ID: 1122252448

View in Genome Browser
Species Human (GRCh38)
Location 14:100449458-100449480
Sequence TGCAACAGCCAGCCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 303}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122252448_1122252458 5 Left 1122252448 14:100449458-100449480 CCCTGCCCTGGCTGGCTGTTGCA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1122252458 14:100449486-100449508 GTGGGAGAGGCTGTCTCAGCTGG 0: 1
1: 0
2: 2
3: 20
4: 280
1122252448_1122252462 29 Left 1122252448 14:100449458-100449480 CCCTGCCCTGGCTGGCTGTTGCA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1122252462 14:100449510-100449532 TCTCTGGAAAAGCTGAGGTCAGG 0: 1
1: 0
2: 1
3: 24
4: 305
1122252448_1122252459 6 Left 1122252448 14:100449458-100449480 CCCTGCCCTGGCTGGCTGTTGCA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1122252459 14:100449487-100449509 TGGGAGAGGCTGTCTCAGCTGGG 0: 1
1: 0
2: 1
3: 26
4: 268
1122252448_1122252461 24 Left 1122252448 14:100449458-100449480 CCCTGCCCTGGCTGGCTGTTGCA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1122252461 14:100449505-100449527 CTGGGTCTCTGGAAAAGCTGAGG 0: 1
1: 1
2: 3
3: 45
4: 448
1122252448_1122252460 13 Left 1122252448 14:100449458-100449480 CCCTGCCCTGGCTGGCTGTTGCA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1122252460 14:100449494-100449516 GGCTGTCTCAGCTGGGTCTCTGG 0: 1
1: 0
2: 1
3: 35
4: 253
1122252448_1122252457 -8 Left 1122252448 14:100449458-100449480 CCCTGCCCTGGCTGGCTGTTGCA 0: 1
1: 0
2: 1
3: 28
4: 303
Right 1122252457 14:100449473-100449495 CTGTTGCATTGGGGTGGGAGAGG 0: 1
1: 1
2: 1
3: 31
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122252448 Original CRISPR TGCAACAGCCAGCCAGGGCA GGG (reversed) Intronic
900111337 1:1006901-1006923 TGCAACAGCCATCCCGAGCAAGG + Intergenic
900141423 1:1140766-1140788 TTCACCAGGCAGCCAGGGAACGG + Intergenic
901454546 1:9355556-9355578 TGTGACAGCTAGCCAGGGAACGG + Intronic
901629651 1:10641923-10641945 TTCTGCAGCCAGCCAGGCCAAGG - Intronic
901857584 1:12054196-12054218 TCCCACAGCCAGTCAGTGCAGGG - Intergenic
902122270 1:14176437-14176459 TGCCACAGCTGCCCAGGGCAGGG + Intergenic
902779100 1:18693101-18693123 TGCAGAAGACAGCCAGGGAATGG - Intronic
902965263 1:19996329-19996351 GGCAGCAGCCTGGCAGGGCAAGG + Intergenic
903995105 1:27300683-27300705 TGGATCAGTCAGCCAGGACAGGG + Intronic
905173432 1:36122578-36122600 GGCCACAGCCATCCAGTGCAAGG + Intronic
905186480 1:36200674-36200696 AGCACCAGCCAGCCAGGGTGTGG + Intergenic
905461664 1:38126390-38126412 AGCTTCAGCCAGCCACGGCAGGG + Intergenic
906132692 1:43470315-43470337 TGCAAAAGCCAGATGGGGCATGG - Intergenic
906141497 1:43536488-43536510 TGCCACACCCAGCCACAGCAGGG - Intronic
906878034 1:49559033-49559055 TGGCAAAGCCAGCCAGGCCATGG - Intronic
909239222 1:73191313-73191335 TGCCACAGACAGCCATGGCTAGG + Intergenic
911112353 1:94203579-94203601 TGCAAAAATTAGCCAGGGCATGG + Intronic
911761266 1:101620026-101620048 TGAAACAGGAAGCCAGGGCAGGG + Intergenic
912143118 1:106756183-106756205 TGGAGCTGCCAGCAAGGGCATGG + Intergenic
912174489 1:107140219-107140241 TGCAACTGCCAGCAAGTGGAAGG - Intronic
