ID: 1122245914

View in Genome Browser
Species Human (GRCh38)
Location 14:100403417-100403439
Sequence TGGGACTCCTGGGAAGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 1, 2: 0, 3: 37, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122245908_1122245914 -1 Left 1122245908 14:100403395-100403417 CCTTTGGAATTATTGGGATCGTT 0: 1
1: 0
2: 1
3: 7
4: 73
Right 1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG 0: 1
1: 1
2: 0
3: 37
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122245914 Original CRISPR TGGGACTCCTGGGAAGGAAC TGG Intronic
900321834 1:2088329-2088351 TGAGACTGCAGGGGAGGAACAGG - Intronic
900543103 1:3213825-3213847 AAGGCCTCCTGGGAAGGCACCGG - Intronic
900673520 1:3870151-3870173 AGGGACACCTGGGAAGGCAGCGG - Intronic
901865689 1:12105276-12105298 TGGGACTCCAGAGAAGGACCTGG - Intronic
903237811 1:21961785-21961807 TGGGGTTCCTGGACAGGAACAGG + Intergenic
903299948 1:22371718-22371740 AGGGTCTCCTGGGAAGGCAGTGG - Intergenic
903653291 1:24933795-24933817 GAGGCCTCCTGGGAAGGAAACGG - Intronic
903744479 1:25577393-25577415 AGGGCCACCTGGTAAGGAACAGG - Intergenic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
904256391 1:29257562-29257584 TGGGTCTCTGGGGAAGGGACAGG + Intronic
904601161 1:31673262-31673284 AGGGGCTCCTGGGAAGGGCCTGG - Intronic
904633840 1:31864262-31864284 TGGTACTCCTGGGAAGGAGTGGG + Intergenic
905912830 1:41665345-41665367 TGGGGCTGATAGGAAGGAACTGG - Intronic
906520927 1:46466534-46466556 GGGGGCGCCTGGGAAGGAGCGGG - Intergenic
906670273 1:47649174-47649196 TGGGACTCTTGTGAAGGAGATGG + Intergenic
907512498 1:54972386-54972408 TGGCCCACCTGGGAAGGGACTGG + Intergenic
908406281 1:63817139-63817161 TGTGTCTTCTGGGAGGGAACTGG + Intronic
908828019 1:68152131-68152153 TGGGGATCCTGGGAGGGAATAGG + Intronic
909794064 1:79711376-79711398 TGGAATTCCTGGGTAGGAAATGG + Intergenic
910369325 1:86499098-86499120 AGTGACTCCTGGGGAAGAACTGG + Intronic
912091254 1:106079571-106079593 TGTGACTCCAGGGAAGGGAGAGG - Intergenic
912820517 1:112864086-112864108 TGTGACTAGTGGGAAGGAAGAGG + Intergenic
918040004 1:180908226-180908248 TGGGAATCCTGGAAGGAAACAGG + Intergenic
920124456 1:203682548-203682570 GGGGCCTCCCAGGAAGGAACGGG + Intronic
920317783 1:205091375-205091397 TGGGACTTTTGGGAAGGACCAGG - Intronic
920720433 1:208381810-208381832 TGGGTCTCATGGAAAGGAAGGGG - Intergenic
922120608 1:222664020-222664042 AGGGACTCCTGGGAAAGGAGGGG - Exonic
922125001 1:222712982-222713004 TGAGACTCCGGGGAAGTAGCGGG - Intronic
922657450 1:227398506-227398528 TGGTACACCTGGGCAGGAACAGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063641583 10:7835922-7835944 GGGGAATCCTGGGAAGAAAGTGG - Intronic
1064136369 10:12754227-12754249 AGGGACTCCTGGGATGGGGCAGG - Intronic
1064390071 10:14934570-14934592 TGGGACTGTTGGGAAGGAAAAGG - Intronic
1064400504 10:15017094-15017116 TGGGACTGTTGGGAAGGAAAAGG - Intergenic
1065921572 10:30397955-30397977 TGAGGCTCCTGGGAGGGAACAGG + Intergenic
1067495822 10:46759179-46759201 CGTGACTCCTGTGAAGGATCAGG + Intergenic
1067598833 10:47581211-47581233 CGTGACTCCTGTGAAGGATCAGG - Intergenic
1067723708 10:48750302-48750324 TGGGAATCATGGGAAAGCACTGG - Intronic
1067837804 10:49652362-49652384 TGGGAAGACTGGGGAGGAACAGG - Intronic
