ID: 1122249049

View in Genome Browser
Species Human (GRCh38)
Location 14:100425261-100425283
Sequence GTGCACATCCTGTCACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 151}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122249041_1122249049 25 Left 1122249041 14:100425213-100425235 CCTTGGAGGCTGGTTGTGTCAGC 0: 1
1: 0
2: 0
3: 11
4: 138
Right 1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG 0: 1
1: 0
2: 0
3: 16
4: 151
1122249045_1122249049 -8 Left 1122249045 14:100425246-100425268 CCTACCTCCCTTAATGTGCACAT 0: 1
1: 0
2: 2
3: 17
4: 160
Right 1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG 0: 1
1: 0
2: 0
3: 16
4: 151
1122249044_1122249049 -4 Left 1122249044 14:100425242-100425264 CCATCCTACCTCCCTTAATGTGC 0: 1
1: 0
2: 2
3: 14
4: 196
Right 1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG 0: 1
1: 0
2: 0
3: 16
4: 151
1122249042_1122249049 3 Left 1122249042 14:100425235-100425257 CCCTTCTCCATCCTACCTCCCTT 0: 1
1: 0
2: 13
3: 306
4: 2141
Right 1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG 0: 1
1: 0
2: 0
3: 16
4: 151
1122249043_1122249049 2 Left 1122249043 14:100425236-100425258 CCTTCTCCATCCTACCTCCCTTA 0: 1
1: 0
2: 2
3: 75
4: 843
Right 1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG 0: 1
1: 0
2: 0
3: 16
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122249049 Original CRISPR GTGCACATCCTGTCACCCCA TGG Intronic
900252416 1:1678068-1678090 GCGCCCATCCTGTCTCACCAAGG + Intronic
900627405 1:3615255-3615277 GTGCACTTTCTGACCCCCCAAGG + Intergenic
901806218 1:11740252-11740274 CTGCACTTCCTGGCAGCCCAGGG - Intronic
902981232 1:20124856-20124878 CAGCACATCCTCTCAGCCCATGG + Intergenic
903220266 1:21865407-21865429 GAGGACACCCTGGCACCCCAGGG - Intronic
904505675 1:30951209-30951231 TTGTACATTTTGTCACCCCAAGG + Intronic
905381528 1:37564915-37564937 ATCCACATGCTGTCACTCCAAGG - Intronic
906727753 1:48056069-48056091 CTGCACATCCTGTGTCCCCGAGG + Intergenic
907189552 1:52637146-52637168 GTTCCCATTCTGTGACCCCAAGG + Intronic
916826925 1:168451219-168451241 GTGCCCAGCCTGCCACCACAGGG + Intergenic
919506098 1:198399217-198399239 GTTCTCATCATGTCACCCCATGG + Intergenic
920717578 1:208355193-208355215 GTGGACATCCAGGCATCCCAAGG - Intergenic
921994788 1:221406384-221406406 GTGCCCCTCCTTTCACCCCCAGG + Intergenic
922215154 1:223514308-223514330 GTGCATTTCCTGTCTCCCCTGGG + Intergenic
1063668826 10:8083379-8083401 AGGCACATCTTGTCACCCCAAGG - Intergenic
1064323702 10:14329640-14329662 GACCCCATTCTGTCACCCCATGG + Intronic
1064734147 10:18363396-18363418 GTTGAAATCCTGTCGCCCCATGG + Intronic
1070789319 10:79180210-79180232 GTGCACAGCCTGGCACCTCGGGG - Intronic
1073556479 10:104457193-104457215 CTGCACGTCCTGACAGCCCAGGG + Intergenic
1074213431 10:111360365-111360387 GTTTCCATCCTGTCACCACAGGG - Intergenic
1074425683 10:113349166-113349188 GTACACATCCTGGCTCCCAAGGG - Intergenic
1074829609 10:117239820-117239842 GTGCACATCCTGTGACATCCTGG + Intergenic
1075099053 10:119493196-119493218 ATTCACAGCCTGCCACCCCAGGG - Intergenic
1075335507 10:121606344-121606366 GTTCACTTCCTGTAACACCAGGG - Intergenic
1076108841 10:127845859-127845881 GTGCTCTTCCTGGCACACCAGGG + Intergenic
1077072659 11:683389-683411 ATGAACGTCCTGTCACTCCAAGG + Intronic
1078556655 11:12332653-12332675 GGGCTCATCATGTCACACCATGG - Intronic
