ID: 1122254568

View in Genome Browser
Species Human (GRCh38)
Location 14:100467418-100467440
Sequence CAGGACTCCCACCCGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122254559_1122254568 24 Left 1122254559 14:100467371-100467393 CCAGGGACGCAGGTGAGCCTGGG 0: 1
1: 1
2: 7
3: 38
4: 332
Right 1122254568 14:100467418-100467440 CAGGACTCCCACCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 18
4: 175
1122254563_1122254568 7 Left 1122254563 14:100467388-100467410 CCTGGGATAGGGTTGTGAATGCT 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1122254568 14:100467418-100467440 CAGGACTCCCACCCGGCTGCAGG 0: 1
1: 0
2: 0
3: 18
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122254568 Original CRISPR CAGGACTCCCACCCGGCTGC AGG Intronic
901023664 1:6267834-6267856 CAGGATTCACACCCGGCTCCAGG - Intronic
901139442 1:7018961-7018983 GAGGACACCCTCCTGGCTGCAGG + Intronic
901210852 1:7525234-7525256 CACTGCTCCCACCCTGCTGCAGG - Intronic
901315010 1:8301129-8301151 AATGACTCCCACCCAGCTACAGG - Intergenic
901315090 1:8301604-8301626 GATGAATCCCACCCAGCTGCAGG - Intergenic
903217135 1:21849409-21849431 CTGGTCTACCACCCCGCTGCTGG - Intronic
903217374 1:21850647-21850669 CTGGTCTACCACCCCGCTGCTGG - Intronic
903586163 1:24416778-24416800 CCGGACTCCCACCCAGCTGAGGG + Intronic
903628112 1:24745662-24745684 CCCGGCTCCCTCCCGGCTGCGGG + Intronic
906698609 1:47841596-47841618 CATGATTCCCACCGGGCTGTGGG - Intronic
908109967 1:60887121-60887143 CAGGCCTCCCTGCCGGGTGCTGG - Intronic
908355018 1:63320225-63320247 CTGGACTCCCTCCACGCTGCTGG - Intergenic
912533158 1:110340769-110340791 CAGGCCTCCCACCCAGAGGCGGG - Exonic
912595940 1:110875738-110875760 CAGGACTCCAGCATGGCTGCTGG + Intronic
912631602 1:111251220-111251242 CAGAACTCCCAGCCCGCTGTGGG - Intergenic
913680577 1:121185158-121185180 CAGGGCTCCAGCCCGGCGGCCGG - Intronic
914032408 1:143972800-143972822 CAGGGCTCCAGCCCGGCGGCCGG - Intergenic
914157037 1:145095167-145095189 CAGGGCTCCAGCCCGGCGGCCGG + Intronic
914403920 1:147350749-147350771 CAGGATTCCCACCCTGCCTCTGG - Intergenic
915526791 1:156480989-156481011 AAGGACTCTCACCCAGCTGATGG - Intronic
918996861 1:191773117-191773139 CAGGTCTGCCACCTGGGTGCAGG - Intergenic
920467886 1:206203684-206203706 CAGGGCTCCAGCCCGGCGGCCGG - Intronic
922471829 1:225881836-225881858 CAGGACTCCGCCAAGGCTGCAGG + Intronic
922605558 1:226887858-226887880 CAGGACTCCCTCAGGTCTGCCGG - Intronic
922802657 1:228371403-228371425 CAGGGCTCTCACCCGCCTGGTGG - Exonic
1062973623 10:1666585-1666607 CAGAATTCCCCCTCGGCTGCAGG - Intronic
1067016029 10:42756765-42756787 CAGGACCCCCAGCTGGCTGGTGG - Intergenic
1067521390 10:47009334-47009356 CAGAACACCCTCCTGGCTGCAGG - Intergenic
1067708962 10:48633704-48633726 CAGCCCTCCCTCCCTGCTGCTGG - Intronic
1069788417 10:71004441-71004463 CAGGACGGCCACCTTGCTGCCGG - Intergenic