912720024 1:112012189-112012211 TGCAGCAGAGAGCCTGGGCAAGG + Intergenic
915600921 1:156922938-156922960 TGCAGGAGCCAGCCAGACCAGGG + Intronic
916428224 1:164702148-164702170 TCATACTGCCAGCCAGGGCAAGG - Intronic
916786318 1:168089654-168089676 ACCAACAGCCAGCCTGGGGATGG + Intronic
918301170 1:183205178-183205200 TCCAAAAGGCATCCAGGGCAGGG + Intronic
919924716 1:202186377-202186399 GGCAAGGGCCACCCAGGGCATGG + Intergenic
920108397 1:203570373-203570395 TTCAACACCCAGACAGGGAATGG + Intergenic
922699502 1:227750608-227750630 CTCAGCAGCGAGCCAGGGCAGGG - Intronic
922776424 1:228216169-228216191 TGGAACAGCCAGGCATGGGATGG - Intronic
1066011008 10:31193332-31193354 AGCAGCAGCCACCCAGAGCAAGG + Intergenic
1067121209 10:43473732-43473754 TACAACAGCCAGGCTGGGCAAGG + Intronic
1067524556 10:47030284-47030306 TGCATCAGCCACCGAGGGCCTGG - Intergenic
1069203543 10:65653655-65653677 TCAAAAAGCCAGACAGGGCATGG + Intergenic
1069642312 10:69963840-69963862 AGGTACAGCCAGCCAGGGCAGGG + Intronic
1070087565 10:73251955-73251977 TGGTGCAGCCACCCAGGGCAAGG + Exonic
1070608038 10:77913265-77913287 TGAAACAACCGGCCTGGGCAAGG + Intronic
1070792417 10:79197200-79197222 TTTCACAGCCAGCCAGGACAGGG - Intronic
1070919054 10:80172641-80172663 TGGGACAGCCAGCCGAGGCAGGG - Intronic
1071335486 10:84597067-84597089 TTCAAAAGCCACCAAGGGCAGGG - Intergenic
1072272117 10:93786882-93786904 TGTAACAGGTTGCCAGGGCATGG - Intronic
1072754851 10:98012540-98012562 TGCATCTGGCAGCCAAGGCAAGG + Intronic
1073068599 10:100779346-100779368 TGCAGCAGTCAGTGAGGGCAGGG + Intronic
1076016111 10:127028715-127028737 TGCAAGAACCAGCTAGGGCGTGG + Intronic
1076480425 10:130781644-130781666 TGCACCAGGCAGAAAGGGCAGGG - Intergenic
1076838345 10:133032428-133032450 GGCAAGAGCTAGCCGGGGCACGG + Intergenic
1076905370 10:133358311-133358333 GGCAACACCCAGCCAGCCCACGG + Intergenic
1077183016 11:1224782-1224804 TGGAAAAGCCAGGCAGGGCCAGG + Intronic
1077374138 11:2197665-2197687 TGACACTGCCAGGCAGGGCAGGG + Intergenic
1077581619 11:3420923-3420945 TGAAGCAGCCAGCCATGGGAAGG - Intergenic
1078085937 11:8233057-8233079 TGCAGAGGCCAGCCTGGGCACGG - Intronic
1079348332 11:19672104-19672126 GGGAACAGCAAGCCAGGGGATGG + Intronic
1083832446 11:65241517-65241539 TTCAAGAGCCAACCAGGGCAGGG + Intergenic
1083859779 11:65413903-65413925 TGCAGCAGCCACCCAGGACCTGG + Intergenic
1083877118 11:65530155-65530177 TGCCCAATCCAGCCAGGGCAGGG + Intronic
1084133307 11:67154727-67154749 TGAAACACCCAGGCTGGGCATGG - Intronic
1084238529 11:67803745-67803767 TGAAGCAGCCAGCCATGGGAAGG - Intergenic
1084833886 11:71789088-71789110 TGAAGCAGCCAGCCATGGGAAGG + Intronic
1084934052 11:72577586-72577608 TGCAACAGCCTGCGGGTGCATGG + Exonic
1088964585 11:114705476-114705498 TGGAACAGCCAGCCAGAGTCAGG - Intronic
1090395104 11:126413833-126413855 TCCAAGAGCCAGCCTGGGGAAGG + Intronic
1091795102 12:3293621-3293643 TCCAAGAGCCGTCCAGGGCAGGG + Intergenic
1091795289 12:3294493-3294515 TGCCAGAGCCAGCCTGGGCAGGG - Intergenic
1092409220 12:8241370-8241392 TGAAGCAGCCAGCCATGGGAAGG - Intergenic
1093247501 12:16757845-16757867 TGCAACTGCATGCCAAGGCAGGG + Intergenic