1070820795 10:79352998-79353020 TGGGGCACCTGGGGATGAACTGG + Intronic
1070984886 10:80680133-80680155 TAGTACACCTGGGAAGGGACTGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071691692 10:87826753-87826775 TGGGACTCTTGGAAATAAACAGG + Intronic
1072550552 10:96474118-96474140 TGGGAGTCCTGGGCAGGCATTGG - Intronic
1072711664 10:97719571-97719593 TGAGACTACTGGGAAGGGGCTGG - Intergenic
1073896399 10:108165035-108165057 TTGGAGTCATGGGAAGAAACAGG - Intergenic
1074193252 10:111156417-111156439 GGGCAAGCCTGGGAAGGAACAGG - Intergenic
1074353314 10:112759043-112759065 GGGGAGGCCTGGGAGGGAACAGG - Intronic
1075922889 10:126227744-126227766 TGGGGTCCCTGGGAAGGAAAAGG - Intronic
1076612976 10:131737889-131737911 TGGCACACATGGGAAGGACCTGG + Intergenic
1077114949 11:879940-879962 TGGGAATCCTGGGAAGGCTCTGG - Intronic
1077329974 11:1979907-1979929 TTGGACTCTTGGGAAGAAGCTGG + Intronic
1077435793 11:2538590-2538612 TGGGAATCCTGGGCTGGAACCGG + Intronic
1077435803 11:2538630-2538652 TAGGAATCCTGGGCTGGAACCGG + Intronic
1077709265 11:4519676-4519698 TGCAACTCTTGGGAAGTAACTGG - Intergenic
1077942391 11:6856831-6856853 TTGGAATCCTGTGAATGAACGGG - Intergenic
1078194533 11:9124637-9124659 TGACTCTCCTGGGAAGGACCTGG - Intronic
1079003022 11:16773560-16773582 GGGGGCTCCTGGGAATGACCAGG + Intergenic
1080609496 11:33891884-33891906 AGGGCCTCCCGAGAAGGAACAGG - Exonic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081794557 11:45810641-45810663 AGGGAGGCCTGGGGAGGAACGGG + Intronic
1082029408 11:47593889-47593911 TGGGACTTCTTGGAAGGATGAGG - Intronic
1082822050 11:57550677-57550699 GGGGACTCCAGGGCAGGAGCTGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084044796 11:66562334-66562356 TGGGACTCCTGGGAAGGAGCTGG - Intronic
1084483816 11:69436760-69436782 TGAGGCTGCGGGGAAGGAACTGG - Intergenic
1084647932 11:70471460-70471482 AGGGACTCCGGGGAAAGAAAGGG + Intronic
1087820792 11:102709778-102709800 TGGGGCTTCTGGAAAGGGACTGG - Intergenic
1089680448 11:120116333-120116355 AGGGACGCCTGGGAAGACACAGG + Intronic
1089880284 11:121766683-121766705 CAGGACTCCTGGGAGGAAACCGG + Intergenic
1091188868 11:133672531-133672553 TGGGATTTCTGGGAAGACACAGG + Intergenic
1202812951 11_KI270721v1_random:35086-35108 TTGGACTCTTGGGAAGAAGCTGG + Intergenic
1091582070 12:1796271-1796293 TGGGACTGCTGGGAAGGCCGTGG - Intronic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1092672953 12:10883876-10883898 TGGGACTGCTGTGAAGGATGTGG - Intronic
1092676774 12:10929592-10929614 TGGGACTGCTGGGAAGGATATGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1097724644 12:63061230-63061252 TCGGACTCCTGGGCAGATACCGG - Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099070615 12:78041970-78041992 TGGGACGGCTGGGAAGGGAATGG - Intronic
1099446734 12:82761684-82761706 TGGGACTCCTGGAAATAAAGAGG - Intronic
1101323831 12:103697319-103697341 TTGCACTCCTGGGATGGAACTGG + Intronic
1102038939 12:109788338-109788360 TGGGTCTCCTCGGAAGGACGAGG + Intronic
1102564486 12:113786535-113786557 CAGGACTCCTGGGCAGGAAAGGG + Intergenic
1102723978 12:115042523-115042545 TGGATCTCCTGTGAAAGAACAGG + Intergenic
1103013118 12:117473119-117473141 TGTGGCTCTTGGGAAGGAGCAGG - Intronic
1103039598 12:117684291-117684313 TGGGAGTGCTGGGAAGGCAGGGG + Intronic
