ID: 1122246946

View in Genome Browser
Species Human (GRCh38)
Location 14:100410088-100410110
Sequence CTGGAAACTCAGATGGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122246946_1122246956 19 Left 1122246946 14:100410088-100410110 CCAAACCCCATCTGAGTTTCCAG 0: 1
1: 0
2: 2
3: 19
4: 249
Right 1122246956 14:100410130-100410152 TATTGTTAAAGTGATTCTGGGGG 0: 1
1: 0
2: 1
3: 11
4: 221
1122246946_1122246957 25 Left 1122246946 14:100410088-100410110 CCAAACCCCATCTGAGTTTCCAG 0: 1
1: 0
2: 2
3: 19
4: 249
Right 1122246957 14:100410136-100410158 TAAAGTGATTCTGGGGGCAGTGG 0: 1
1: 0
2: 0
3: 28
4: 354
1122246946_1122246955 18 Left 1122246946 14:100410088-100410110 CCAAACCCCATCTGAGTTTCCAG 0: 1
1: 0
2: 2
3: 19
4: 249
Right 1122246955 14:100410129-100410151 CTATTGTTAAAGTGATTCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 206
1122246946_1122246954 17 Left 1122246946 14:100410088-100410110 CCAAACCCCATCTGAGTTTCCAG 0: 1
1: 0
2: 2
3: 19
4: 249
Right 1122246954 14:100410128-100410150 TCTATTGTTAAAGTGATTCTGGG 0: 1
1: 0
2: 2
3: 21
4: 251
1122246946_1122246953 16 Left 1122246946 14:100410088-100410110 CCAAACCCCATCTGAGTTTCCAG 0: 1
1: 0
2: 2
3: 19
4: 249
Right 1122246953 14:100410127-100410149 CTCTATTGTTAAAGTGATTCTGG 0: 1
1: 0
2: 0
3: 14
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122246946 Original CRISPR CTGGAAACTCAGATGGGGTT TGG (reversed) Intronic
903281109 1:22250485-22250507 CTGGTGACTCAGATGGGGAGGGG + Intergenic
904748915 1:32728709-32728731 CTGGAAGCTCACATGTGTTTTGG + Intergenic
905868943 1:41391951-41391973 GTGGAAACCCAGATGGGAGTTGG - Intergenic
905888127 1:41502667-41502689 CTGGAGACTCCGGTGGGGTGTGG - Intergenic
908124132 1:61013439-61013461 TTGCAAACTCAGATGTGGATGGG - Intronic
909540491 1:76786270-76786292 CTGGAAACTCTTAAGGGGATGGG - Intergenic
910464657 1:87485323-87485345 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
911152428 1:94608335-94608357 ATACAAACACAGATGGGGTTGGG - Intergenic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
912744039 1:112230351-112230373 CTAGACACTCAGCTAGGGTTTGG - Intergenic
914359431 1:146920035-146920057 CTGTCACCTCAGAAGGGGTTTGG + Intergenic
914494318 1:148179840-148179862 CTGTCACCTCAGAAGGGGTTTGG - Intergenic
917586284 1:176430372-176430394 CTGGAAGCTGTAATGGGGTTAGG - Intergenic
919011070 1:191963847-191963869 CTGGAAACTCAAATTTTGTTTGG + Intergenic
919796518 1:201324501-201324523 CTGGCAACTCTGATGTGGTGCGG + Exonic
919839146 1:201596735-201596757 CTGGAAACTCTGTTGGGGCAGGG - Intergenic
919902561 1:202055067-202055089 CTGGAAAGTGGGGTGGGGTTGGG + Intergenic
921067066 1:211630760-211630782 CTGGATTCTCAGCTGGGGTGGGG - Intergenic
922089095 1:222378583-222378605 ATGGAAAATGAGATGGGGTGGGG - Intergenic
923597947 1:235375471-235375493 CTGGATACTAAAATGGGGCTGGG + Intronic
924305030 1:242679332-242679354 GTGGAAGCTCAGATATGGTTGGG - Intergenic