1094684574 12:32698373-32698395 TGACACAGCCAGCCAGCCCAAGG - Intronic
1097162448 12:57057520-57057542 AGCCACAGGCAGGCAGGGCAAGG + Exonic
1101882036 12:108632187-108632209 GGCATCAACCACCCAGGGCACGG + Intronic
1101956890 12:109219848-109219870 TGCAACACGCAGCCAGGACTGGG + Intronic
1102025581 12:109712654-109712676 ACCAACAACCAGCAAGGGCAGGG + Intergenic
1102524322 12:113500525-113500547 TCCAACAGCCTGCCTGGACAGGG + Intergenic
1102574131 12:113845150-113845172 TCCAGCAGCCGGCCAGGGCTCGG - Intronic
1103874060 12:124113802-124113824 TGCAGAAGCCAGGCAGGGCTTGG - Intronic
1104990744 12:132622559-132622581 CCCCACAGCCAGCCAGGCCACGG + Intergenic
1105813121 13:24011513-24011535 GGCATCAGCCAGCCAGGACAGGG - Intronic
1108180885 13:47838745-47838767 AGCAACTGCCAGCCAGGGCTTGG + Intergenic
1110795854 13:79637230-79637252 TGCAATGTGCAGCCAGGGCAGGG + Intergenic
1112300715 13:98227230-98227252 TGCAACAGGAGGCCAGGGCGCGG - Intronic
1113377510 13:109779318-109779340 TCTAAGAGCCAGGCAGGGCAGGG + Intronic
1113424087 13:110193650-110193672 TGCGGCTGCCAGCCAGGGCAGGG - Intronic
1114195070 14:20469701-20469723 TGCGGCAGCCAGCGCGGGCAGGG + Intronic
1115378202 14:32702731-32702753 GGCCAGAGCCAGCCAGGCCAGGG - Intronic
1115448236 14:33516836-33516858 TCCAAAGGCCAGGCAGGGCAGGG - Intronic
1116410218 14:44612283-44612305 TTTAACAGCCAGCCAAGCCAGGG + Intergenic
1117976204 14:61299258-61299280 TGCAATGGCCAGCCAGTGCCTGG + Intronic
1118053643 14:62056240-62056262 TGCAAAATCCAGCTTGGGCAAGG + Intronic
1118259712 14:64235617-64235639 TGCCGCAGCCAGCCATGGCAGGG + Intronic
1119427788 14:74547023-74547045 GGCAGCAGCCAGCCCTGGCATGG + Intronic
1119433669 14:74584438-74584460 TTCAAGGGCCAGCCAGGGCAGGG - Intronic
1120867682 14:89309662-89309684 TTCCACAGCCAGCCAAGGCCCGG + Intronic
1120969287 14:90193856-90193878 GGAAACAGCCAGAGAGGGCAGGG + Intergenic
1121423784 14:93833848-93833870 TGTGACAGACAGACAGGGCATGG - Intergenic
1121446249 14:93981040-93981062 AGCAAGAGGCAGCCAGGGCTGGG - Intergenic
1121699349 14:95940622-95940644 TGCAGCAGCAAGTCAGGGCAGGG - Intergenic
1122247195 14:100411824-100411846 AGCAAAAACCAGGCAGGGCATGG - Intronic
1122252448 14:100449458-100449480 TGCAACAGCCAGCCAGGGCAGGG - Intronic
1122686910 14:103513062-103513084 TGCACCAGACAGCCAGAGCCTGG + Intergenic
1122787158 14:104169054-104169076 TGCCCCAGCCAGCCAGGCCTGGG - Intronic
1123900121 15:24868337-24868359 GACAACAGCCAGCCAAGGAATGG - Intronic
1124098400 15:26670312-26670334 TGCAGCAGCAGGGCAGGGCACGG + Intronic
1126111200 15:45175670-45175692 TGCAACAGCCAGCGAGGGCTGGG + Intronic
1126794713 15:52250738-52250760 GGCAACACCCAACCAGGACATGG + Intronic
1128186097 15:65644588-65644610 GGCAGCAGCCAGCCAGGCCAGGG + Intronic
1128801125 15:70497820-70497842 TGTTAAAGCCAGGCAGGGCAGGG - Intergenic
1129134186 15:73531746-73531768 AGCAACAGCCAGCCATTGCAGGG + Intronic
1130052746 15:80497413-80497435 GCCAACAGCCAGCAAGGGCATGG + Intronic
1131091455 15:89627697-89627719 TCCAAGAGCCAGCCAGTTCAGGG + Exonic
1131807860 15:96141792-96141814 TGCAGCAGACAGCAAGTGCAAGG + Intergenic
1133263700 16:4569995-4570017 GGATACAGCCAGCAAGGGCAGGG - Intronic
1133350190 16:5096173-5096195 TGAAGCAGCCAGCCATGGGAAGG - Intronic