1103740096 12:123085249-123085271 GGGGGCTCCTGGGCAGGACCTGG + Intronic
1104480853 12:129106808-129106830 TGGGCCTCCTGGGCAGGAGAAGG - Intronic
1104745256 12:131206681-131206703 AGGGGCGCCTGGGGAGGAACAGG - Intergenic
1104789080 12:131470425-131470447 AGGGGCGCCTGGGGAGGAACAGG + Intergenic
1104832297 12:131761598-131761620 TGGCAGCCTTGGGAAGGAACTGG + Intronic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1104987015 12:132603016-132603038 TGGGAAGCCTGGGGAGGCACAGG - Intergenic
1107367350 13:39697049-39697071 AGGGAATGCTGGAAAGGAACTGG + Intronic
1108016253 13:46079634-46079656 TGGGATTGCTGGGATTGAACTGG + Intronic
1108708003 13:53007289-53007311 TGGGACACCTTGGGAGGCACAGG - Intergenic
1110375527 13:74789205-74789227 GGGGACTCGGGGGAAGGAATGGG - Intergenic
1111538646 13:89640035-89640057 TGGGCCTCCTAGGAAGGACTTGG - Intergenic
1111655010 13:91141172-91141194 TGGGAAATCTGGGTAGGAACTGG - Intergenic
1112635877 13:101217828-101217850 TGGGCATCTTGGGAAGGATCTGG + Intronic
1114652213 14:24292422-24292444 TGGGGCTCCTGGGAAGGACAGGG - Intronic
1117539569 14:56733471-56733493 TGGGACTCCTGGAGAGGCAGAGG - Intergenic
1117881379 14:60316524-60316546 TGGGGCCCCTGGGAAGGAGAGGG - Intergenic
1118772132 14:68949254-68949276 TGGGAGCCCTGGGGAGGCACGGG - Intronic
1119891803 14:78188365-78188387 TGTGATTCCAGGGAGGGAACTGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1122324048 14:100872094-100872116 TGGGACACCTGGGAGGGAGGAGG - Intergenic
1122540521 14:102495499-102495521 AGGGACTCCAGGGAAGGGAGGGG + Intronic
1123102649 14:105816136-105816158 TGGGACTCCTGCGCAGACACTGG + Intergenic
1123783070 15:23645836-23645858 TGGGCCTCCTGGGCAGGCAGGGG + Exonic
1124624116 15:31298494-31298516 AGGGACTCCTGGGTAGAATCAGG - Intergenic
1125198846 15:37080646-37080668 TGGGGCTCTGGGGAAGTAACTGG - Intronic
1126105058 15:45141960-45141982 GGGGTCTCCTGGGAAGGCAGAGG - Exonic
1127788000 15:62373081-62373103 AGGCCCTCATGGGAAGGAACTGG + Intergenic
1128529577 15:68434796-68434818 AGGGACTGGTGGGAAGGAATGGG - Intergenic
1129030920 15:72617009-72617031 TGAGGCTCCTGGGAGGGAACAGG - Intergenic
1129209464 15:74059217-74059239 TAAGGCTCCTGGGAGGGAACAGG + Intergenic
1129407499 15:75328956-75328978 AGGGGATCCTGGGAAGGAAGAGG + Intergenic
1129477758 15:75797544-75797566 TGAGGCTCCTGGGGGGGAACAGG - Intergenic
1129710276 15:77817267-77817289 TGGGCCACCTGGGGAGGAAGTGG + Intronic
1129835825 15:78704810-78704832 TGAGGCTCCTGGGGGGGAACAGG - Intronic
1130240576 15:82184557-82184579 TGGTCCTGCTGGGAAGGTACAGG - Intronic
1130511524 15:84593813-84593835 TGAGGCTCCTGGGAGGGAACAGG + Intergenic
1131921023 15:97328808-97328830 TGGGAATCAAGGGATGGAACAGG + Intergenic
1132701591 16:1224511-1224533 TGGGACCCCAGGGAAGGAGAGGG + Intronic
1133277587 16:4648082-4648104 TGGGAATTCTGAGAAGGAATAGG + Intronic
1133286513 16:4693302-4693324 TCGGCCTCCTGGGGAGAAACGGG + Intergenic
1133317820 16:4895025-4895047 TGGGACTTCTGAGGAGGGACTGG + Intronic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1134514603 16:14876558-14876580 TGGGAGTCCTCTGAAGAAACTGG + Intronic
1134702280 16:16275211-16275233 TGGGAGTCCTCTGAAGAAACTGG + Intronic