1064807780 10:19156840-19156862 TTGGTAACTTAGTTGGGGTTGGG + Intronic
1065423677 10:25576202-25576224 CTGGAGACTCAGAAGGGGTTAGG - Intronic
1067787691 10:49262617-49262639 CTGGCCACACAGATGGGGTGAGG + Intergenic
1068749704 10:60577882-60577904 CTGGAAATTCAGATAGGTGTGGG + Intronic
1070548814 10:77474585-77474607 CAGGAAACTCACATGGGGCGCGG + Intronic
1071061000 10:81570816-81570838 ATGCAAACTCAGAAGGGGTGAGG + Intergenic
1071272127 10:84017591-84017613 CTGGAAACTGAGCTGAGATTTGG + Intergenic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1073460555 10:103663430-103663452 ATGGAAAGACAGATGGGCTTGGG - Intronic
1074120685 10:110492293-110492315 CAGGAAATAAAGATGGGGTTAGG - Intergenic
1074143356 10:110696375-110696397 TGGGAAATACAGATGGGGTTGGG + Intronic
1074569986 10:114615461-114615483 GAGGAAACTGAGATGGGGGTCGG - Intronic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1080333805 11:31174013-31174035 CTGAAAACTCAGAAGGGTGTAGG - Intronic
1082057881 11:47834877-47834899 ATGGAAACTCAGGTTGGGTGAGG + Intronic
1083050114 11:59769466-59769488 TTGGAAACTCAGAGAGGTTTGGG + Intronic
1083811036 11:65107195-65107217 CTGGACACGCAGATGCGCTTGGG + Intronic
1084877624 11:72145023-72145045 GTAGAAACTCATATAGGGTTGGG + Intergenic
1085996571 11:81923301-81923323 GTGGTTACACAGATGGGGTTAGG - Intergenic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1089542121 11:119195634-119195656 TTGGAACCTCAGACAGGGTTGGG + Intronic
1089697745 11:120226361-120226383 CAGGGAACTCAGATGAGGCTGGG - Intronic
1090306329 11:125694288-125694310 CTGGAAGATCTGATGGGGGTTGG + Intergenic
1090609290 11:128455929-128455951 CTGTAAACTCAAACGGGCTTTGG + Intergenic
1092091288 12:5805656-5805678 CAGGAAACAGAGATGGGGCTCGG - Intronic
1092230844 12:6774443-6774465 CTGGAAGCTGAGATGGGGAGAGG + Intronic
1092513932 12:9187935-9187957 CTGAAAACCCTGATGGGGGTGGG + Intronic
1095878479 12:47107007-47107029 CGGGTAACTGAGATGGGGGTAGG - Intronic
1096773122 12:53949188-53949210 CTGGAGACTAAGATGTGGGTGGG - Intergenic
1097477657 12:60078625-60078647 TTGGAGACTCAGAAGGGGATAGG - Intergenic
1098721896 12:73910733-73910755 CTCGAAACTGAAATGGGGATTGG + Intergenic
1099647571 12:85378937-85378959 CTGTAAACTCAAACTGGGTTTGG + Intergenic
1101398533 12:104368814-104368836 CTGGAAGCCCAGGTGGGGCTTGG - Intergenic
1104732345 12:131114716-131114738 TTGGAAACTGAGGTGGGGTGGGG + Intronic
1105977190 13:25482468-25482490 CTGGAAACTTGGGTGGGGCTTGG + Intronic
1106367955 13:29101636-29101658 GTGGTGACTGAGATGGGGTTTGG - Intronic
1106758172 13:32842943-32842965 CTGAAGGCTCAGCTGGGGTTGGG - Intergenic
1107840324 13:44450765-44450787 TTTGGAACTCAGGTGGGGTTGGG + Intronic
1109396657 13:61766905-61766927 CTGCCAACTCAGAAGGGGCTCGG + Intergenic
1113230222 13:108205695-108205717 CTGGAAAGTCATATGGTGTAGGG - Intergenic
1114402216 14:22420479-22420501 CTGGAAACTCTGATGGTCTTTGG - Intergenic
