ID: 1122252647

View in Genome Browser
Species Human (GRCh38)
Location 14:100450821-100450843
Sequence CAGATTAAGCACACTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122252641_1122252647 -1 Left 1122252641 14:100450799-100450821 CCAGAGCCCCTCTTACTGTGTGC 0: 1
1: 0
2: 2
3: 20
4: 169
Right 1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 12
4: 217
1122252644_1122252647 -9 Left 1122252644 14:100450807-100450829 CCTCTTACTGTGTGCAGATTAAG 0: 1
1: 0
2: 2
3: 21
4: 217
Right 1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 12
4: 217
1122252643_1122252647 -8 Left 1122252643 14:100450806-100450828 CCCTCTTACTGTGTGCAGATTAA 0: 1
1: 0
2: 3
3: 8
4: 151
Right 1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 12
4: 217
1122252642_1122252647 -7 Left 1122252642 14:100450805-100450827 CCCCTCTTACTGTGTGCAGATTA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG 0: 1
1: 0
2: 3
3: 12
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122252647 Original CRISPR CAGATTAAGCACACTGAGGA GGG Intronic
902293178 1:15448123-15448145 TAGATTAAGCAAACTTAAGAAGG - Intronic
902529285 1:17080117-17080139 CAGATTAGGTAACCTGAGGAAGG + Intronic
902981506 1:20126763-20126785 CAGACTCAGCACACTGTGCAGGG + Intergenic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
907078244 1:51597145-51597167 TGGCTTAAGCACAGTGAGGAAGG + Intronic
907719101 1:56954748-56954770 CAGATGAAGCAAACTGTAGAAGG - Exonic
910718663 1:90260244-90260266 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
914386463 1:147173757-147173779 CAGATTCAGAACCCTGGGGATGG - Intergenic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
920794316 1:209123981-209124003 CAGCTTAGGCACATTGAAGAAGG + Intergenic
921308238 1:213818242-213818264 ATGATTAAGCTCAGTGAGGAAGG + Intergenic
921543928 1:216451884-216451906 CACATTGAGTAGACTGAGGAAGG + Intergenic
921609796 1:217197913-217197935 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
924706822 1:246509027-246509049 CAGGCTAATCACACTGTGGAGGG - Intergenic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1065159183 10:22901371-22901393 CAGATTAAACACACTGAACTGGG - Intergenic
1065207616 10:23372287-23372309 CATAATATGCACCCTGAGGATGG - Intergenic
1065519946 10:26562034-26562056 TTGATAAAGCCCACTGAGGAGGG - Intronic
1065523113 10:26591013-26591035 TTGATAAAGCCCACTGAGGAGGG - Intergenic
1065557883 10:26934790-26934812 TTGATAAAGCCCACTGAGGAGGG + Intergenic
1065947923 10:30624287-30624309 CAGAAGAAGGACACTGAGGTTGG + Intronic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1067169557 10:43895467-43895489 CAAATTAACTAAACTGAGGAGGG + Intergenic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1071437122 10:85657765-85657787 AAGTTTCAGCACCCTGAGGATGG - Intronic
1073295526 10:102436145-102436167 CAGAACACGCACACTGAGAAGGG - Intergenic
1078205875 11:9228949-9228971 CAAATTATGCAAACTTAGGAAGG + Intronic
1078368424 11:10725370-10725392 CCGACTAATCTCACTGAGGAAGG - Intergenic
1078457315 11:11485351-11485373 CAGATTAATCACACCGAGGAGGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1083204082 11:61137532-61137554 CATATTAAGCACTGTGAGCATGG - Intronic
1084369246 11:68728152-68728174 AAGATTAAGCTTAGTGAGGAAGG + Intronic