1136428890 16:30185885-30185907 GGCAGCAGCCAGCCAGCGGAGGG - Intronic
1137000444 16:35225186-35225208 TGCAGCAGCCAGCCTGGGCGAGG + Intergenic
1137293176 16:47066025-47066047 GGTAAAAGCCAGCCAGGGGAGGG + Intergenic
1138126947 16:54447016-54447038 TCCGACAGGCAGCGAGGGCAGGG - Intergenic
1138454842 16:57115351-57115373 GTCACCAGCCAGCCAGGGCGGGG + Intronic
1139041721 16:63006114-63006136 TGCAAGAGCAAGGCGGGGCATGG + Intergenic
1139504338 16:67391602-67391624 AGCAAGAGCCAGTCTGGGCACGG + Exonic
1140616530 16:76671171-76671193 CTCAAGAGCCAGCCAGGGCTAGG + Intergenic
1140633165 16:76879469-76879491 TTGAACAGCAAGCCAGGACATGG + Intergenic
1141710472 16:85695995-85696017 TGCAGCATCCCACCAGGGCAGGG + Intronic
1141724776 16:85780559-85780581 TGCCCCAGCCAGCGTGGGCACGG - Intronic
1142102994 16:88285478-88285500 TGCCACAGCCAGCGTGGGCAGGG + Intergenic
1142975462 17:3641113-3641135 TGCAACAGCCCAGCAGGGCTAGG + Intronic
1143280176 17:5748045-5748067 TTCACCAGCCAGGGAGGGCATGG + Intergenic
1144732455 17:17536613-17536635 CACAGGAGCCAGCCAGGGCATGG - Intronic
1147120306 17:38331577-38331599 AGGAACAGACAGCCAGGGGATGG - Intronic
1149645190 17:58235740-58235762 TGCAACCACCAGTCAGTGCAAGG - Intronic
1151371643 17:73650336-73650358 TGCAACTGCCAGACAGGAGAGGG + Intergenic
1151672268 17:75577702-75577724 CCCCACAGCCATCCAGGGCAAGG + Intergenic
1151837014 17:76588377-76588399 TGCAGCACTCAGCCAGGCCAGGG - Intergenic
1152251181 17:79213445-79213467 AGCAACAGCCAGACGGGGGAGGG + Intronic
1152654634 17:81514059-81514081 GACAACAGCGAGTCAGGGCAAGG + Intronic
1152765324 17:82134182-82134204 TGCAACAGCCACCCTGGGAATGG + Intronic
1154206757 18:12344094-12344116 TGCACTAGGCAGCCAGTGCATGG - Intronic
1155083249 18:22431083-22431105 TGCATAAGCCACCCAGGCCATGG - Intergenic
1155261731 18:24050050-24050072 GGCACCAGCCAGCCAGGCCTGGG - Intronic
1156296796 18:35799569-35799591 GGCACCAGCCAGCCAGTCCAAGG + Intergenic
1157406517 18:47426465-47426487 TGGAACCACCAGCCAGGGAAAGG + Intergenic
1160399317 18:78598468-78598490 GGAAACAGCCAGCCCGGTCATGG + Intergenic
1160823672 19:1069533-1069555 TGGCTCACCCAGCCAGGGCAGGG + Intronic
1160994229 19:1875053-1875075 TGCAAAATCCAGCTTGGGCAAGG + Intergenic
1161156682 19:2735469-2735491 GCCAACAGCCAGCCAGGACACGG - Intronic
1161653776 19:5500677-5500699 TGGAACAGCCAGTCAGGTGAGGG - Intergenic
1161704809 19:5814657-5814679 AGCAACAGACAGCCAGCGCAAGG - Intergenic
1163003338 19:14382398-14382420 TGACACAGACAGCCAGGGCGTGG - Intronic
1163228398 19:15980602-15980624 TCCAAAAGCCAGCCAGGGAGGGG + Intergenic
1164484366 19:28642067-28642089 TGCAACAGTCAGTATGGGCAAGG - Intergenic
1166092322 19:40518013-40518035 TGCAAGAAACAGGCAGGGCATGG + Intronic
1166978101 19:46616906-46616928 GGCCACAGCCTGCCATGGCAAGG - Intergenic
1168540138 19:57203124-57203146 TGGAAAAGCAAGACAGGGCATGG + Intronic
1168630108 19:57949856-57949878 AGCAGCAGCGAGCCAGAGCAGGG - Intergenic
926208954 2:10854648-10854670 TGCAACAGTCAGTCTGGACATGG - Intronic
927574368 2:24189388-24189410 GGCAACAGCCTGGCAGGTCAGGG - Intronic
928395693 2:30941890-30941912 TGCAACAGCCAGGAAGACCAAGG - Intronic