1116541695 14:46108515-46108537 CTGCCAACTCAGAAGGGGTCAGG + Intergenic
1117145697 14:52835207-52835229 CTGGAAACCCAAATGGCCTTGGG + Intergenic
1117184752 14:53228404-53228426 TTGTGAACTCAGATGGGGATGGG - Intergenic
1118486874 14:66222734-66222756 CCTGAAGGTCAGATGGGGTTGGG - Intergenic
1120061032 14:79983092-79983114 CTGGAAAGTCAGGTAGGGATTGG - Intergenic
1121647924 14:95534085-95534107 CTGGAAACTCAGAGGCGGCCGGG + Intronic
1122218732 14:100221832-100221854 ATGAAAACACAGATGGGGTGAGG + Intergenic
1122246946 14:100410088-100410110 CTGGAAACTCAGATGGGGTTTGG - Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1126256820 15:46637024-46637046 CTGCCAACTCACATGGGATTTGG + Intergenic
1126549952 15:49917624-49917646 CTGGAGAATCAGATGGTGTTGGG + Intronic
1127706505 15:61552434-61552456 CTGGAATGACAGATGGGATTTGG + Intergenic
1128177735 15:65571277-65571299 CTGGATACTCAGATGTTTTTTGG - Intronic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128638689 15:69319595-69319617 TTGGAAACACAGCTGGGCTTGGG + Intronic
1129089040 15:73129367-73129389 CTAGAAATTCAGATAGTGTTAGG + Intronic
1129257127 15:74339861-74339883 TTGGAGACTGGGATGGGGTTCGG - Intronic
1133231752 16:4370265-4370287 TTGGAAACTCAGATGGTTCTGGG + Intronic
1133455958 16:5942838-5942860 CAGGAAACTAAGATGAGGATGGG + Intergenic
1133638244 16:7690929-7690951 CTGTAAAATCAGATTGGCTTTGG - Intronic
1134822341 16:17256995-17257017 CTGGGGGCTCCGATGGGGTTGGG - Intronic
1135799604 16:25480351-25480373 CTGGAAACTCAGAAAGGGAGGGG + Intergenic
1136383814 16:29910652-29910674 TTAGAAACTCAGAAGGGGTGAGG - Intronic
1136428840 16:30185700-30185722 ATGGAAACACAGAGGGGGTTGGG + Intronic
1138938956 16:61766146-61766168 TTGGAAACTCAGAAGGGGGTAGG - Intronic
1139062009 16:63263861-63263883 CTGAGACCTCAGGTGGGGTTGGG + Intergenic
1139546329 16:67651533-67651555 CTGCAAACGGAGGTGGGGTTGGG - Intronic
1143892289 17:10111757-10111779 TTGGAAACACAATTGGGGTTAGG - Intronic
1144438269 17:15260591-15260613 CTGGGAACCCAGATGGGGAAGGG + Intronic
1144708907 17:17387761-17387783 CTGGAAACTCAGAGAGGTTAGGG - Intergenic
1149530525 17:57391403-57391425 CTGGTTTCTCAGATGAGGTTGGG - Intronic
1150482363 17:65520298-65520320 CTGGTAACTGAGATGGTTTTTGG + Intergenic
1151692986 17:75698456-75698478 TTGGAAACTCAGAGGTGCTTGGG - Intronic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1152262415 17:79274221-79274243 CTGGAGACTGGGATGGGGGTTGG + Intronic
1152335026 17:79695817-79695839 CAGGAAATTCACATGTGGTTTGG + Intergenic
1152568834 17:81112388-81112410 CTGACAACTCAGCTGGGATTGGG + Intronic
1152895730 17:82910058-82910080 CTGGAAACCCAGATGAGCCTGGG - Intronic
1153444112 18:5153026-5153048 CTTGAAACACAGATGGACTTTGG + Intronic
1154260472 18:12827505-12827527 CTGGAGTCCCAGCTGGGGTTGGG - Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156490916 18:37495523-37495545 CTGGAGCCTCAGATGGGGCATGG - Intronic
