ID: 1122255006

View in Genome Browser
Species Human (GRCh38)
Location 14:100470172-100470194
Sequence AGGTTCTTGCAGATGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122255006 Original CRISPR AGGTTCTTGCAGATGGAACA AGG Intronic
900502114 1:3011464-3011486 GGGTCTTTGCAGATGTAACAAGG - Intergenic
900704923 1:4074477-4074499 AGGTTCTTGCAAATTAAAAATGG - Intergenic
901248187 1:7750227-7750249 AGGTTCTTGCAGAAGGGTCCTGG + Intronic
902036313 1:13460790-13460812 AGGTTCTTTCAGGTGAAACAGGG - Intergenic
903211636 1:21822380-21822402 AGGCTCCTGCAGATGGGGCAGGG + Exonic
903517529 1:23921909-23921931 AGGTTAAAGCAGAGGGAACATGG - Intergenic
906054664 1:42906176-42906198 AGGTTCTTGCTGAAGGCAAAGGG - Intergenic
908134432 1:61115658-61115680 GGGTGCTTGCTGAAGGAACAAGG - Intronic
908730182 1:67218389-67218411 AGGTTATTGCAGATTCTACAAGG - Intronic
910318267 1:85914167-85914189 AGGTGCTTGCTGATGGCAAACGG + Intronic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
911286492 1:96000038-96000060 AAGTTCTAGCAGATGTAATAAGG + Intergenic
916321290 1:163507352-163507374 TGGTGCTTGAAGATGGCACAAGG - Intergenic
921275296 1:213513089-213513111 AGGTTCTTAAATATGGAAGAGGG + Intergenic
922704635 1:227782740-227782762 AAGCTCTAACAGATGGAACAAGG + Intergenic
1065033407 10:21611679-21611701 AGTTACTTGCACATGGAAAATGG + Intronic
1065342500 10:24721627-24721649 ATGTTCTTGCAAAAGAAACACGG + Intronic
1065816940 10:29491169-29491191 AGAATCTTGGAGATGGAAGAGGG + Intronic
1065955906 10:30693324-30693346 AGATTCTTGGAGATGGAAGAGGG - Intergenic
1065998894 10:31085978-31086000 AGGGTGTTGAAGATGGAAGAAGG + Intergenic
1066061287 10:31725620-31725642 AGCTTCTTGCAGCTGGCTCATGG + Intergenic
1067927881 10:50529031-50529053 TGGTTCCTACAGCTGGAACATGG + Intronic
1068008412 10:51417919-51417941 ATATTCTTGGATATGGAACATGG + Intronic
1069597955 10:69684805-69684827 AGGATCATACAGCTGGAACAGGG + Intergenic
1070286155 10:75085391-75085413 AGTTTCTTTCAGATGCCACAAGG + Intergenic
1070550036 10:77483708-77483730 AGGTTCTTGAATGTGGAAAATGG - Intronic
1073490741 10:103851574-103851596 AGGGTCTCGCAGCTGGCACAGGG - Intronic
1073499581 10:103923753-103923775 AGGTTATGGCAGTGGGAACAGGG - Intergenic
1073686762 10:105763322-105763344 AGATTCTTCCAGGTGGAACAGGG + Intergenic
1074976331 10:118584904-118584926 GGGCTCTTGAATATGGAACAAGG + Intergenic
1076487935 10:130836197-130836219 AGGATCTTGCAGATGGACGGTGG - Intergenic
1076926992 10:133496238-133496260 AGGTGCTTGCAGAAGGCAAAGGG - Intergenic
1077007717 11:366348-366370 AGGTGCTTGCAGAGGGCAAAGGG + Intergenic
1077995488 11:7448973-7448995 AGGGTGTTGCTGATGGAACCAGG + Intronic
1078112354 11:8406837-8406859 AGGTTCTAGCTGATGCAACAAGG - Intronic
1078304360 11:10168429-10168451 TGGTTCTTGAACATGAAACAGGG - Intronic
1078741574 11:14071568-14071590 ATGTTCTAGGAGAAGGAACAGGG - Intronic
1079655974 11:22987349-22987371 AGGTTCTTGCTGAAGGCAAAGGG - Intergenic
