTCCAGAGTTTAGAAGG + Intergenic
935279437 2:101504822-101504844 CCCTCTCTCCCGAGTGGCCAGGG + Intergenic
935333920 2:101997635-101997657 CATTCTCTCCTGGGAGTGCAGGG + Intronic
939096876 2:137842400-137842422 ACCTCTGTCCTGAGTTTACATGG + Intergenic
940427447 2:153546087-153546109 GCTTATCTCCTGAGGGTGCAAGG - Intergenic
942129711 2:172866072-172866094 CCTTCTCATCTGAGTGTACATGG + Intronic
942508498 2:176669999-176670021 CCTGCTCTCCTGAAAGTAAATGG - Intergenic
944452950 2:199861643-199861665 CCTTCTTTGCTGATTGTACATGG - Intergenic
945813548 2:214576383-214576405 CCCTCTTTCCTTAGTCTACAGGG - Exonic
946365988 2:219249419-219249441 CCTACTCTGCTGAGTAAACAGGG + Exonic
947226150 2:227842278-227842300 CCCTCTCTCCTGATTGGCCAAGG - Intergenic
1169454421 20:5739461-5739483 GCCTCTCTCCTGAGTCTATATGG + Intergenic
1171246400 20:23613409-23613431 GCTTCTCATCTGAGTGTCCATGG - Intergenic
1173470019 20:43316284-43316306 CCTCCTCTCCTGACTCTAGATGG - Intergenic
1175378075 20:58542942-58542964 GCTGCTCTCCTGCGTGTCCACGG - Intergenic
1176970855 21:15263885-15263907 GCTTCTCTCCTGATTTTCCAAGG + Intergenic
1177700829 21:24637052-24637074 CCTTCTCTCCTGACTTTTCCAGG + Intergenic
1178523751 21:33307101-33307123 CCTTCTCTCCTCATTCTGCAGGG + Intergenic
1180869441 22:19138065-19138087 CCTGGTCTCCTGTCTGTACAAGG - Intronic
953932834 3:47014553-47014575 CTTTCTCTCCTGATTCTTCAGGG - Intergenic
954375537 3:50192409-50192431 CCATCTCTCCTCAGTGCCCATGG - Intronic
956397504 3:68841428-68841450 CCTTCTTTCCTGACAGGACAAGG + Intronic
958178977 3:90033124-90033146 CCTTCTCCCCAGTGTCTACACGG + Intergenic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
964964973 3:162481431-162481453 CCTTGGCTCTTGAGTGAACATGG - Intergenic
967284282 3:187853423-187853445 CCTTCCCTTCTGAATCTACAAGG + Intergenic
968869892 4:3236493-3236515 CCATCTCTCCTGAGGGCTCAGGG + Intronic
969174842 4:5390587-5390609 CCTTCTCCTCTGTGTGTACCTGG + Intronic
969197505 4:5574676-5574698 CCTTCTCACCTGGCTGCACAGGG + Exonic
969314599 4:6374140-6374162 CTCTCTCTCCTGAGAGTCCAGGG - Intronic
971415651 4:26425971-26425993 CCCTCTGTCATGATTGTACAAGG + Intronic
977977083 4:103278276-103278298 CCTTATCTCCTGCGGCTACAGGG - Intergenic
978478061 4:109154877-109154899 TCTTCTTTCCTTAGTGGACAAGG + Intronic
981291523 4:143082170-143082192 CTTTCCCTCCTGAATGTAGATGG - Intergenic
981320812 4:143388994-143389016 CCTTCTCTGCAGAGTGGACTGGG - Intronic
985828137 5:2207905-2207927 CCTTCTTTCCAGAGTGAACTTGG + Intergenic
988285415 5:29209624-29209646 AGTTTTCTGCTGAGTGTACAGGG - Intergenic
992052222 5:72951703-72951725 TCTTCTCTCCTAAGTGCACCTGG - Intergenic
992614181 5:78533995-78534017 CCTGCTCTCCTGAGTGGTCCGGG - Intronic
992643349 5:78789072-78789094 CCTACTCTCTTGACTGCACAAGG + Intronic
996615483 5:125436216-125436238 CATTATCTGCTGGGTGTACAGGG - Intergenic
996828818 5:127716874-127716896 CCTTCTCTCCTTACTTTATAGGG + Intergenic
998470823 5:142382530-142382552 CCTTCTGTCCTGAGTGTTCCAGG + Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
1002852751 6:1010971-1010993 GCTTTTCTCCTCAGTGTACAAGG + Intergenic