1134969550 16:18519439-18519461 TGGGAGTCCTCTGAAGAAACTGG - Intronic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1135680896 16:24455858-24455880 TGTGCTTCCTGGGAAGGAAGAGG - Intergenic
1136485791 16:30571116-30571138 TGGGAATCCTGGGAGAGAACAGG + Exonic
1139431161 16:66911745-66911767 TGTGACTCCTGGCAGGGATCGGG - Intronic
1139950230 16:70664869-70664891 TGGGCCTCCTGGGACTGACCTGG + Intronic
1140753414 16:78046295-78046317 TCGGCCTCCTGGAAAGGAAAGGG + Intronic
1140908237 16:79428434-79428456 TGGGACTCCAAGGGAGCAACAGG - Intergenic
1141314832 16:82951858-82951880 TGTGGCTCCTGGGAAAGAAATGG - Intronic
1141388961 16:83648483-83648505 TGGGACTTCTGGGAGGGAGGAGG - Intronic
1141836689 16:86545279-86545301 TGGGGCAGCTGGGAAGGAACAGG + Intronic
1144850023 17:18239325-18239347 TGGGAGCCCTGGGAAGGTCCTGG + Intronic
1146314481 17:31796440-31796462 AGGGATTCTTGGGGAGGAACTGG - Intergenic
1147392857 17:40121406-40121428 TGGGACTGCTGGGGAGGAGAGGG + Intergenic
1147398466 17:40163808-40163830 TGGCAGTCCTGAGAAGGAAGAGG + Exonic
1148229560 17:45923156-45923178 TAGGACTCCTGGCCAGAAACAGG + Intronic
1148534709 17:48429878-48429900 TGGGACTCCAGGGAGTGAAAGGG + Intronic
1148871059 17:50659001-50659023 TGGGACACCTGGGGAGGAGGAGG + Intronic
1150484243 17:65532944-65532966 TGGGAAACCTGGGACAGAACTGG + Intronic
1150714400 17:67559173-67559195 TGGGACTCAGGGGAAGGTGCGGG - Intronic
1152004225 17:77668109-77668131 AGGGACTCCTGTGGAGCAACAGG - Intergenic
1152203089 17:78958542-78958564 CCTGACTCCTGGGAAGGGACAGG - Intergenic
1152259938 17:79261442-79261464 TGGAGCTCCTTGGAAGGAGCCGG + Intronic
1152344153 17:79741569-79741591 AGGGATTCCTGGGAGGGCACAGG - Intronic
1152520118 17:80850836-80850858 TGGCACTCCAGGGCTGGAACTGG + Intronic
1152812912 17:82390754-82390776 GGTGACCCCTGGGAAGGAGCGGG - Intronic
1152812924 17:82390797-82390819 GGTGACCCCTGGGAAGGAGCGGG - Intronic
1152812936 17:82390840-82390862 GGTGACCCCTGGGAAGGAGCGGG - Intronic
1152812948 17:82390883-82390905 GGTGACCCCTGGGAAGGAGCGGG - Intronic
1154181269 18:12142044-12142066 TCAGAGTACTGGGAAGGAACAGG - Intergenic
1154182635 18:12149540-12149562 TCAGAGTACTGGGAAGGAACAGG + Intergenic
1154311961 18:13273840-13273862 TGGAACTCCTGAAAAGGGACAGG - Intronic
1155240703 18:23861443-23861465 TGGGAGTTCTGGGAAGGCAGTGG - Intronic
1157487582 18:48099624-48099646 TGTGACTCCTGACAATGAACTGG + Intronic
1157804796 18:50650033-50650055 TGGGAGTCCAGGACAGGAACTGG - Intronic
1158027140 18:52913673-52913695 TGAGACTCTTGGGAAAAAACAGG - Intronic
1158446850 18:57529428-57529450 TGGTTCTCAAGGGAAGGAACGGG + Intergenic
1159866273 18:73708717-73708739 TGGGATTCCTTGGAAGGCATAGG + Intergenic
1160847453 19:1172881-1172903 TGTGACTGCTGGGACGGGACGGG - Intronic
1161579234 19:5071597-5071619 GGGGACTCTTGGGAAAGAAGGGG + Intronic
1161832478 19:6617286-6617308 TGGATCCCCTGGGATGGAACTGG - Intergenic
1162312872 19:9917581-9917603 AGGGACCCTTGGGGAGGAACTGG - Intronic
1162705268 19:12550799-12550821 TGGGAATGCGGGGAAGGAACCGG + Intronic
1163058116 19:14737582-14737604 TGGGGCTTCTGAGAAAGAACAGG - Intronic
1163586736 19:18168460-18168482 TGAGCCACCTGAGAAGGAACAGG - Exonic
1164571732 19:29379633-29379655 TGGGACTCCAGGGAGGGAGCTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167960914 19:53103538-53103560 AGGGACCCCAGGGAAGGAACGGG + Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168297891 19:55386555-55386577 TTGGGCTCCTGGGAAGGAGGCGG - Exonic