1158438852 18:57455661-57455683 CGGGAAGCTCTGATGGGGTCTGG + Intronic
1158547732 18:58410313-58410335 CTGTAAACTCAGAGGAGGGTTGG - Intergenic
1159712144 18:71774059-71774081 CTGGAAACTAAAATGGGGGAGGG - Intronic
1159980284 18:74770053-74770075 CTGGAAAATGAGATGTGGTGAGG + Intronic
1160111313 18:76034450-76034472 CTGAAGTCTCAGATGGGGTGGGG - Intergenic
1160693297 19:470170-470192 CTGGGAACTCAGATCGGTCTGGG + Intronic
1162234069 19:9292078-9292100 CTGGGAACTCAGCCAGGGTTAGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164922742 19:32101799-32101821 ATGGAGACTCAGAAGGGGGTGGG - Intergenic
1166916018 19:46196571-46196593 CTGGAGGCTCAGCTGGGGTCGGG - Intergenic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167793558 19:51694792-51694814 CTGGAAGTCCAGATGGGGTCGGG + Intergenic
1168001026 19:53446116-53446138 AGGGAACTTCAGATGGGGTTGGG - Intronic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
929449623 2:42028040-42028062 ATGTAAACCCAGATGGGGGTGGG + Intergenic
930834272 2:55776447-55776469 CTTGAAAGGTAGATGGGGTTCGG + Intergenic
933899356 2:86837948-86837970 CTGGAAGTTCACATGGGGCTGGG - Intronic
935781206 2:106511280-106511302 CTGGAAGTTCACATGGGGCTGGG + Intergenic
936290223 2:111217212-111217234 CTGCCAACTCAGAAGGGGTGGGG + Intergenic
936377941 2:111958234-111958256 CTGGAAAGTCACAAGGGTTTGGG + Intronic
937500401 2:122472178-122472200 CTTGAAAGTTAGATGGGGCTGGG + Intergenic
937610196 2:123851967-123851989 CTGGGAACTCAGATGGGGAAAGG + Intergenic
938920523 2:135990389-135990411 CTGGAAACGGAGATGGGGAGTGG - Intergenic
942195885 2:173519675-173519697 CTGGAAACTCCGCAGGGGTGGGG - Intergenic
942205188 2:173612923-173612945 CTGGAACCTCAGATCCGCTTGGG + Intergenic
942283985 2:174395686-174395708 CTGGAAACGCAGTTCCGGTTAGG - Exonic
943041942 2:182814431-182814453 TTGAAAGCTCAGAAGGGGTTGGG - Intergenic
945043859 2:205764783-205764805 GTGGGAACCCAGATGGGGGTGGG - Intronic
945370422 2:209009477-209009499 CTGGAAACTTTGTTGTGGTTTGG - Intergenic
948681777 2:239640052-239640074 CAGGAATCTCAGATTGTGTTTGG + Intergenic
1170063800 20:12288675-12288697 CTGGCAGCTCAAATGGGGGTGGG - Intergenic
1170662255 20:18353439-18353461 CTGTAAAGTCAGCTGGGCTTGGG + Intergenic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1173110187 20:40180097-40180119 CTGGAAAATCAAAAGGGGGTGGG - Intergenic
1175709791 20:61210319-61210341 CTGGAGCCTCAGGTGGGGTCAGG - Intergenic
1177746621 21:25222496-25222518 CTGGGACCTCAGCTGGGGTTGGG + Intergenic
1178398521 21:32263776-32263798 CTGCAAACCCAGCTGGGGTCGGG + Intergenic
1181639431 22:24188931-24188953 CTGGGACCCCAGATGGGGTAAGG + Exonic
1182112018 22:27730831-27730853 CTGTGAGCTCAGATGTGGTTGGG - Intergenic
1182381622 22:29894568-29894590 GTGGCAACTCAGATGGGATATGG + Intronic
1182844372 22:33418397-33418419 CTGGATACTAGGATGGGGGTGGG + Intronic