1003037899 6:2661309-2661331 CATGGTCTCCTGAGTGCACAAGG + Intergenic
1003344576 6:5255256-5255278 CATTCTCTCATGAGTATACAGGG + Intronic
1005419644 6:25635605-25635627 TCTTCTATTCTGAGTGCACACGG - Intergenic
1008362849 6:50642351-50642373 CCTGCACTCCTGAGTTTATAAGG + Intergenic
1010765799 6:79776485-79776507 TCTTCTCTCCTCTGTGCACATGG + Intergenic
1013426186 6:110015071-110015093 CCTCTTTTCCTGAGTGTATAAGG + Intergenic
1015961527 6:138654773-138654795 TCTTTTCTCCTCAGTATACATGG - Intronic
1018827275 6:167418265-167418287 TCTTCTCTCATGAGTGGCCAAGG - Intergenic
1018994365 6:168700015-168700037 CCTGTTCTCCTGAGTTTTCAAGG + Intergenic
1021601271 7:22366178-22366200 CATTCTCTCGTAAGTATACATGG + Intergenic
1021715200 7:23455378-23455400 TCTTCCCTCCTGGGTGCACACGG + Intronic
1021852919 7:24826181-24826203 CCTTCTTTCCTTACTGTTCAGGG - Intronic
1023521066 7:41050369-41050391 CCATCTGTCCTTGGTGTACATGG + Intergenic
1030099419 7:105932411-105932433 CCTCCTCTCCTGTCTGTGCATGG + Intronic
1031139477 7:117926267-117926289 CCTTCCCTCCTGAGTCCCCAAGG - Intergenic
1033355516 7:140595895-140595917 CTGTCTCTCCTGAGTGGCCACGG + Intronic
1033848356 7:145463091-145463113 CCTACTCTGCTGAGTAAACAGGG + Intergenic
1034401506 7:150864543-150864565 CCCTCTCACGTGAGTGTACGTGG - Intergenic
1034906824 7:154956450-154956472 TCTTCTTTCCAGACTGTACATGG - Intronic
1036800071 8:11784235-11784257 TCTTCGCTCCTGAGTGCACAGGG - Intronic
1039373442 8:37010165-37010187 ACTTCTCTCCTGGGTGTGGAAGG - Intergenic
1044319492 8:90786544-90786566 CCTACTCTCCTTAGTCTTCATGG - Intronic
1045204561 8:100024502-100024524 CCTTCAGTCCTGAGCATACAAGG + Intronic
1046065529 8:109192330-109192352 CCTTTGCTCCTGAGAGTGCAGGG + Intergenic
1046418705 8:113949447-113949469 CCTTTTCTCATGAGTATGCAAGG - Intergenic
1048930305 8:139309848-139309870 GCTTCTCCCCTGAGTTTCCATGG + Intergenic
1049880693 8:145060361-145060383 CTTTCTCTCCTGAATATGCACGG - Intergenic
1052791243 9:32877267-32877289 TCTTGTCTCCTGAGTCTCCAGGG - Intergenic
1054917874 9:70512304-70512326 CATTCTCTCATGAATGTATAGGG + Intergenic
1056845486 9:90033645-90033667 ACTTCTGTCCTAAGTGTATATGG + Intergenic
1058176717 9:101743911-101743933 CATTATCTGATGAGTGTACAGGG + Intergenic
1058973141 9:110101306-110101328 ACTCCACTCCTGAGTGTCCAAGG + Intronic
1059387904 9:113979309-113979331 CATTCTCTCTTGAGGGTGCAGGG - Intronic
1060469650 9:123937716-123937738 CCTCTTCTCCTGACTATACATGG + Intergenic
1061493113 9:130957093-130957115 CCTCCTCTCCTGAGAGGCCAGGG - Intergenic
1061716464 9:132521405-132521427 GCTTCTCTACTGAGTGCAGACGG + Intronic
1185557003 X:1029453-1029475 ATTTCTCTCCTGGGTGTCCAAGG + Intergenic
1187134771 X:16536869-16536891 CCTCCTCTCCTGTCTGTACAAGG + Intergenic
1187561182 X:20405178-20405200 TCTTCTCTCCTGCATCTACATGG - Intergenic
1188489512 X:30722842-30722864 CCTTCTCTCCTGGGTGTTGCAGG + Intronic
1195799163 X:108687643-108687665 TTTTCTCTCCTGTATGTACAAGG + Exonic
1196534829 X:116831278-116831300 ACTTCTCTACTTAGAGTACAGGG - Intergenic
1198881188 X:141282952-141282974 TCTTCTCTGCTTATTGTACAAGG - Intergenic