1070963441 10:80515316-80515338 CAGGCCTCTCTCCTGGCTGCAGG + Intronic
1073260862 10:102189027-102189049 CAGGAACCCCACCCCGCTGTGGG - Intergenic
1075669735 10:124256251-124256273 CTGCCCTCACACCCGGCTGCTGG + Intergenic
1076822460 10:132946282-132946304 CAGGCCCCCCTCCCAGCTGCCGG - Intergenic
1077060004 11:613865-613887 CAGGATTCCCTTCCGGATGCAGG - Exonic
1081994509 11:47355020-47355042 CAGGACTCCACCCCGGCTCCCGG - Exonic
1082006648 11:47422970-47422992 CAGGACTTCCTCCTGGCAGCTGG - Exonic
1085386836 11:76162488-76162510 CAGGACTCTGTCCCAGCTGCAGG + Intergenic
1090780673 11:130003405-130003427 CCGAACTCCCGCCCGGCTCCCGG + Intergenic
1090832319 11:130428174-130428196 GAGGCCTGCCCCCCGGCTGCGGG + Exonic
1093072870 12:14724684-14724706 CAGGTCTGCCACCTGGCTGTTGG + Intergenic
1096120114 12:49083215-49083237 CAGCACTCCCACCTGGGTGATGG + Intergenic
1096255096 12:50057875-50057897 CAGGACCCGCCGCCGGCTGCCGG + Exonic
1097265112 12:57739960-57739982 CAGGATTCTCACCTGGCTGGAGG - Intronic
1100271573 12:93030031-93030053 CAGGACTCTCACTCTGCTGAGGG + Intergenic
1100407249 12:94282477-94282499 CAGGACTCCCACCCATTTCCTGG + Intronic
1101409722 12:104458050-104458072 CCGGGCTCCCAGCCTGCTGCAGG - Intronic
1102524337 12:113500572-113500594 CAGGCCTCACACCCAGCTCCAGG - Intergenic
1104273079 12:127300385-127300407 CAGAACTCTCACGCTGCTGCTGG - Intergenic
1105770004 13:23600348-23600370 CAGGTTTCCCACCCTGGTGCTGG - Intronic
1107103991 13:36624061-36624083 CAGGACTCTCACTCTGCTGAGGG + Intergenic
1107814588 13:44233014-44233036 TAGGTCTCCCACCCTTCTGCTGG + Intergenic
1108535351 13:51370908-51370930 CAGAACTCCCAACCGCATGCAGG + Intronic
1113862495 13:113497514-113497536 CAGGTCTCACACACAGCTGCAGG - Intronic
1114586172 14:23816033-23816055 CTGTACTCCCACCCAGCTACTGG - Intergenic
1116905205 14:50396989-50397011 CCGGCCGCCCTCCCGGCTGCAGG + Intronic
1119422761 14:74517281-74517303 AAGGACTCCCACCCCGCTCCTGG + Intronic
1120907487 14:89633127-89633149 CAAGACTCCCGCCCAGCTGGAGG + Intronic
1121124566 14:91397789-91397811 CAGCACCCCCACCCCACTGCGGG + Intronic
1122254568 14:100467418-100467440 CAGGACTCCCACCCGGCTGCAGG + Intronic
1122597298 14:102902458-102902480 AAGGCCTCCTACCCTGCTGCTGG - Intronic
1122909858 14:104822251-104822273 CAGCATTCCCACCCTCCTGCAGG + Intergenic
1128757920 15:70195908-70195930 CAGGCCTCTCTCCCGGCTGTCGG - Intergenic
1131051594 15:89351767-89351789 CAGGAATACCCCCAGGCTGCAGG - Intergenic
1131097531 15:89665951-89665973 CAGGACTCTAAGGCGGCTGCCGG - Intronic
1131753232 15:95532429-95532451 CAGCCCTCCCACCAGGCTGGAGG + Intergenic
1132710709 16:1265904-1265926 CTGGTCCCCCACCCAGCTGCCGG + Intergenic
1132721617 16:1319291-1319313 CAGGACAGCCACGCAGCTGCTGG + Intronic
1132803425 16:1765041-1765063 CAGGATCCACACCCGGCTGGAGG - Exonic
1133212545 16:4271646-4271668 CGGGCCACCCACCCGGCTGGGGG + Intronic
1135565786 16:23510195-23510217 CAGGCCCCCTACCCGGCCGCCGG + Intronic