1085364407 11:75926142-75926164 TATATTAAGCACACTCTGGAGGG - Intronic
1086307428 11:85496706-85496728 CAGATGAAGCTCTCAGAGGAAGG + Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1089063861 11:115647192-115647214 CAGATGAAAAACACTGAGGCTGG + Intergenic
1091334429 11:134755668-134755690 CAGAGTCAGCACACTGAGTGGGG + Intergenic
1091515568 12:1177332-1177354 AAGATTAAGCTTAGTGAGGAAGG - Intronic
1092553697 12:9531931-9531953 CAGAATAAGGATACTGGGGAAGG - Intergenic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1094518402 12:31158692-31158714 CAGAATAAGGATACTGGGGAAGG + Intergenic
1094727710 12:33138687-33138709 CAGATTAAAATCACTGACGATGG - Intergenic
1095188127 12:39225295-39225317 CAGAATAGTCACACAGAGGAAGG - Intergenic
1098981099 12:76956525-76956547 TACATTAGGCACAGTGAGGAAGG - Intergenic
1099606283 12:84805764-84805786 AAGAGTAAGCACTCTGATGAGGG - Intergenic
1101934888 12:109049215-109049237 ATGATTAAGCTCAGTGAGGAAGG - Intronic
1105039386 12:132949788-132949810 CAGAGCAAGGACACTGAGGTAGG + Intronic
1106001801 13:25730691-25730713 CAGAATAAGCAAACTGGGCATGG - Intronic
1106452829 13:29898827-29898849 AAGATTTGGCACACTGTGGATGG - Intergenic
1109656659 13:65400079-65400101 GGGAGTTAGCACACTGAGGAGGG + Intergenic
1117197867 14:53359526-53359548 CAGATGAAGAACAGAGAGGAGGG + Intergenic
1117759158 14:59008439-59008461 CATATCAAGCACATTGAAGAAGG + Intergenic
1118038484 14:61892963-61892985 CTGAGTCACCACACTGAGGAAGG - Intergenic
1120430663 14:84410344-84410366 AAGATTAAGCTTACTGAGGAAGG + Intergenic
1120913677 14:89690771-89690793 CGGACTTAGCAGACTGAGGAAGG + Intergenic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1123410740 15:20056775-20056797 CAGCTCTAGCACACTGTGGAGGG - Intergenic
1123520069 15:21063481-21063503 CAGCTCTAGCACACTGTGGAGGG - Intergenic
1124887755 15:33702660-33702682 CAGATAGAGCACACAGAGGGTGG + Intronic
1126154537 15:45553159-45553181 CAGATTAAGCACAATTATGGGGG + Intergenic
1126212847 15:46119498-46119520 CAGATTAAAGAGACTGATGAAGG + Intergenic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1128629337 15:69247620-69247642 ATGATTAAGCTCAGTGAGGAGGG - Intronic
1130286672 15:82561124-82561146 AAGATTAAGAGCTCTGAGGATGG + Intronic
1130960391 15:88655068-88655090 AAGCTTCAGGACACTGAGGAGGG - Intronic
1136078301 16:27832002-27832024 CAGAAAATGCCCACTGAGGAAGG - Intronic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1140135877 16:72205078-72205100 CAGCCTAGACACACTGAGGATGG - Intergenic
1145102409 17:20088053-20088075 CACATGAAGCACAGTGAGCAGGG + Intronic
1146118713 17:30169148-30169170 TAGAATAAGCAGACTGAGAAAGG - Intronic
1147009251 17:37431282-37431304 CAGATTAGGCACAGTGAGGGTGG + Intronic
1147155440 17:38542400-38542422 CACACTCACCACACTGAGGAAGG - Intronic
1148442268 17:47717495-47717517 CAGCAAAAGCACACTGTGGATGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153270619 18:3317718-3317740 ACGATTAAGCTTACTGAGGAAGG - Intergenic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1153739048 18:8103826-8103848 ATTATTAAGCACAGTGAGGAAGG - Intronic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1154286050 18:13057651-13057673 TGGATTAAGCACACTGAGGAGGG - Exonic