925065370 2:925677-925699 TGAGAAGCCTGGGAAGGAAAGGG + Intergenic
927523501 2:23717254-23717276 AGGGACTCATGGGAATGCACAGG + Intergenic
928201439 2:29250041-29250063 TGGGCCTCCTGGGAAGGAGAGGG - Intronic
928397080 2:30950910-30950932 TGGGACCACTGGGATGGAAAGGG + Intronic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
929692639 2:44087287-44087309 TGGGACGGCTGGAAGGGAACTGG - Intergenic
936151162 2:110023161-110023183 TGGGAGGCCTGGGCAGGAGCAGG - Intergenic
936193513 2:110348208-110348230 TGGGAGGCCTGGGCAGGAGCAGG + Intergenic
938392160 2:130915023-130915045 TGGGACCCATGTGAAGGAAGGGG + Intronic
938971794 2:136439533-136439555 CAGGATTCCTGGGAATGAACAGG - Intergenic
941570162 2:167160784-167160806 GGGGACTGTTGGGAAGGCACTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944887437 2:204078006-204078028 TGGGACTCATGTGTGGGAACTGG + Intergenic
946122374 2:217527617-217527639 TCTGTCTCCTGAGAAGGAACTGG + Intronic
946331590 2:219012407-219012429 TGGGGCTGCTGGGAAGGCAGAGG + Intronic
946872998 2:224101584-224101606 TGGGGTTTCTGGGAAGGAAAGGG + Intergenic
947711396 2:232318469-232318491 TGGGCTTCAAGGGAAGGAACTGG - Intronic
948921553 2:241068296-241068318 TGGGACTCCTGGGAGAGCTCGGG - Intronic
948921570 2:241068368-241068390 TGGGACTCCTGGGAGAGCTCGGG - Intronic
1168965661 20:1896427-1896449 TGGGTCTCCTGGGAGGGCACCGG + Intronic
1169130695 20:3165145-3165167 TGGCACACCTGGGCAGGAACAGG + Exonic
1169149336 20:3276956-3276978 GGGGACCCCTGAGAAGGAAGGGG - Intronic
1171564251 20:26163620-26163642 TGGGAGTGCTGGGAAGGGAAGGG - Intergenic
1172007420 20:31826949-31826971 GGGGCCTCCTGGGAAGGGTCAGG + Intronic
1172124409 20:32616762-32616784 TGTGACTGCTGGGCAGGAAATGG - Intergenic
1173707617 20:45124113-45124135 TGTGATTCCTGTGAAGGAACTGG - Exonic
1174669527 20:52293356-52293378 TGAGACTCCTGGGATGGTACAGG - Intergenic
1174845377 20:53938249-53938271 TGGGACTCAGGGGAAGGCACTGG - Intronic
1174900466 20:54494237-54494259 TGGACCTTCTGGGAAGGAGCTGG + Intronic
1175311235 20:58012894-58012916 TGGGCGTCCTGGGAAGGAAATGG - Intergenic
1175853682 20:62107415-62107437 AGGGGCTCCTGGGAAGGCAGGGG + Intergenic
1175978309 20:62724660-62724682 AGGGTCTCCTGGGCAGGCACTGG + Intronic
1176064948 20:63189419-63189441 TGGGAGCCCTGGGCAAGAACAGG - Intergenic
1176084488 20:63289845-63289867 TGGGACCCCCGGGAAGGCAGGGG + Intergenic
1176794760 21:13363290-13363312 TGAGACTCCTAAAAAGGAACAGG - Intergenic
1179081520 21:38174893-38174915 TGGTTTTCATGGGAAGGAACAGG - Intronic
1181088640 22:20457103-20457125 TGGGATCCCAGGGAAGGAACAGG - Intronic
1181113808 22:20618539-20618561 TGAGACACCTGGCAAGGACCAGG + Intergenic
1182279043 22:29207604-29207626 AGGGTCTCCTGGGTGGGAACAGG + Intronic
1183825974 22:40387899-40387921 TGGTACTCCTGTGCAGGAAGGGG + Intronic
1184126753 22:42492608-42492630 TGGGGCTACTTGGAAGGACCAGG - Intergenic
1184245024 22:43231471-43231493 TGGGCCACCTGGGAAGGGAGGGG + Intronic
1185066610 22:48635441-48635463 TGGGCCCCCTGGGTAGGGACTGG - Intronic
1185179341 22:49350193-49350215 TGTGGCTCCATGGAAGGAACGGG + Intergenic
949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG + Intronic