1137571019 16:49566366-49566388 CAGGACTCACACCCTGCTCCTGG + Intronic
1138537323 16:57666944-57666966 CAGACCTCCCTCCCAGCTGCAGG - Intergenic
1141173766 16:81706350-81706372 CATGACTCCTACCGGGCCGCTGG + Intronic
1141827869 16:86493647-86493669 CAGGATCCCCACCTGCCTGCAGG - Intergenic
1142121176 16:88387380-88387402 CAGGACCCACCCCCGGGTGCCGG + Intergenic
1142858849 17:2749256-2749278 CAGGACTCGCGGCGGGCTGCTGG - Intergenic
1143056824 17:4168983-4169005 CAGGAAAGCCACCCGTCTGCAGG + Intronic
1143136753 17:4716536-4716558 CCGGCCCCCCACCCGCCTGCAGG + Exonic
1143664006 17:8345800-8345822 CAGGACTCCCTCCTGGGTGATGG - Exonic
1145390933 17:22454807-22454829 CAGACCTCCCACGCGGCTCCGGG + Intergenic
1146056400 17:29583482-29583504 CTGGCCTCCCACGCTGCTGCAGG - Exonic
1150220945 17:63495607-63495629 CAGGGCTCCCGCCTGCCTGCTGG + Intronic
1152192521 17:78897236-78897258 CAGGCCTGCACCCCGGCTGCAGG + Intronic
1152354782 17:79801411-79801433 CGGGACGCCCGCCCGGCTCCGGG - Intronic
1152610711 17:81313890-81313912 CCGGCCCCCCACCCTGCTGCAGG - Exonic
1152931018 17:83109891-83109913 GAGCACTCACACCAGGCTGCGGG + Intergenic
1153841814 18:9014699-9014721 CTTGACTCCCACCTGGGTGCTGG - Intergenic
1154193856 18:12252106-12252128 CAGGATTCCCACTCAGCAGCAGG + Intergenic
1155403724 18:25465385-25465407 AAGGACTTCCAGCCGGTTGCAGG + Intergenic
1157672214 18:49540242-49540264 CAGAACTCCCAACCGCATGCAGG - Intergenic
1160109992 18:76017276-76017298 CACGACTCTCACCCAGCTTCTGG + Intergenic
1160358172 18:78246342-78246364 CAGGACTCCCAGCCTCCAGCTGG - Intergenic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1160875591 19:1295027-1295049 CTGGACACCCACCTCGCTGCTGG + Intronic
1161088165 19:2344500-2344522 CAGGACCCTCACCCGGCCGCGGG - Intronic
1161401500 19:4067690-4067712 GAGTTCCCCCACCCGGCTGCGGG + Intergenic
1161534711 19:4811916-4811938 CATGGCTCCCACCCGCCTGGGGG + Intergenic
1161720385 19:5899004-5899026 CAGGACTCCCCACCTGCTCCTGG + Intronic
1163597813 19:18230730-18230752 CCTGACTCCCACCCCACTGCTGG + Intronic
1163683509 19:18697086-18697108 CTGGACCCCCATCCAGCTGCTGG - Intronic
1164435312 19:28223580-28223602 CAGGAGTCCCACCCGGTAGCAGG + Intergenic
925358831 2:3263014-3263036 CAGGACTCCCACATGGCCACAGG - Intronic
925973688 2:9125960-9125982 CAGGCCTCCCTCCCGGCTTCTGG - Intergenic
926784722 2:16508278-16508300 CAGGGGTCCCACCGGGCCGCAGG + Intergenic
928025846 2:27737989-27738011 CTGGGCTCCCAGCCGGCTGGAGG + Intergenic
930651708 2:53970727-53970749 CGGGACGCCCGCCCGGCTCCGGG + Exonic
931943357 2:67277649-67277671 CAGCACTGCCACCTGGCTGATGG - Intergenic
932335213 2:70927269-70927291 CAGGACTCCCCTCCTGCAGCTGG + Intronic
932418398 2:71587144-71587166 CAGAACACCCCCCTGGCTGCAGG - Intronic
932567562 2:72919034-72919056 GAGGGAGCCCACCCGGCTGCTGG + Intronic
933775568 2:85769399-85769421 CAGCACTGGCACACGGCTGCAGG - Intronic