1154979371 18:21489913-21489935 CAGATTAAGCATGGTGGGGAAGG - Intronic
1156068081 18:33169931-33169953 GAGATTGAGAAAACTGAGGAAGG - Intronic
1157319991 18:46626813-46626835 TAGATGAAGGAGACTGAGGAAGG - Intronic
1160139523 18:76309234-76309256 CAGATCAGGCACCCTGAGGTGGG - Intergenic
1160845387 19:1163967-1163989 CAGACTCAGCGCCCTGAGGACGG + Intronic
1162702436 19:12527188-12527210 ATGATTAGGCACACTGGGGATGG - Exonic
1162702472 19:12527524-12527546 ATGATTAAGCACACTGGAGATGG - Exonic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1163471256 19:17498436-17498458 AACACCAAGCACACTGAGGAAGG - Intronic
1165274057 19:34733206-34733228 CAGATTGTGCAAAGTGAGGAAGG + Intergenic
1165824490 19:38698097-38698119 CAGAGCAGGCACACTGTGGAGGG + Intronic
925871424 2:8274831-8274853 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
929769715 2:44881471-44881493 CAGATAATGCACACCTAGGAGGG + Intergenic
929786230 2:44994583-44994605 CAGATAAAGCACAGTGTGAATGG + Intergenic
930403364 2:50921176-50921198 AACATTAAACACAATGAGGATGG + Intronic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933144624 2:78836500-78836522 CAGAAATAGCACAGTGAGGATGG - Intergenic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
937868598 2:126771798-126771820 CAGAGTAGGGACGCTGAGGAAGG + Intergenic
939322188 2:140638489-140638511 AAGATTAAACTCTCTGAGGATGG + Intronic
940495983 2:154429205-154429227 AAGATTAAGCTTAGTGAGGAAGG + Intronic
941841607 2:170091204-170091226 CAGCATAACCACACTAAGGAAGG + Intergenic
941846609 2:170140516-170140538 CAGAGTTAGACCACTGAGGAGGG - Intergenic
941974583 2:171389113-171389135 AAGATTAAGCTTAGTGAGGAAGG + Intronic
942110306 2:172675300-172675322 CTGATTAAGCTTGCTGAGGAGGG + Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
945322625 2:208442960-208442982 CAGATTCAACAGACTGTGGATGG + Intronic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945995534 2:216432839-216432861 CAGGTGAAGCGCACGGAGGATGG - Exonic
947084673 2:226437610-226437632 CAGATTCAGCTAACTAAGGATGG - Intergenic
948121068 2:235530860-235530882 CAGAGGAAGGACACTGAGGTGGG - Intronic
948739006 2:240030808-240030830 CAGATGAAGGACCCTAAGGAGGG - Intergenic
1168854151 20:997198-997220 GAGATTGAGGCCACTGAGGAAGG - Intronic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1173436115 20:43033719-43033741 CAGATGAAGCACAGAGAAGATGG + Intronic
1173679139 20:44864160-44864182 AAGAGAAAGAACACTGAGGAAGG - Intergenic
1174526428 20:51175724-51175746 CAGATTCAGCACATTGAGCAAGG + Intergenic
1175259373 20:57664922-57664944 CAGATTAGGGAAACTGAGGCAGG - Intronic
1176951155 21:15047875-15047897 AAGGTTAAGCTCAGTGAGGAAGG - Intronic
1177485467 21:21749569-21749591 CAAATTAAAAATACTGAGGAAGG - Intergenic
1177597467 21:23264214-23264236 CAAATGAAGCACACTGATAAAGG + Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1179109316 21:38432715-38432737 CAGATGAAGCACAGAGAGGTTGG + Intronic
1179423911 21:41257629-41257651 CAGTTTAAGCAAAATGAGTAAGG + Intronic
1181923088 22:26335885-26335907 CACATTAAGCCTAGTGAGGAGGG - Intronic
1184588202 22:45462042-45462064 CAGTTCCAGCTCACTGAGGATGG - Intergenic
949118586 3:358420-358442 AAGATTAAGGACATTGAGGTAGG - Intronic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