1182864785 22:33594481-33594503 CTGGAAATTATGATGAGGTTAGG - Intronic
1183255404 22:36758569-36758591 AAGGAAACTCAGATGGAGTCAGG + Intronic
1183261511 22:36798632-36798654 CTGGACACTGAAGTGGGGTTGGG - Intergenic
1183300237 22:37055419-37055441 CTGAAAACTGTGATGGGATTAGG - Intronic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1184615618 22:45636227-45636249 CTGGAAGGTCAGATGGGGATGGG + Intergenic
1184918942 22:47592114-47592136 CTGAAAACTCAGATGGGTCGAGG - Intergenic
1185142751 22:49112552-49112574 CTGGAGTCTTTGATGGGGTTGGG + Intergenic
950039519 3:9911024-9911046 CTCGAGAGTCAGATGGGGTGAGG + Exonic
950126965 3:10515586-10515608 CTGGGACCTCAGTTGGGGCTGGG - Intronic
950724173 3:14905789-14905811 CTTGAAAATGAGTTGGGGTTGGG + Intronic
950845601 3:16012649-16012671 CTGGAAATTCAGCAAGGGTTTGG + Intergenic
951072652 3:18350371-18350393 TAGCAAACTCAGATGTGGTTAGG + Intronic
952896750 3:38082687-38082709 GTAGAGACTCAGAAGGGGTTGGG + Intronic
953168028 3:40482603-40482625 CTGGAATATCAGATCTGGTTTGG - Exonic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
954316879 3:49806209-49806231 CTGGTAACTGGGATGGGGGTTGG - Intronic
954329977 3:49884637-49884659 CTGACACCCCAGATGGGGTTGGG + Intergenic
954453935 3:50586793-50586815 CTGGAAAGCCAGGTGGGGTGGGG - Intergenic
954751844 3:52818245-52818267 CTGGGAACTTACCTGGGGTTTGG + Exonic
955052285 3:55424354-55424376 CTGGAAACACCCATGGGGTGGGG + Intergenic
955491180 3:59484770-59484792 CTGAAAACTCAGTAGGGATTTGG + Intergenic
955760043 3:62270302-62270324 CTGGGATCACAGATGGGCTTTGG - Intronic
958454694 3:94315890-94315912 CTGGAAAGTCTGATGTGGGTTGG + Intergenic
959258273 3:104042497-104042519 CTGGAAACCCAGATAGGAATTGG - Intergenic
959399470 3:105882403-105882425 CTGGAAACTCAGTTGGGCCTGGG - Intergenic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
962029695 3:131586807-131586829 AGGGAAACACAGAAGGGGTTTGG + Intronic
964927387 3:161975448-161975470 CTGCCAACTCAGAAGGGGGTAGG + Intergenic
965541988 3:169880047-169880069 CTGCCAACTCAGAAGGGGTGGGG - Intergenic
966248040 3:177830796-177830818 TTGGAAACTGGGATGAGGTTTGG + Intergenic
970552146 4:17193070-17193092 CTGGAAGATCAGCTGGGGTCTGG - Intergenic
971418096 4:26452117-26452139 GTGGAAACTCAGCTGTGTTTTGG + Intergenic
975905354 4:79204716-79204738 CTGGAGACTCAGAAGGGGAGTGG - Intergenic
977650074 4:99459299-99459321 CTGGAATCTGGGATGGGCTTGGG + Intergenic
977792240 4:101120428-101120450 CTGGAAACTCCTACGGGTTTAGG + Intronic
977916665 4:102601802-102601824 CATGAAACCAAGATGGGGTTCGG + Intronic
983217287 4:165013770-165013792 CAGGAACCTTAGGTGGGGTTTGG + Intergenic
985721357 5:1490948-1490970 CTGGAAACTGAACTGGGGTGGGG - Intronic
986108918 5:4691997-4692019 CTCGAAACCCAGATGTGGTTTGG + Intergenic
986224154 5:5797659-5797681 CTGGAATCTCAGATGTAATTAGG + Intergenic
988835407 5:35027733-35027755 CTGCAAACTCAGATAGGCTCTGG - Intronic