1080260836 11:30348120-30348142 CTGCACTTCCTGAGACCCCAAGG - Intergenic
1084006935 11:66328107-66328129 GTGCACATCCTGCCAGCCACGGG - Intergenic
1084167049 11:67379897-67379919 GTGTCCATCCTTTGACCCCAGGG - Intronic
1084533997 11:69746184-69746206 GTGCATATCCCCTCACCCCTGGG - Intergenic
1084581715 11:70028386-70028408 GTCCACACTCTGCCACCCCAGGG + Intergenic
1085912173 11:80840506-80840528 GGGCACCTCCTATCACCACATGG - Intergenic
1089672737 11:120067684-120067706 CTGCCCATCTTGTCACCCCAGGG - Intergenic
1089979007 11:122757116-122757138 ATGCACTTACTGTCACACCAAGG + Intronic
1090104782 11:123841205-123841227 CTGCACATCCCCTCAGCCCAAGG - Intergenic
1090962771 11:131572075-131572097 ATGCACATCAGGTCAACCCACGG + Intronic
1093692332 12:22122234-22122256 GTGCAAACCCTGTCACCACCAGG - Intronic
1093844038 12:23945733-23945755 GTTCACATTCTGTCACCTAATGG - Intronic
1096701021 12:53382831-53382853 GCTCACAGCCTGTCACCTCAGGG + Exonic
1104530716 12:129568318-129568340 GAGGAGATCCTGTCACCCCCTGG + Intronic
1104692163 12:130834483-130834505 GAGCAAATCCTGCCACCACAAGG + Intronic
1108694692 13:52892657-52892679 ATGCACATCCTCTCCTCCCAAGG - Intergenic
1114792293 14:25673147-25673169 GTGGACATCCTGACCCCTCATGG - Intergenic
1117470951 14:56044152-56044174 GTGTCCATTCTGTCTCCCCAGGG + Intergenic
1117606061 14:57430548-57430570 CTGCACATGCTGCCACCACAGGG - Intergenic
1118492210 14:66272145-66272167 GTGATCATGCTGTCTCCCCAGGG + Intergenic
1119406991 14:74405277-74405299 GTGCATAACCTGCCTCCCCAGGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1122249049 14:100425261-100425283 GTGCACATCCTGTCACCCCATGG + Intronic
1122323631 14:100869768-100869790 GTCCACATCCCTTCACCCCAGGG - Intergenic
1122323818 14:100870810-100870832 GTCCACATCCCTTCACCCCAGGG - Intergenic
1125417181 15:39466181-39466203 GTGCAAATTTTGTCTCCCCATGG + Intergenic
1128169023 15:65494250-65494272 GTGCAAATACAGTCACTCCAAGG + Intronic
1129165436 15:73774593-73774615 GTCCACCTCCTCTCACCCCTGGG + Intergenic
1133282671 16:4676115-4676137 GGACACATCCAGTGACCCCATGG - Intronic
1134227650 16:12403932-12403954 GGGGTCATCCTGTCAACCCACGG - Intronic
1134295628 16:12942987-12943009 GTGACCATCCTGCCACCACAGGG - Intronic
1134490628 16:14693255-14693277 CTGTCCATCCTGTGACCCCAGGG + Intronic
1134496009 16:14732372-14732394 CTGTCCATCCTGTGACCCCAGGG + Intronic
1136471208 16:30481801-30481823 GTGCACAGTCTGTAATCCCAGGG + Intronic
1140801481 16:78492180-78492202 GTGCACACACTGTCACCTAATGG - Intronic
1142126700 16:88414124-88414146 GTCCACACCCTGTCACCCTCAGG + Intergenic
1146471921 17:33131569-33131591 CTGCAGCTCCTGTCACACCAAGG + Intronic
1148624754 17:49060739-49060761 GTGCCCTTCCTATCACCCCCAGG - Intergenic
1149328281 17:55555643-55555665 GTGCCCATGCTGACACCCCTGGG - Intergenic
1149656298 17:58311104-58311126 GTGCGCACCATGTCGCCCCACGG - Exonic
1151336763 17:73444469-73444491 GTACACTTCCTCCCACCCCAGGG - Intronic
1151665212 17:75541679-75541701 GTGCAGATCCTTTCACTCAAGGG + Intronic
1152082968 17:78199891-78199913 TCTCCCATCCTGTCACCCCAAGG - Intronic
1152491509 17:80637754-80637776 GTGGAAATTCTGTCATCCCAAGG + Intronic
1156450160 18:37262313-37262335 CAGCAGATCCTGCCACCCCAAGG + Intronic
1157587831 18:48816615-48816637 GTGCAGAGCCTGTCACACAATGG + Intronic
1158565962 18:58554514-58554536 GTGCTCCTCCTTCCACCCCATGG + Intronic