952079953 3:29745753-29745775 CAGATTAAGAGTATTGAGGAAGG - Intronic
952312855 3:32205934-32205956 CATATGAGGCATACTGAGGAGGG - Intergenic
953455071 3:43034521-43034543 CAGATAAAGCTCAGTGAGGGTGG + Intronic
955039118 3:55297879-55297901 CATATTAAGCACTCTCAGGAAGG - Intergenic
955452446 3:59084228-59084250 CTTAATAAGCACACTAAGGATGG - Intergenic
955641574 3:61091370-61091392 CAGATGAAGAAGACTTAGGAAGG - Intronic
955868377 3:63410098-63410120 CATATTAATCACAATGAGCAAGG - Intronic
957334887 3:78815244-78815266 ATGATTAAGATCACTGAGGAAGG + Intronic
957499712 3:81038725-81038747 AAGATTAAGCTTAGTGAGGATGG - Intergenic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
960121677 3:113953672-113953694 CAGAAAAAGCACAAAGAGGAGGG - Intronic
960700353 3:120433318-120433340 AAGATTAAGCAAACTGTTGACGG + Intronic
962400200 3:135051914-135051936 CAAAGAAAGGACACTGAGGAAGG + Intronic
963198636 3:142563728-142563750 ATGATTAAGCCTACTGAGGAAGG + Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
965788777 3:172365034-172365056 CAGTTTCAAGACACTGAGGAAGG - Intronic
966214310 3:177486262-177486284 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
966664060 3:182450770-182450792 GAGATAAAACACAGTGAGGAGGG - Intergenic
969029866 4:4203303-4203325 CAGCTGCAGCCCACTGAGGATGG + Intronic
969155817 4:5208927-5208949 CTGATGAAGCCCACTGAGCAGGG - Intronic
969663895 4:8545854-8545876 CAGCTTCAGCACACGGAGGTGGG - Intergenic
970606291 4:17685248-17685270 TAGATTAAGAAGGCTGAGGAGGG + Intronic
974764331 4:66322674-66322696 CACATAAAGAACTCTGAGGAGGG - Intergenic
975230475 4:71926819-71926841 CAGATGAAGCACAGTGAAGGAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978609261 4:110519296-110519318 AACATTAAGAACACTGAAGATGG + Intronic
979533564 4:121794703-121794725 CAGATGGACCACACTGATGAGGG + Intergenic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
985548639 5:522329-522351 CAGATAAGGCACACTGACCAGGG - Intronic
986146600 5:5083596-5083618 CAGATTTGGCACAGTGAGCAGGG + Intergenic
986346508 5:6840358-6840380 GAGATTCAGCACATTCAGGAGGG - Intergenic
987546727 5:19320121-19320143 CAGATTAAGCACATTTATGGTGG - Intergenic
989103717 5:37841803-37841825 CAGAGTAAGAACATTGATGAGGG - Intergenic
990481596 5:56216463-56216485 ATGATTAAGCTCAATGAGGAAGG + Intronic
991599732 5:68340484-68340506 GAGATTAACCAGGCTGAGGATGG + Intergenic
993359350 5:86954618-86954640 CACATTAAGCACATTGAAAATGG - Intergenic
994063398 5:95506744-95506766 CACATAAAGCACACTGGGGTTGG + Intronic
994431279 5:99664710-99664732 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
995791340 5:115891497-115891519 GAAATTAATCAAACTGAGGAGGG - Intronic
996716434 5:126591658-126591680 AAGACAAAGCACACTGAGGATGG + Intronic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
997407799 5:133665783-133665805 CAGATTTAGAATACAGAGGAGGG - Intergenic
999712339 5:154329661-154329683 GCGATTGAGCACACTGTGGACGG - Exonic
999972317 5:156877397-156877419 CAAAGTCACCACACTGAGGATGG - Intergenic
1000508761 5:162155605-162155627 CAGATAAAGCTCACTGAGAGGGG - Intergenic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1002946957 6:1771229-1771251 CAGATGCATCCCACTGAGGATGG + Intronic