934710229 2:96509561-96509583 CAGCACTGCCACCCGGTGGCCGG + Intergenic
935719773 2:105969716-105969738 CAGGGCTCCACCCTGGCTGCAGG + Intergenic
942447239 2:176086108-176086130 CTGGACTCCCACCGCGCTGATGG - Intergenic
946418305 2:219551535-219551557 CAGCACCCACACACGGCTGCTGG - Exonic
946689850 2:222301744-222301766 CTGGACTCCCATCCAGCTGCGGG - Intronic
946909058 2:224442602-224442624 CAGGATCCCCGCCCGGCTGCGGG + Intergenic
1170649195 20:18224490-18224512 CAGGCCTCTCTCCCGGCTTCTGG + Intergenic
1175374448 20:58514797-58514819 CAGGACTCCAGCCTGGCCGCCGG - Exonic
1175939009 20:62529287-62529309 CAGGCCTCCCTCCCAGCTCCTGG - Intergenic
1176199940 20:63855641-63855663 CAGCCCACCCACCCGGCAGCTGG + Intergenic
1178518201 21:33266313-33266335 CCGGGCTCCCACCCCGCTGCAGG - Intronic
1180109550 21:45641803-45641825 CAGCATTCCCACCAGGCTGCAGG + Intergenic
1183074425 22:35417844-35417866 CAGGACTCACACTCGGCAGTAGG - Exonic
1183095275 22:35548201-35548223 CAGGGCTCACACCCAGGTGCTGG - Intronic
1183164059 22:36134197-36134219 CTGGAATCCCAGCCTGCTGCTGG - Intergenic
1183335872 22:37245446-37245468 CAGGATTCCCACCAGGCACCCGG + Intergenic
1183520981 22:38295864-38295886 CTGGGCTCCCACTCGGTTGCAGG + Intronic
1185072836 22:48666774-48666796 CAGGCCTCCCTCCAGCCTGCTGG + Intronic
949782772 3:7708755-7708777 CTGGGATCCTACCCGGCTGCTGG - Intronic
951515929 3:23559565-23559587 CAGGACAGCCACAGGGCTGCTGG - Intronic
953139142 3:40211341-40211363 CAGGACCCCAGCTCGGCTGCTGG - Intronic
955510748 3:59678109-59678131 CAGGACCCCGACTCGGCTCCAGG - Intergenic
956311729 3:67888368-67888390 CTGGACACCCACCCAGCAGCGGG + Intergenic
959450862 3:106498130-106498152 TATGACTGCCACCCGGCTGATGG + Intergenic
960175844 3:114516812-114516834 CGTGACTCCCACCCAGCTTCTGG - Intronic
964073085 3:152659064-152659086 CAGGACTCTCACTCTGCTGAGGG - Intergenic
968056778 3:195697729-195697751 CAAGACTCCCACCCAGGAGCGGG - Intergenic
968641569 4:1717504-1717526 CAGGCCCCCCACCTGGCTGCTGG + Exonic
969464915 4:7350604-7350626 CAGGACTCCCGGCAGGCGGCAGG + Intronic
969467880 4:7368437-7368459 CAGGACTCCCGGCAGGCAGCAGG - Intronic
973993472 4:56435008-56435030 CAGGGCTCCTCCCCGACTGCAGG - Intronic
977848246 4:101791232-101791254 CAGGACCCTGACCCGGGTGCTGG - Intronic
977967239 4:103167716-103167738 CAGGACTCCCACCTGGGTGTTGG - Intronic
978382531 4:108144649-108144671 CAGAATTCCCACACAGCTGCTGG + Intronic
980552401 4:134356294-134356316 CAGAACTTCCACATGGCTGCAGG - Intergenic
982781943 4:159500347-159500369 CCTGACTCCCACTCAGCTGCTGG + Intergenic
986289156 5:6385004-6385026 TAGGCCTCTCTCCCGGCTGCTGG + Intergenic
990598465 5:57333859-57333881 TAGGACTCCGACCTGGCTCCTGG - Intergenic
991371596 5:65925660-65925682 CAGGCCTCCTGCCCGGCTGTTGG + Intergenic
995724561 5:115169860-115169882 CGGGAATCCCGCCCAGCTGCCGG + Intronic
1002450269 5:179314729-179314751 CAGGAGCCCCACCTGGGTGCAGG - Intronic