1158818531 18:61131542-61131564 GTGCACATCCTGTCTGCCCTGGG + Intergenic
1158888973 18:61855642-61855664 GTGCACAGCCAGGCACACCAGGG - Intronic
1158957290 18:62552098-62552120 GTGCACAAACTGTCACACCCCGG - Intronic
1160735016 19:658432-658454 GTGCACATCAGGAGACCCCAGGG + Intronic
1162499293 19:11042351-11042373 GTGCACCTTCTGCCAGCCCAGGG + Intronic
1165312539 19:35037530-35037552 GAGCACATCCTGGCTGCCCATGG - Intronic
1165367888 19:35380725-35380747 TTTCACCTCCTGTCACCACATGG + Intergenic
1165545853 19:36535313-36535335 GTCCATATCCTGTCACCACGTGG + Intronic
1165904888 19:39187676-39187698 CTGCAAAACCTGTCACCCCCAGG - Intergenic
1167301643 19:48681067-48681089 GTCCTCATCCTGTGACCCGAGGG + Intergenic
1168574139 19:57494311-57494333 GTACATAACCTGTCACCCTAAGG - Exonic
925351855 2:3206522-3206544 CGGCACATCCTGTCACCTAATGG - Intronic
934583731 2:95469546-95469568 TTCCACATCCTGATACCCCATGG + Intergenic
934595721 2:95607168-95607190 TTCCACATCCTGATACCCCATGG - Intergenic
934787054 2:97018321-97018343 TTCCACATCCTGATACCCCATGG + Intronic
936087530 2:109479520-109479542 CTGGACATCCCGACACCCCAGGG - Intronic
936673115 2:114682925-114682947 GTGCACATGATTTCACCACAAGG - Intronic
937076962 2:119114112-119114134 GCACACATCATGTCACCCTAGGG - Intergenic
937865463 2:126748277-126748299 GGGCACATCTGGGCACCCCAGGG + Intergenic
945266739 2:207898347-207898369 CTGCACAACCTGTCTCCCCTTGG + Intronic
946400315 2:219465114-219465136 GTGCTCACCCTGGCACCCTAGGG - Intronic
947186784 2:227462795-227462817 GTGCACATCCTGGAGCCCCGGGG + Intergenic
948429257 2:237908854-237908876 CAGCACAGCCTGTCACCCCCAGG - Intronic
1170957925 20:20998323-20998345 GCACACATGCTGTCACTCCAGGG - Intergenic
1171944225 20:31361717-31361739 GTACTCATCCTGTCACTGCATGG - Intergenic
1172491492 20:35342122-35342144 ATGCACCTTCTGTCACCTCATGG - Intronic
1172961565 20:38804241-38804263 GTTCCCATCCTCTCAGCCCATGG + Intergenic
1174080485 20:47968008-47968030 GGACACATCCTGCCTCCCCACGG - Intergenic
1174381033 20:50155540-50155562 CTGCACTACCAGTCACCCCAGGG + Intergenic
1175364179 20:58440109-58440131 GTGTACATCCTGTCACAGGAAGG + Intronic
1175808634 20:61845495-61845517 GTGCACATCCCTTCACCTCAGGG + Intronic
1176269122 20:64226316-64226338 GGGCACAGCCTGGCACCCAAAGG - Intronic
1179482373 21:41686311-41686333 TTGCACATCATGTCATCTCAAGG + Intergenic
1179637725 21:42724177-42724199 GAGCGCACCCTGTCACCCCAAGG + Intronic
1181886975 22:26029271-26029293 GTGCACCTGCTGCCACCCCCAGG + Intronic
1184661830 22:45969032-45969054 GGGCGCATCCTGTCCCCACACGG + Intronic
1185237278 22:49721499-49721521 TTGCACATCCTGGGACCCCAGGG + Intergenic
949258399 3:2077863-2077885 GGGCAGATCCTGTGAGCCCAGGG - Intergenic
950554809 3:13688980-13689002 GTGCCCAGCCTGTCACAGCACGG + Intergenic
956565502 3:70632550-70632572 GTGCACATCTTCCCACTCCAAGG - Intergenic
959419850 3:106115960-106115982 GTGTTCATCTTGTCAGCCCACGG + Intergenic
960950436 3:122995411-122995433 GTGGCCACCCTGTCATCCCAGGG - Intronic
961143447 3:124574808-124574830 GTGCCCATCCTGTCTGCTCAGGG + Intronic
962046407 3:131764649-131764671 GTTCACTTCCTGTTACCCCATGG + Intronic
968130886 3:196192273-196192295 GGGCCCTTCCTGCCACCCCACGG - Intergenic
969046930 4:4343152-4343174 GTGCAGATACTGTTGCCCCAAGG + Intergenic
969364359 4:6685600-6685622 GTGCACATGCTCCTACCCCAAGG - Intergenic