929397268 2:41537253-41537275 TGCAACAATTAGCCAGAGCAAGG - Intergenic
929406615 2:41649843-41649865 AGGAACAGCCAGCCAGGAAAAGG + Intergenic
929887994 2:45895464-45895486 TGGTACAGCCACCCAAGGCATGG + Intronic
931984099 2:67725027-67725049 TTCAACAGGCAGTCATGGCAAGG - Intergenic
933151371 2:78919177-78919199 TGCAGAAGCCAGCCTGGGCTGGG + Intergenic
934645869 2:96059201-96059223 GGCAAGAGCAAGGCAGGGCAGGG - Intergenic
934839272 2:97615291-97615313 GGCAAGAGCAAGGCAGGGCAGGG - Intergenic
935836908 2:107064731-107064753 GCCAACGGCCAGCCATGGCACGG + Intergenic
937039580 2:118810549-118810571 TGCACCAGGCAGCAAGAGCAGGG + Intergenic
938403641 2:131014955-131014977 GGCAACCCGCAGCCAGGGCAGGG - Intronic
941470538 2:165880173-165880195 TGCAACATCCAGCCTGGGACTGG + Intronic
942035243 2:172004186-172004208 TGTAATAGCCAGGCAGGGGAGGG + Intronic
943597175 2:189872274-189872296 TGCATCTGCCAACCAGGTCAAGG + Intronic
946047247 2:216831439-216831461 TGGAGGAGCCAGCCTGGGCAGGG + Intergenic
946335444 2:219032439-219032461 TGCCACAGCGAGTGAGGGCAGGG - Intronic
947135661 2:226974525-226974547 AGCAACACCCAGGCCGGGCACGG - Intronic
948075880 2:235164907-235164929 AGCAGCAGCCAGCCATGCCATGG - Intergenic
1171389050 20:24789548-24789570 GGGCACAGCCAGGCAGGGCATGG + Intergenic
1171769785 20:29313675-29313697 GGCAAAGGCCAGCCAGGGGAGGG + Intergenic
1172152685 20:32801450-32801472 TGTCACAGACAGCCAGGGCAGGG + Intronic
1172786169 20:37470172-37470194 TGCACCAGCGAGCAAGGGGAAGG - Intergenic
1173049946 20:39549800-39549822 GGGAAGAGCCAGGCAGGGCAGGG - Intergenic
1173638374 20:44581024-44581046 TGCCGCAGCCAGCCTGGGAAAGG - Intronic
1174484126 20:50850953-50850975 TCCTACAGGCAGCCCGGGCAGGG - Intronic
1175311038 20:58011725-58011747 TCCAAGGGCCAGCCAGTGCAAGG + Intergenic
1175455849 20:59113283-59113305 TGGTGCAGCCACCCAGGGCAAGG - Intergenic
1176269199 20:64226835-64226857 TACAACAGCCAGGCCTGGCATGG + Intronic
1178531480 21:33380038-33380060 AGCAACAGCAAGTCATGGCAGGG - Intergenic
1178643279 21:34363810-34363832 TGCCAGCTCCAGCCAGGGCAGGG - Intergenic
1178886357 21:36488106-36488128 TGCAACATCCAGCCAGAAAAAGG + Intronic
1179629062 21:42665613-42665635 AGCAAGGGCCGGCCAGGGCAGGG - Intronic
1179994106 21:44966102-44966124 TGCTACAGGGACCCAGGGCAGGG + Intronic
1180038661 21:45264621-45264643 TGCACCTGCCAGCCGGGGCGAGG + Exonic
1181052935 22:20246260-20246282 TGCGGCAGCCAGACTGGGCAGGG + Intronic
1181618581 22:24071882-24071904 TCCAACACCCAGGGAGGGCAAGG - Intronic
1181635569 22:24172856-24172878 TCCACCTGCCACCCAGGGCAGGG + Intronic
1183505149 22:38204584-38204606 AGAAACAGGAAGCCAGGGCAGGG + Intronic
1183663738 22:39235622-39235644 GGCCACACCCATCCAGGGCAGGG - Intronic
1184230588 22:43156339-43156361 TCCAGCACCCAGCCAGGGCCAGG - Intronic
1184683440 22:46085277-46085299 TGCACCTGCGTGCCAGGGCACGG + Intronic
1184717798 22:46291662-46291684 TGCCACAGACAGGCCGGGCACGG + Intronic
1185315919 22:50179052-50179074 GACACCAGCCAGCCTGGGCAAGG + Exonic
1185419299 22:50726644-50726666 TGCAGCAGGCCACCAGGGCAGGG - Intergenic
1203301265 22_KI270736v1_random:78759-78781 TGCAATAGACAGCCATGGAATGG + Intergenic
949529288 3:4938400-4938422 TGCTGCAGCCATCTAGGGCAGGG + Intergenic