949903288 3:8837685-8837707 TTGGTTTCCTGGGAAGGAACAGG + Intronic
950138241 3:10598111-10598133 TGGGAATTCAGGGAAGGGACAGG + Intronic
951580155 3:24154251-24154273 AGGGAATTCTGGGAAGGATCTGG + Intronic
953290262 3:41653319-41653341 TGGTTTTCATGGGAAGGAACAGG - Intronic
953841899 3:46395944-46395966 TGTGGGTCCTGGGAAGGAAGAGG + Intergenic
954144114 3:48625885-48625907 GGGGACTCCTGGGTAGCACCTGG + Exonic
954627521 3:52030653-52030675 GGGCCATCCTGGGAAGGAACAGG + Intergenic
954812928 3:53259019-53259041 TGCGACTCATGGGAAGGAGGAGG + Intergenic
955814602 3:62828418-62828440 TGGAACTACTGACAAGGAACTGG + Intronic
956257388 3:67298129-67298151 TGGGTCTCCTGGCATGGAAATGG + Intergenic
957436941 3:80189788-80189810 TGGCAATTTTGGGAAGGAACTGG - Intergenic
960062906 3:113341312-113341334 TGGGAGTGCTGGGAAGGGAAAGG - Intronic
960207980 3:114926132-114926154 TAGGAACTCTGGGAAGGAACGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961680353 3:128595861-128595883 TGGGACCACTGGGAAGGGAGAGG + Intergenic
962023815 3:131526998-131527020 AGGGGCTCCTGGGAAGGAGGCGG - Intergenic
966885789 3:184377521-184377543 GGGGGGTCCTGTGAAGGAACCGG - Intronic
967290513 3:187915237-187915259 TGGCACTCAGAGGAAGGAACAGG - Intergenic
967718913 3:192794562-192794584 TGGTAATGCTGGGAAGGAACAGG - Intergenic
967873296 3:194249767-194249789 GGAGACTCGGGGGAAGGAACGGG + Intergenic
968513421 4:1005108-1005130 TGGGCGTCCTGGCAAGGAGCAGG + Intergenic
969120199 4:4902954-4902976 TGAGAATCCTGAGAAGGCACAGG - Intergenic
970238413 4:13982147-13982169 AGGGAGCCCTGGGGAGGAACAGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
974017418 4:56660859-56660881 TGGGACTCCGGGAAAAAAACAGG - Intronic
975128085 4:70804470-70804492 TGTTACTCCTGGGGAGGGACTGG - Intronic
975666470 4:76739578-76739600 TGTGGCTCCAGGGAAGGTACCGG - Exonic
976087845 4:81424502-81424524 TGGGACTGCTGGGAAGGTGGGGG - Intergenic
979082170 4:116358844-116358866 TGGAACTCCCGGGAGGGACCTGG - Intergenic
980887133 4:138775256-138775278 GGGGAGAGCTGGGAAGGAACTGG - Intergenic
985553797 5:546357-546379 TGGGAGCCCTGGGAAGGCCCGGG + Intergenic
985956044 5:3267161-3267183 TGGGCCTCCCAGGAAGGACCAGG - Intergenic
986541021 5:8843830-8843852 TGGGACACTTGGGAATGAAATGG - Intergenic
989809278 5:45653246-45653268 AGGGAGTTCTGTGAAGGAACTGG - Intronic
990661848 5:58024301-58024323 TAGGAATCCTGGTAAGGAGCTGG + Intergenic
991628773 5:68632743-68632765 TGAGACTCCTGGGAAGCACATGG + Intergenic
992418365 5:76575337-76575359 TGGGACCTCTGGGAAGTCACAGG + Intronic
992467755 5:77023962-77023984 TGGGCCTCCAGGGGAGGAAACGG + Intergenic
993672583 5:90779082-90779104 TGGAACTCCAGGGAAGGTAAAGG + Exonic
993938159 5:94027849-94027871 TGAGACTAGTGGGAAGGAAGGGG + Intronic
996216047 5:120867581-120867603 TGGGACTCTTTGCAAGGAAGAGG - Intergenic
996270482 5:121598076-121598098 TAGGGTTACTGGGAAGGAACTGG - Intergenic
998145680 5:139726788-139726810 TGCGACTCCAGGGAAGGCAGTGG - Intergenic
1001940697 5:175737525-175737547 AGGGAGTCCTGAGAAGCAACCGG - Intergenic
1002663881 5:180809011-180809033 TGGGGCTCATGAGAAGAAACAGG + Exonic
1002785754 6:398730-398752 TGTGAAGCCTGGGAAGGAAGGGG - Intronic
1002843712 6:927297-927319 TGGGACACCGGGGCAGGCACCGG + Intergenic
1004515395 6:16318194-16318216 AGGGACTCTTGTGAAGGAAATGG - Intronic