971165549 4:24179340-24179362 GTGCAGCTCCTCTCATCCCAGGG + Intergenic
971207912 4:24587854-24587876 GTGCACATCCTGGCAGCCTCTGG - Intergenic
979278590 4:118839739-118839761 TTGCACATCCTGCCAGACCAGGG - Intergenic
980454458 4:133021082-133021104 GGGCCCATCTTGTCTCCCCATGG - Intergenic
982175830 4:152704666-152704688 GTGCACATCCTGGCCCCCATTGG - Intronic
984704692 4:182839335-182839357 GAGCACATCCTGGAGCCCCAAGG + Intergenic
985709773 5:1421793-1421815 GTGCACCTCCTGTCCAGCCACGG + Intronic
986585557 5:9313316-9313338 ATGTGCATACTGTCACCCCAGGG - Intronic
988598941 5:32621577-32621599 GTGCACATCCCCGCACCCTAAGG - Intergenic
992967691 5:82020024-82020046 GCGCCCATGCAGTCACCCCATGG + Intronic
996168500 5:120258318-120258340 GTTCTCTTCCTTTCACCCCATGG + Intergenic
1001723620 5:173877479-173877501 GTGCACACCCTGGGACCCAAGGG - Intergenic
1002913589 6:1510417-1510439 GTGCATATCCTGTCTTCCCCAGG - Intergenic
1004916479 6:20337691-20337713 TTGCACATCCTTTGACACCACGG + Intergenic
1006910565 6:37560788-37560810 CTGCACATCATATCACCCCAAGG - Intergenic
1006927358 6:37664448-37664470 GTGCCCCTCCTGGCTCCCCAAGG + Intronic
1011820046 6:91242680-91242702 GTGCTCATCCTCTAAACCCATGG + Intergenic
1015718019 6:136211884-136211906 GCCCACTTGCTGTCACCCCAAGG - Intergenic
1016023562 6:139260920-139260942 GACCACATGCTGGCACCCCAAGG - Intronic
1018288792 6:162269154-162269176 CTGGAGATCCCGTCACCCCAGGG + Intronic
1018944935 6:168341110-168341132 GTGCATGTCCTGGCACCTCAGGG - Intergenic
1020687902 7:11318515-11318537 GTGCACATCCTCTAAACCAAGGG + Intergenic
1021828208 7:24574367-24574389 ATCCACATCCTGTCACCACACGG - Intronic
1024658402 7:51471577-51471599 GAGCAAAGCCTGTCAGCCCAGGG - Intergenic
1024832034 7:53472323-53472345 GTCCACATCCTTTCTCACCAGGG + Intergenic
1026325559 7:69306329-69306351 GTGCACTTACTGTCAGTCCAGGG - Intergenic
1028399788 7:90412675-90412697 GTGGACATCCCGACAGCCCATGG - Exonic
1029513045 7:101008771-101008793 GGGCACACCCAGACACCCCAGGG + Intronic
1035752760 8:2007926-2007948 GCACACATCCTACCACCCCAGGG + Intergenic
1038010449 8:23471772-23471794 GTCCATAACCTGTGACCCCAGGG + Intergenic
1041191827 8:55362849-55362871 GAGCACACCCTTTGACCCCAGGG - Intronic
1041794464 8:61731680-61731702 GGCCACATCCTGTACCCCCACGG - Intergenic
1047613965 8:126547605-126547627 CTGCCCTTCCTGTCACCCCATGG - Intergenic
1049991960 9:999171-999193 ATTCACATCCTCCCACCCCACGG + Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1054811954 9:69442137-69442159 GTCCACTTCCAGTCTCCCCAGGG + Intronic
1054989766 9:71310594-71310616 GAGCACATCTTCTCACCCAAGGG + Intronic
1056090807 9:83203789-83203811 ATGCACTTCCTCTCACCCCAGGG - Intergenic
1059140639 9:111849703-111849725 GTCCACATCATGTCCCTCCAGGG - Intergenic
1059614261 9:115931847-115931869 GAGCACAGCATGTCAGCCCAGGG - Intergenic
1060252831 9:121999868-121999890 GTTCAGATCCTGGCTCCCCAGGG - Intronic
1061165450 9:128919663-128919685 CTGCTCAGCCTGTCAGCCCATGG - Intergenic
1062030983 9:134361915-134361937 GTGCACACCCTGGCCCCCCAGGG - Intronic
1062084022 9:134639366-134639388 GTGCACTGCCTGCCTCCCCATGG - Intergenic
1187396351 X:18922904-18922926 TCTCACATCCTCTCACCCCAGGG - Intronic
1190338790 X:49280049-49280071 GTGCACATCCTGACTCCCCGGGG + Intronic
1199627070 X:149750614-149750636 CTGCCCATGCTGTCAACCCAGGG + Intergenic