950694851 3:14690933-14690955 TCAAACAGCCAGCCAGGGGCTGG - Intronic
952837850 3:37619559-37619581 TGCATCTGCCAGCTAGGGAATGG + Intronic
953057862 3:39402626-39402648 TGTAACAACCAGGCTGGGCACGG + Intergenic
953420197 3:42748331-42748353 TGGAAGAGTCAGCCAGGGCAGGG - Intronic
954072262 3:48151552-48151574 TGCAGCTGGAAGCCAGGGCAGGG + Intergenic
958264927 3:91426908-91426930 TGGAACACCCAGAGAGGGCATGG + Intergenic
960056282 3:113278750-113278772 AGCAGCAGCCAGCCAGACCACGG + Exonic
960514559 3:118589406-118589428 GGCAACAGCCAGCAAGGAAATGG + Intergenic
961300365 3:125918169-125918191 TGAAGCAGCCAGCCATGGGAAGG + Intergenic
961451983 3:127006375-127006397 TAGAGGAGCCAGCCAGGGCAAGG + Intronic
961888144 3:130109898-130109920 TGAAGCAGCCAGCCATGGGAAGG - Intronic
962450846 3:135515783-135515805 TCCAAGAACCAGCCAGGGCACGG + Intergenic
962739911 3:138355988-138356010 TGCAAAAGCCAGCGAAGGCTGGG + Intronic
967382318 3:188872777-188872799 TGCCACAGACTGGCAGGGCAGGG - Intronic
968659607 4:1793631-1793653 TGCAGCAGCCAGGGAGGGAAGGG + Intronic
968726993 4:2252364-2252386 TGAGGCAGCCAGACAGGGCAGGG + Intronic
968911127 4:3477469-3477491 TGCAAAGGCCAGCTGGGGCACGG + Intronic
968997294 4:3953846-3953868 TGAAGCAGCCAGCCATGGGAAGG - Intergenic
969086456 4:4660122-4660144 AGGAACAGCCAGCCAGAGCAAGG + Intergenic
969485247 4:7468622-7468644 TGCAACAGCAAGGCCTGGCATGG + Intronic
969601525 4:8179339-8179361 TGCACCTTCCAGCGAGGGCATGG - Intergenic
969756720 4:9154836-9154858 TGAAGCAGCCAGCCATGGGAAGG + Intergenic
970345787 4:15150765-15150787 AGCATGAGCCAGCCAAGGCATGG - Intergenic
970429111 4:15972416-15972438 TGCAAGAGACAGACAGGGAATGG + Intronic
970956621 4:21819163-21819185 TGCAACAGGAAGCCCTGGCAGGG - Intronic
973808347 4:54546815-54546837 TGCCACAGCAAGTCAGGGTAGGG - Intergenic
977127529 4:93188374-93188396 AGCAACAGTAAGACAGGGCAAGG + Intronic
979693378 4:123584305-123584327 TCCCAGAGGCAGCCAGGGCAGGG - Intergenic
981706170 4:147661468-147661490 TTCAACAGCCACCCAGGAAATGG + Intronic
983193471 4:164779920-164779942 TGCAGCAGCCAGCCAGTAGACGG + Intergenic
984709841 4:182875841-182875863 TGCACCAGGCAGGGAGGGCAGGG + Intergenic
984791005 4:183615013-183615035 TGCAAAAGCCAGGAAAGGCAAGG + Intergenic
985708097 5:1413343-1413365 TGCAACAGAAAGCCAGGGTCGGG - Intronic
986105888 5:4658962-4658984 TCCACCAGCCAGCCAGGACAGGG - Intergenic
988264544 5:28930482-28930504 TGATCCAGCCAGCCAGGACATGG - Intergenic
988480559 5:31626964-31626986 TGCCACATCTAGCGAGGGCAGGG + Intergenic
992641543 5:78772488-78772510 CGCCACAGGCAGCCAGGGCCGGG - Intergenic
994017913 5:94989894-94989916 TGTCACAGCCAGAGAGGGCATGG + Intronic
994107245 5:95961435-95961457 CGCAGCGGCCAGGCAGGGCAGGG - Intronic
996399509 5:123046369-123046391 TGCTGCAGCCAGCCAGGCCCAGG + Intergenic
996566713 5:124887351-124887373 GGCAACACACAGCCAGGGCCTGG + Intergenic
997480033 5:134177825-134177847 TGAACCAGGCAGCCAGGGCCCGG + Intronic
997507430 5:134428954-134428976 AACAACAGCCAGCCAGGCAAAGG - Intergenic
1000070820 5:157739543-157739565 TGCTACAGCCACCTAAGGCAAGG - Exonic
1000925885 5:167193483-167193505 TGTAACAGACAGAAAGGGCAGGG + Intergenic