989962688 5:50435341-50435363 TTTGAAACTTAGATGGGGTGTGG - Intronic
990297476 5:54417124-54417146 GTGAAAACTCAGATGGGGGAGGG + Intergenic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
992236659 5:74716892-74716914 CTAAAAACTCAGATTGGGCTGGG + Intronic
992367340 5:76106147-76106169 CTATCAACTCAGATGGGGTAGGG - Intronic
994188338 5:96839867-96839889 CTGGGAACTCAGATGAGGTCAGG - Intronic
994228350 5:97281788-97281810 ATGGAGACTCAGATGGGGGCAGG - Intergenic
995220172 5:109639754-109639776 GTGGAAAGAGAGATGGGGTTAGG + Intergenic
997331057 5:133062114-133062136 CTGGAAAATGGGATTGGGTTGGG + Intronic
997645743 5:135480794-135480816 ATGTAAAGTCAGATGGTGTTGGG - Intergenic
997979205 5:138458656-138458678 CTGCACACTCAGCTGGGGGTAGG + Intergenic
998498422 5:142611208-142611230 CTTGAAACTCAGAAGGGCTCTGG + Intronic
999374437 5:151076875-151076897 GCGGAAACTCAGATGTGGGTGGG - Intronic
1001032191 5:168271138-168271160 CCGGAAAGGCTGATGGGGTTTGG - Intergenic
1001173066 5:169439762-169439784 TTTGAAACTGAGATAGGGTTTGG + Intergenic
1001260860 5:170227389-170227411 ATGGAAACACAGAAGGGGCTGGG + Intergenic
1001516836 5:172361630-172361652 CTGGAAAGTCACATGGCCTTAGG + Intronic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1003590394 6:7432214-7432236 CTGGAAAGCCAGATCCGGTTAGG + Intergenic
1004464029 6:15866776-15866798 CTGGAGCCTCAGAGGGTGTTGGG - Intergenic
1005155545 6:22801995-22802017 CTGGTAACCCATATGGTGTTGGG - Intergenic
1005781780 6:29200903-29200925 CTGTCAACTCATAAGGGGTTGGG - Intergenic
1006787630 6:36679087-36679109 CTGGAAACCCAGCTGGGGCGAGG + Intronic
1006851748 6:37103411-37103433 CTGGAACCTGAGAGGGGGTTGGG + Intergenic
1008588465 6:52970204-52970226 CTGGGAACTCACCTTGGGTTGGG - Intergenic
1008766650 6:54925214-54925236 CTGGAAATTCAGGAGGAGTTTGG - Intronic
1009624394 6:66120542-66120564 TTGGAAACTCAGAAGGGGATAGG - Intergenic
1009931336 6:70180221-70180243 CTATAAACTCAATTGGGGTTGGG + Intronic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1012599222 6:101073554-101073576 CTGGCAAGTCAGATGGAGATAGG - Intergenic
1012830572 6:104199518-104199540 TTGGAAACTCAGGAGGGGGTAGG + Intergenic
1013409053 6:109868282-109868304 CAGGAAATTCAGTGGGGGTTGGG + Intergenic
1016056049 6:139578809-139578831 CTGGATTCTCTGATGGGTTTGGG - Intergenic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1018065068 6:160118885-160118907 CTGCCAACTCAGAAGGGGTGGGG + Intergenic
1020637508 7:10714322-10714344 CTCGAAACTCAGAAGGTGGTGGG - Intergenic
1021421776 7:20453758-20453780 GAGGAAACTCAGGTGAGGTTAGG + Intergenic
1021658497 7:22895276-22895298 CTAGAGAAGCAGATGGGGTTGGG - Intergenic
1023840724 7:44096193-44096215 CCCGAAACTCTGATGGGGGTGGG - Intergenic
1027408103 7:77884388-77884410 ATGGAGACTCAGAAGGGGTAGGG - Intronic
1028188457 7:87817686-87817708 CTGGGAACAGAGATGGGGATGGG - Intronic