1002701906 5:181130501-181130523 CAGGATTCCCACCTGCCTCCAGG + Intergenic
1002703891 5:181147645-181147667 CAGGATTCCCACCTGCCTCCAGG - Intergenic
1003708407 6:8561306-8561328 CAGTACTCCCAGACTGCTGCAGG - Intergenic
1011193661 6:84762440-84762462 CAGAACCCCCACCGAGCTGCAGG + Intronic
1017616972 6:156256194-156256216 CCAGCCTCCCACCCGACTGCGGG + Intergenic
1018623919 6:165759058-165759080 CAGGACTGCTTCCCGGCTGTGGG - Intronic
1018774121 6:166998574-166998596 CAGGACTCCCCGCCGGCGCCTGG + Intergenic
1018872004 6:167790480-167790502 CAGGACATCCACCCCGCTTCAGG + Intronic
1019330097 7:457216-457238 CAGGCCTCCCACCCCAATGCCGG + Intergenic
1019330182 7:457417-457439 CAGGTCTCCCACCCCAATGCCGG + Intergenic
1019330237 7:457547-457569 CAGGTCTCCCACCCCAATGCCGG + Intergenic
1021086202 7:16423019-16423041 CAGGACTCCCAACCAGCAGGTGG + Intergenic
1024059915 7:45690063-45690085 CAGGGCTCCCACCTGCCTCCTGG - Intronic
1026500955 7:70942975-70942997 CAGAACTCCCAAGCTGCTGCTGG + Intergenic
1028835145 7:95366318-95366340 CAGGACTTCCACAGGGTTGCTGG - Intronic
1034036709 7:147831477-147831499 CACGACTGCCACCTGGCTGAAGG - Intronic
1034267889 7:149790021-149790043 AAGGCCTCCCTCCCAGCTGCAGG + Intergenic
1034419071 7:150979509-150979531 CAGGTCTCTGATCCGGCTGCAGG - Intergenic
1034496095 7:151423538-151423560 CAGGCCTCCCTCCCAGCTTCTGG + Intergenic
1035224047 7:157424022-157424044 GAGGCCACCCACGCGGCTGCAGG + Intergenic
1035638087 8:1162140-1162162 CAGGAAGCCCTCCCGGCAGCAGG + Intergenic
1038617167 8:29105446-29105468 CAGGACTCACAGGAGGCTGCAGG - Intronic
1039886923 8:41660114-41660136 CAGGGGTCCCACTAGGCTGCTGG - Intronic
1040603893 8:48910829-48910851 CAGGGCCCCCACCCGGATCCCGG - Intergenic
1045679029 8:104639296-104639318 CAAGACTGCCACCTGGATGCAGG - Intronic
1047455303 8:125003382-125003404 CATGATAACCACCCGGCTGCAGG - Exonic
1050185054 9:2964489-2964511 CAGGCCTCCCTCCCAGCTACTGG - Intergenic
1051337542 9:16079586-16079608 CAGGCCTCTCTCCCGGCTTCTGG - Intergenic
1060485267 9:124042373-124042395 TTGGACACCCACCCGGCTCCTGG - Intergenic
1060930885 9:127488898-127488920 CAAGACTCCCACGGGGCTGCAGG - Intronic
1060952410 9:127612520-127612542 CAGGCCTCCGAGCGGGCTGCCGG + Intronic
1061146962 9:128805714-128805736 CAGGGCTGGCACCAGGCTGCCGG - Intronic
1061709309 9:132476783-132476805 CAGGCCTCTCTCCCGGCTGCTGG - Intronic
1062181382 9:135192991-135193013 CAGGGCTCCATCCAGGCTGCAGG + Intergenic
1062187130 9:135224097-135224119 CAGGCCTCCCACCCGCCTATGGG + Intergenic
1062502729 9:136858266-136858288 CAGGGCTCCCACCTGGCTGAGGG - Exonic
1062592112 9:137278821-137278843 CGGGCCCCCCACCCGGCTGCAGG - Exonic
1187251068 X:17598258-17598280 CTGGACTCCCAACAGGCTCCGGG - Intronic
1192363856 X:70455242-70455264 CTGGACTCCGACCCGGCGCCAGG + Intronic
1197767684 X:130069711-130069733 AAGGTCTCCCACCCAGCTCCCGG - Intronic
1200046998 X:153408502-153408524 CAGTACTCCGACCCTTCTGCAGG + Intergenic