1003271458 6:4611385-4611407 CAGCATGAGCACACAGAGGAGGG - Intergenic
1003360071 6:5417038-5417060 CAGATGAAGAGCACTGAAGATGG - Intronic
1005264048 6:24092484-24092506 GAGATTCAGAACACGGAGGAGGG + Intergenic
1006619505 6:35353390-35353412 CAGATTAAGCACCCAGAGCCAGG + Intronic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1014461455 6:121700711-121700733 ACCATTAAGCACACTGACGAAGG + Intergenic
1015027262 6:128550468-128550490 CATTTTAAGCTCAATGAGGAAGG + Intergenic
1015563595 6:134542379-134542401 CAGATTTGGTAGACTGAGGAAGG - Intergenic
1015793209 6:136984947-136984969 CAGATTCAACCAACTGAGGATGG + Intergenic
1016041643 6:139437891-139437913 CAGATTATGCAAACTGATGACGG + Intergenic
1017358092 6:153534042-153534064 CAGATTAATCACCCTGAGGAGGG - Intergenic
1017384762 6:153870431-153870453 CAAATCAAGCACACTCAGTAGGG + Intergenic
1022330869 7:29377565-29377587 CTCATTAAGCACACAGAGGATGG - Intronic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1024955523 7:54915282-54915304 CAGCTTAAGCAAAATGAGCAAGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1031979806 7:128117157-128117179 CAGATTACACACTCTGGGGATGG - Intergenic
1034002693 7:147433128-147433150 AAGATTCAGCACTCTGCGGATGG - Intronic
1035461164 7:159040106-159040128 CCAAACAAGCACACTGAGGAAGG + Intronic
1036076145 8:5503042-5503064 CAGATGGAGCAAAATGAGGAAGG - Intergenic
1036543813 8:9746837-9746859 CAGATAAGGCTCACTGAGGTAGG - Intronic
1038481263 8:27903194-27903216 GAGATCAAGCACACTCAGGATGG - Intronic
1039879508 8:41615722-41615744 TACTTTAACCACACTGAGGATGG - Intronic
1040360053 8:46656585-46656607 CAGCTTACATACACTGAGGAGGG - Intergenic
1041475994 8:58266556-58266578 ATGATTAAGCTCAGTGAGGAAGG - Intergenic
1044454236 8:92374071-92374093 CTGATGTATCACACTGAGGATGG - Intergenic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1050110488 9:2210344-2210366 CAGATTATACACACTGAGACTGG - Intergenic
1051031864 9:12690502-12690524 TAGAGTAAGCTCAGTGAGGAAGG + Intronic
1051351888 9:16205064-16205086 AGGACTAAGCACACTGGGGACGG + Intronic
1051401110 9:16683755-16683777 CAGAAGAAGCACATTTAGGAAGG + Intronic
1052186613 9:25604539-25604561 AAGATTAAGCTTAGTGAGGAAGG + Intergenic
1055398213 9:75895650-75895672 CAGGATAAGCATACTGCGGATGG + Intronic
1057889949 9:98862358-98862380 GGTATTAAGCACACTGAAGATGG - Intergenic
1058135953 9:101307742-101307764 CAGATTCAGAACACTGAATACGG + Intronic
1058605498 9:106717984-106718006 AAGAATAATCACACTGAGAATGG - Intergenic
1059734820 9:117090654-117090676 CAGAGTAAGCACCCAGTGGAAGG - Intronic
1187866581 X:23728311-23728333 CAGCTTGAGCACAATGAAGAGGG + Intronic
1188438425 X:30189549-30189571 AAGATGAAGCACACAGAAGATGG + Intergenic
1190007295 X:46752628-46752650 CAGATTAAACACATACAGGAAGG + Intronic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1193020178 X:76783175-76783197 AGGATTAAGCTTACTGAGGAAGG + Intergenic
1194743304 X:97601960-97601982 CAGATTAGGTATACAGAGGAGGG - Exonic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195987907 X:110651206-110651228 AAGATTAAGCTTAGTGAGGAAGG - Intergenic
1197977730 X:132183127-132183149 GAGATTGAGCACAGTGAGAATGG - Intergenic
1199914161 X:152320827-152320849 AACATTAATCACACAGAGGAGGG + Intronic