1003182003 6:3799947-3799969 TGCAAAGGCCAGGCAGGGTATGG + Intergenic
1003348619 6:5294761-5294783 TGGAACACCCAGGGAGGGCATGG - Intronic
1003388899 6:5695316-5695338 TGCCACAGCAAGCCAGGGACTGG + Intronic
1003825778 6:9949933-9949955 TTCAAAAGTCTGCCAGGGCATGG + Intronic
1004068894 6:12278594-12278616 TGCAAAAGCCAGCTTGGGCCAGG + Intergenic
1004517748 6:16335053-16335075 TCGAACACCCAACCAGGGCAGGG - Intronic
1005363818 6:25057394-25057416 GGCAATAGCCAGCAGGGGCAGGG + Intergenic
1007252317 6:40504144-40504166 TGCAACAACCAGCCTTGGAATGG - Intronic
1008789002 6:55205815-55205837 TATACCAGGCAGCCAGGGCAAGG - Intronic
1008990456 6:57595752-57595774 TGGAACACCCAGAGAGGGCATGG - Intronic
1009179032 6:60494298-60494320 TGGAACACCCAGAGAGGGCATGG - Intergenic
1009670365 6:66740891-66740913 TGAAACTGCCAACCAGGGGAGGG - Intergenic
1011208086 6:84923208-84923230 GCCAGCAGCCAGCCAGGTCAGGG - Intergenic
1011347632 6:86389348-86389370 TTCCACAGACATCCAGGGCAGGG - Intergenic
1011729736 6:90248804-90248826 TGCAACAGGAAGCCATGGCAGGG + Intronic
1011733629 6:90291947-90291969 TTCAACATCCAGACAGGGAAAGG + Intronic
1012518679 6:100093567-100093589 TGCAACACCAGGCCAGGGCTCGG + Intergenic
1012818326 6:104053330-104053352 TGCATTAGCTAGCCAGTGCAAGG + Intergenic
1013035873 6:106382088-106382110 TGCAACAGCCAGGGAGGGGCAGG + Intergenic
1016647463 6:146426399-146426421 AGAAACAGCCAGGCAGAGCAAGG + Intronic
1017317943 6:153054358-153054380 TGCAAGACCGAGGCAGGGCATGG + Intronic
1019056665 6:169228484-169228506 TCAAAAAGCCAGTCAGGGCAGGG + Intronic
1019333933 7:473772-473794 TCCAACAGCCAACCAGGGGGAGG + Intergenic
1019385742 7:755105-755127 TGCACCAGACAGACAGGGCCCGG + Intronic
1019706775 7:2500520-2500542 TGCAGGAGAGAGCCAGGGCAGGG - Intergenic
1021837400 7:24693288-24693310 GCCAACAGCAAGCCAGGGGAAGG + Exonic
1022405908 7:30089650-30089672 TGCTACAGCCAGAAAGGGGATGG + Intronic
1022921617 7:35021723-35021745 TACAACAGCCATGCAGTGCAGGG - Intronic
1023200049 7:37687159-37687181 TCCCACAGCTACCCAGGGCAGGG + Intronic
1023609810 7:41961366-41961388 TGCACCAGCCAGAGAGCGCACGG - Exonic
1023818143 7:43965781-43965803 GGCTACAGGCAGGCAGGGCAGGG - Intergenic
1023872707 7:44271478-44271500 TGTAGGAGCCAGCCAGGTCATGG - Intronic
1024031849 7:45468202-45468224 TGCAGCAGCCAGCCTGGGGGAGG - Intergenic
1024175967 7:46841444-46841466 CGCATCAGCAAACCAGGGCAAGG + Intergenic
1025155976 7:56606158-56606180 CACAACTGCCAGCCAGGACAGGG + Intergenic
1026224288 7:68427072-68427094 TGCACCTGCCTGCCAGTGCAGGG - Intergenic
1026735249 7:72945126-72945148 AGCCAGAGCCAGTCAGGGCAAGG + Intronic
1026785591 7:73300055-73300077 AGCCAGAGCCAGTCAGGGCAAGG + Intergenic
1027044488 7:74982370-74982392 TGCCCCAGCCACCCAGGGCTTGG + Intronic
1027108476 7:75419881-75419903 AGCCAGAGCCAGTCAGGGCAAGG - Intronic
1029093184 7:98064564-98064586 TGCAACAGAGAGGCTGGGCATGG + Intergenic
1029388382 7:100258569-100258591 TGCCCCAGCCACCCAGGGCTTGG - Intronic
1029418008 7:100455811-100455833 AGCAACAGCAAGGCCGGGCACGG - Intergenic
1029742769 7:102500613-102500635 GGCTACAGGCAGGCAGGGCAGGG - Intronic
1029760759 7:102599774-102599796 GGCTACAGGCAGGCAGGGCAGGG - Intronic