1006155111 6:32009620-32009642 TGGAACACCTGGGAAGCAAGTGG + Intergenic
1006161422 6:32042355-32042377 TGGAACACCTGGGAAGCAAGTGG + Exonic
1006922663 6:37636860-37636882 TGGGACTCCTGAGATGGGAGAGG - Exonic
1007412234 6:41671611-41671633 TGGGGCTCCTGGGAATGCAAAGG - Intergenic
1011596483 6:89021506-89021528 TGGGACTCATGGGAAGGATGGGG + Intergenic
1013746536 6:113352851-113352873 TGGCTCTCCTGGGTAAGAACTGG - Intergenic
1014235744 6:118952466-118952488 TGGGGCTCCTGAGAATTAACAGG - Intergenic
1014559521 6:122873529-122873551 TGGGACTCTTAGGAGGGCACTGG - Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017326915 6:153150822-153150844 TGGAACTCTTGGGCAGGACCGGG - Intergenic
1018308452 6:162483265-162483287 TGAGACACCTGTGAAGGAAGCGG + Intronic
1019578548 7:1749142-1749164 GGAGACTCCAGGGCAGGAACCGG + Intergenic
1021254124 7:18368821-18368843 TGGTGCCCCTGAGAAGGAACAGG + Intronic
1022341148 7:29469444-29469466 AGGGCCTTCTGGGAAGGAATGGG - Intronic
1023116391 7:36866837-36866859 TGGGACTTCTGGGTAGGAAAAGG - Intronic
1023998596 7:45176945-45176967 TGGGACTCCTAAGCTGGAACTGG + Intronic
1024185275 7:46942624-46942646 TGGCACTCCAGGGAAGGAGACGG - Intergenic
1024704070 7:51938449-51938471 TGGGTCTACTGGAAAGGACCTGG + Intergenic
1024966361 7:55025463-55025485 TGGGACTGCAGGGAAGGGAAGGG + Intronic
1025034809 7:55587493-55587515 AGGGCCTCCAGGGAATGAACTGG - Intergenic
1025113185 7:56236378-56236400 TGGGACTACTTGGAAGGATGAGG + Intergenic
1025610147 7:63070887-63070909 TGGGAGCCCTGGGCAGGCACTGG - Intergenic
1025709261 7:63891922-63891944 TGGGAGCCCTGGGCAGGCACTGG + Intergenic
1026650219 7:72210053-72210075 TGGGAAGCCTGGGAAGGGCCTGG - Intronic
1027252847 7:76409870-76409892 CGGGACTCCTGGGCTGGATCAGG - Intronic
1028661137 7:93276880-93276902 AGGGAAGACTGGGAAGGAACAGG + Intronic
1029258747 7:99287095-99287117 TGGCTCCCATGGGAAGGAACAGG + Intergenic
1029515731 7:101021888-101021910 TGTGTCTGCTGGGAAGGACCAGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032509007 7:132456812-132456834 TGGGAGACCTTGGATGGAACTGG + Intronic
1033651197 7:143345438-143345460 CCGCACTCCTGAGAAGGAACAGG - Intronic
1034886429 7:154802355-154802377 CGGGACCCCTGGGATGGAATCGG + Intronic
1034886444 7:154802389-154802411 CGGGACTCCTGGGATGGAAATGG + Intronic
1035756522 8:2036864-2036886 TGGGTCGCCTAGGAAGGAGCAGG + Intergenic
1036041805 8:5092294-5092316 TTGGAAACCTGGGAAAGAACTGG + Intergenic
1039086367 8:33783878-33783900 GGGGAGTGCTGGGAAGGAAAAGG - Intergenic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1039542931 8:38386506-38386528 TGGGGGTCCCGGGAAGGAGCTGG + Exonic
1039905508 8:41783387-41783409 TGGTGCTCCAGGGAAGGACCCGG - Intronic
1040107463 8:43548792-43548814 AGGGCCTGCTGGGAAGGCACTGG + Intergenic
1040107570 8:43549228-43549250 AGGGCCTGCTGGGAAGGCACTGG + Intergenic
1040107924 8:43550569-43550591 AGGGCCTGCTGGGAAGGCACTGG + Intergenic
1040108086 8:43551241-43551263 AGGGCCTGCTGGGAAGGCACTGG + Intergenic
1040284022 8:46091004-46091026 TGGGGCTTCTGGGAAGGGAGAGG - Intergenic
1040284283 8:46092082-46092104 TGGGGCTTCTGGGAAGGGAGAGG - Intergenic
1040284895 8:46094657-46094679 GGGGTCTCCTGGGAAGGGAGAGG - Intergenic
1040285667 8:46099288-46099310 TGGGGCTTCTGGGAAGGGATAGG - Intergenic
