ID: 1122245960

View in Genome Browser
Species Human (GRCh38)
Location 14:100403824-100403846
Sequence TCATCTCGATGGAAGTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122245960_1122245963 7 Left 1122245960 14:100403824-100403846 CCCTCAGACTTCCATCGAGATGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1122245963 14:100403854-100403876 GATCAATATTCCAGTTTGCTTGG 0: 1
1: 0
2: 0
3: 11
4: 116
1122245960_1122245966 21 Left 1122245960 14:100403824-100403846 CCCTCAGACTTCCATCGAGATGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1122245966 14:100403868-100403890 TTTGCTTGGCTGGCAGCTTCCGG 0: 1
1: 0
2: 2
3: 23
4: 193
1122245960_1122245967 22 Left 1122245960 14:100403824-100403846 CCCTCAGACTTCCATCGAGATGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1122245967 14:100403869-100403891 TTGCTTGGCTGGCAGCTTCCGGG 0: 1
1: 0
2: 2
3: 18
4: 206
1122245960_1122245964 11 Left 1122245960 14:100403824-100403846 CCCTCAGACTTCCATCGAGATGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1122245964 14:100403858-100403880 AATATTCCAGTTTGCTTGGCTGG 0: 1
1: 0
2: 1
3: 12
4: 130
1122245960_1122245968 23 Left 1122245960 14:100403824-100403846 CCCTCAGACTTCCATCGAGATGA 0: 1
1: 0
2: 0
3: 6
4: 79
Right 1122245968 14:100403870-100403892 TGCTTGGCTGGCAGCTTCCGGGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122245960 Original CRISPR TCATCTCGATGGAAGTCTGA GGG (reversed) Intronic