1028798195 7:94929396-94929418 TTCGAAACTCAGATAGAGTTTGG - Intronic
1030884684 7:114922697-114922719 CTGGAAAGAGAGATCGGGTTTGG - Intronic
1031487648 7:122348113-122348135 ATGGAAACAAAAATGGGGTTGGG - Intronic
1033315246 7:140291911-140291933 CTGGAAGTTCAGATGGCTTTAGG - Intergenic
1035647332 8:1234737-1234759 CTGGGAACTCATAGGTGGTTAGG + Intergenic
1035995697 8:4544192-4544214 GAGGAAACTCAGATGGCTTTAGG - Intronic
1036192749 8:6685809-6685831 CTGGAAGCTCAGCTGGGACTGGG - Intergenic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037984089 8:23275985-23276007 ATGGGAACTCAGATGGAGTGAGG - Intronic
1037993179 8:23335191-23335213 ATGGGAACCCAGATGGGGTGAGG - Intronic
1045441271 8:102214624-102214646 ATGGAAACTGAGGTGGGGCTCGG + Intronic
1048458390 8:134599020-134599042 CTGGAAACTCATATGAAGTCGGG - Intronic
1048978993 8:139693022-139693044 GTGAAAACTCAGGTGAGGTTGGG - Intronic
1049276423 8:141722347-141722369 CTGGAATGTCAGAAGGGCTTGGG - Intergenic
1051139390 9:13962212-13962234 CTGGAAACTCTGCTGAGTTTGGG - Intergenic
1052825526 9:33171302-33171324 CTGGAAACTCAGAATGGGTTGGG + Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1054719680 9:68592478-68592500 CTGGGAACTGTGGTGGGGTTGGG - Intergenic
1055340091 9:75272403-75272425 TTGGAAACTCAGAAGGGGGAAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1061427752 9:130510852-130510874 CTGAGAAGACAGATGGGGTTTGG - Intergenic
1061888635 9:133606071-133606093 CTGGAGAGTCAGGTGGGGTCCGG - Intergenic
1061906286 9:133700993-133701015 GTGGAAACTCAAAGGGAGTTTGG - Intronic
1186479343 X:9884122-9884144 CTGGAAACTGCGATGGGGGGCGG - Intronic
1186570494 X:10710161-10710183 CAGGAAATTCAGATGGGGGTTGG + Intronic
1187690437 X:21860734-21860756 CTAGCAACTGAGCTGGGGTTGGG + Intronic
1188610597 X:32091566-32091588 CTGGAAAATCTGATGGCTTTAGG - Intronic
1188675008 X:32928763-32928785 CTGTTAACTTACATGGGGTTGGG + Intronic
1188959988 X:36479377-36479399 CTGGAAACTCATGAGGGGCTAGG + Intergenic
1190875900 X:54459846-54459868 CTGGGGCCTCAGATAGGGTTGGG + Intronic
1193983765 X:88215499-88215521 CTGGAAATTAAGAATGGGTTAGG - Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1197290715 X:124653899-124653921 CTTGAAAGACAGATGGGGTGGGG - Intronic
1197645952 X:129016681-129016703 TTGGAGACTCAGAAGGGGGTAGG - Intergenic
1198233104 X:134712263-134712285 CTGGGAAGTCAGATGGGGTATGG - Intronic
1198309918 X:135421086-135421108 GTGAAAACTGGGATGGGGTTGGG + Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1199151194 X:144489203-144489225 TTGTAAAATCAGATAGGGTTTGG + Intergenic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic
1200013616 X:153140709-153140731 CTGGAAACTTAGCTGAGGCTGGG + Intergenic
1200025985 X:153259209-153259231 CTGGAAACTTAGCTGAGGCTGGG - Intergenic
1200353995 X:155528489-155528511 CTGGAGACTCAGAAGGGGAGAGG - Intronic
1201483751 Y:14470157-14470179 CTGGAAACTCACATAGGGACTGG + Intergenic