1040290400 8:46121266-46121288 GGGGACTCCTGGGATGGGAGAGG + Intergenic
1040302868 8:46197023-46197045 TGGGGCTTCTGGGAAGGGAGAGG - Intergenic
1040308705 8:46225552-46225574 GGGGACTTCTGGGAAGGGAGAGG - Intergenic
1040315998 8:46261232-46261254 GGGGGCTCCTGGGATGGAAGAGG - Intergenic
1040316397 8:46263189-46263211 GGGGGCTCCTGGGATGGAAGAGG - Intergenic
1040319688 8:46286313-46286335 TGGGGTTTCTGGGAAGAAACAGG + Intergenic
1040341511 8:46443472-46443494 TGGGGCTCCTGGGATGGTAAAGG + Intergenic
1042916939 8:73884715-73884737 TATCACTCCTGGGAAGGATCAGG - Intergenic
1043985049 8:86684352-86684374 TGGCAAGCCTGGGAAGAAACTGG + Intronic
1044125937 8:88457791-88457813 TGGGACCCATGGGAAATAACTGG - Intergenic
1045676676 8:104615044-104615066 TGGGACTCCTGGGCCAGAACTGG + Intronic
1046268880 8:111866812-111866834 TTGGACTCATGGGAAGAGACAGG - Intergenic
1046989930 8:120441138-120441160 AGGGAAAACTGGGAAGGAACAGG + Intronic
1047410536 8:124621084-124621106 TGGGATGCGTGGGAAGGAAGAGG - Intronic
1050024673 9:1321366-1321388 TACGACTCCTGGGGTGGAACAGG - Intergenic
1051009739 9:12396914-12396936 TTGGGCTGCTGGGGAGGAACTGG - Intergenic
1051667427 9:19478192-19478214 GGAGACTCAGGGGAAGGAACCGG + Intergenic
1051911204 9:22155000-22155022 TGGACCTCCTGGGCAGGAAAGGG + Intergenic
1052443551 9:28529760-28529782 TGGTAAACCTGGGAAAGAACTGG - Intronic
1053389312 9:37722941-37722963 TAGAACTCCTGGGATGGAGCAGG - Intronic
1055364691 9:75530034-75530056 GGGAACTCCTGGAAAGGACCAGG + Intergenic
1056209010 9:84347682-84347704 GGGGATTCCTGAGAAGGCACAGG + Intergenic
1056566061 9:87773224-87773246 CGTGACTCCTGTGAAGGATCAGG + Intergenic
1057317723 9:93980491-93980513 TGGCACTCCTGGGCATGACCTGG - Intergenic
1058096146 9:100862486-100862508 TGGACCTCCTGGGAAGGCAGTGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059142910 9:111870877-111870899 TGGGACTGGTGGGAAGGAGGGGG + Intergenic
1059648642 9:116293521-116293543 TGTGAGTTCTGGGAAAGAACTGG + Intronic
1060597855 9:124858804-124858826 TGGGACCCCTGAGCAGGGACTGG - Intronic
1060615066 9:125005714-125005736 TGGGCCTCCTGGCTAAGAACTGG + Intronic
1060791869 9:126490516-126490538 TGGCACTCCTGGAAGGGAACGGG - Intronic
1061789229 9:133050177-133050199 CGGAGCTCCTGGGAAGGAGCTGG - Intronic
1062545753 9:137063155-137063177 TGGACCTCCTGGGCAGGAAAGGG - Exonic
1186347859 X:8712973-8712995 TGGGTCTCCTGGGAGAGAATGGG - Intronic
1186726482 X:12364363-12364385 TGGTTTTCATGGGAAGGAACAGG + Intronic
1187237787 X:17484558-17484580 TGGTTTTCATGGGAAGGAACAGG + Intronic
1190689226 X:52899629-52899651 CGGGAGTCCGGGGAGGGAACAGG - Intronic
1190696757 X:52956163-52956185 CGGGAGTCCGGGGAGGGAACAGG + Intronic
1191253681 X:58270808-58270830 AGAGGCTGCTGGGAAGGAACTGG + Intergenic
1191257745 X:58287061-58287083 TGGAACTGCTGGAAAGGCACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193921693 X:87435796-87435818 AGAGACTCCTGGGATGGACCAGG - Intergenic
1195764823 X:108285069-108285091 TGGGCCGCTTGGGAAAGAACAGG - Intronic
1195771387 X:108355121-108355143 TGGGTCTCCTTGGATGGATCTGG - Intronic
1195942939 X:110180190-110180212 TGTGCCTCCAGGGAAGGAAGGGG - Intronic
1197203414 X:123769121-123769143 AGGGCCCCCTGGCAAGGAACTGG - Intergenic
1197890837 X:131268701-131268723 TTGGACTTCTGGGAGGGAAGGGG + Intergenic