1030299627 7:107962191-107962213 TGCACCAGCCAGCCCGAGCCAGG - Intronic
1031068494 7:117134975-117134997 TGCAATAGCCAGCTAGGAAAAGG - Intronic
1032388360 7:131539759-131539781 TGCAGCACCCAGACTGGGCACGG - Intronic
1032721443 7:134553517-134553539 GGCAACAGCAAGCCAGGTCCAGG + Intronic
1035569131 8:660460-660482 AGCATCAGCCAGCAAGGACACGG + Intronic
1036379955 8:8230156-8230178 TGAAGCAGCCAGCCATGGGAAGG + Intergenic
1036849603 8:12192506-12192528 TGAAGCAGCCAGCCATGGGAAGG - Intronic
1036870965 8:12434779-12434801 TGAAGCAGCCAGCCATGGGAAGG - Intronic
1038356840 8:26837358-26837380 TACAATAGCCAGGCTGGGCATGG + Intronic
1038707722 8:29910396-29910418 GCCAACACCCAGCCAGGGGAAGG + Intergenic
1038813532 8:30877148-30877170 TGAAACAACAAGGCAGGGCATGG + Intronic
1039216528 8:35278084-35278106 TTTAACAGCCAGCCAGGACTGGG + Intronic
1041068307 8:54102773-54102795 TGCCACTGCCAGCTAGGGGATGG - Intergenic
1041170276 8:55134722-55134744 TGCAAGAGCCCACCAAGGCAGGG - Intronic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1045290377 8:100827699-100827721 TACCACATGCAGCCAGGGCAAGG - Intergenic
1046761907 8:118030263-118030285 TATAAAAGCCAGCCTGGGCAGGG + Intronic
1047044990 8:121042400-121042422 TGCAACAAGCAGCCAGAGAAAGG + Intergenic
1048759021 8:137770996-137771018 TGCAACTGCCAGCAAGGACAAGG + Intergenic
1048961719 8:139585204-139585226 TGCTACTGCCACCCAGGCCAGGG + Intergenic
1049172522 8:141170638-141170660 TGCACCAGCCAGGCAGGGCGGGG + Intronic
1051088403 9:13378822-13378844 TGCCACACCCAGGCTGGGCATGG + Intergenic
1051094100 9:13445297-13445319 CCAAAAAGCCAGCCAGGGCATGG + Intergenic
1051721430 9:20041504-20041526 TGGAACATCCACCCAGGACAGGG + Intergenic
1052249697 9:26383296-26383318 TGAGACAGCAAGCCAGAGCATGG + Intergenic
1052972143 9:34383130-34383152 TGAATCAGCCAGCCTGGACAAGG + Intronic
1053506536 9:38648361-38648383 TGCAACAGTCAGGCCAGGCATGG + Intergenic
1056378511 9:86036522-86036544 CAGGACAGCCAGCCAGGGCAGGG + Intronic
1056448896 9:86695610-86695632 TGCAACAGCCTTCCAAGGCCAGG - Intergenic
1056754576 9:89373710-89373732 TCCCCCAGCCACCCAGGGCAGGG - Intronic
1057714382 9:97479413-97479435 TGGAACAGCCATGCAGGGCCAGG + Intronic
1058769360 9:108215308-108215330 AGGAACAGCCACACAGGGCAAGG - Intergenic
1058979745 9:110158059-110158081 TGCAGCAGCTACCCAGGGCCGGG - Intronic
1059244055 9:112834520-112834542 TGCTACACCCAGGGAGGGCATGG - Intronic
1060587034 9:124793098-124793120 GGAAACAGCCAGCCAGGACCAGG + Intronic
1060727884 9:126017773-126017795 AGCACCAGCCAGCCAGGACCAGG - Intergenic
1061933156 9:133843702-133843724 TGGAGCAGGCAGCCCGGGCAGGG + Intronic
1062514642 9:136926457-136926479 TCCCACAGCCAGCCTGGCCAAGG - Exonic
1185505612 X:630716-630738 TGCACCAGACAGGCAGCGCATGG + Exonic
1187160681 X:16762743-16762765 TCCAACATACTGCCAGGGCATGG - Exonic
1187585544 X:20657412-20657434 TGAAAGAGCCAGCCTTGGCAAGG + Intergenic
1189177706 X:38974532-38974554 TTAAAAAGCCAGGCAGGGCATGG + Intergenic
1198157927 X:133981161-133981183 CACAATAGCCAGCCTGGGCAAGG - Intronic
1200134196 X:153866992-153867014 AGCAACAGACACCCAGGTCATGG + Intronic
1201226170 Y:11820924-11820946 TGCAACAGGGAGCCATGGGAAGG + Intergenic