1079704082 11:23591318-23591340 GGGTTTTTGAAAATGGAACATGG - Intergenic
1079930098 11:26547944-26547966 AGGTTATAGCAAATGAAACAAGG - Intronic
1080907242 11:36558672-36558694 AGTTTCTTGTAGATAGCACATGG + Intronic
1083371717 11:62187670-62187692 AGGTTCTTACAGATGACAGATGG - Intergenic
1087909564 11:103737547-103737569 AGGTTCTTACAGAGATAACATGG + Intergenic
1089430083 11:118416163-118416185 AGCTTCTTTCAGCTGTAACAAGG - Intronic
1093190665 12:16071004-16071026 AAGATCTTACAGCTGGAACATGG + Intergenic
1093338809 12:17945574-17945596 AGGTTCTAGTAGACAGAACAGGG - Intergenic
1094389518 12:29934272-29934294 AGATTCTTGCTGAAGGAAAAGGG - Intergenic
1094724115 12:33094970-33094992 AGGCTATTGCAAATGGAAAAAGG + Intergenic
1097518538 12:60637981-60638003 AGGTGCTTGCTGATGGCAAAGGG + Intergenic
1097649615 12:62280784-62280806 AGGCTCTTGCAGCTGGATCTGGG + Intronic
1098210753 12:68162492-68162514 ACGTGCTTGCAGGTGGCACAGGG + Intergenic
1098499738 12:71177632-71177654 ACATTCTTGCAGATGAAAAAAGG + Intronic
1099400975 12:82203814-82203836 AGGTGCTTGCAGAAGGTAAAGGG - Intergenic
1104185144 12:126423433-126423455 AGGTTCTTGCTGAAGGCAAAGGG - Intergenic
1105290678 13:19051099-19051121 ACGATCTTGCAGATGGGTCATGG + Intergenic
1106364407 13:29064215-29064237 AGGTCCATGCGGAAGGAACATGG + Intronic
1106907617 13:34425097-34425119 TGGTTCTTGCAGCTGGATCCTGG + Intergenic
1107340097 13:39396418-39396440 AGGTTGTTGCAGATGTAATTAGG + Intronic
1107528859 13:41262450-41262472 AGTTTCTTGCACATGTAGCATGG + Intronic
1109955290 13:69557699-69557721 AGGTGCTTGCTGAAGGCACAGGG + Intergenic
1110127105 13:71958335-71958357 AGCTTCCTGCAGATGCAAAAGGG - Intergenic
1110820173 13:79906645-79906667 AGTTTCTTATAGATGAAACATGG - Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1112235112 13:97629010-97629032 AGATTCTTCCAGATGGAGCCAGG - Intergenic
1113067627 13:106388012-106388034 GGGTTCATGCAGCTGGGACAAGG + Intergenic
1114156686 14:20111485-20111507 AGGCTCTTGCAGAGAGAACTAGG + Intergenic
1115173826 14:30538994-30539016 AAATTTTTGTAGATGGAACAAGG - Intergenic
1115940768 14:38607716-38607738 AGGTGCTGGCATATGGAACAAGG + Intergenic
1117125522 14:52619558-52619580 AGGATCTTTCAAATGGGACAAGG - Intronic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1118779028 14:68993810-68993832 AGCTTGTTGCAAATGGAAGATGG + Intergenic
1119740163 14:77008907-77008929 GAGTTCTTGCAGGGGGAACAAGG + Intergenic
1121660702 14:95632961-95632983 AAGAGCTTGCAGATGAAACAAGG + Intergenic
1121826450 14:97013675-97013697 AGCTGCTTACAGAAGGAACATGG + Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1123705777 15:22950232-22950254 AGTTTCTTGTAGATGGCATATGG - Intronic
1124158149 15:27246186-27246208 AGGTTCCTGGAGATCGAATATGG - Intronic
1125887732 15:43241082-43241104 ATGTTCCTGCAGATGGCAAATGG - Intronic
1127528454 15:59817394-59817416 TGGATCTTGCAGATGGAAAAAGG + Intergenic
1133760077 16:8791579-8791601 AGGTTCTACCAGATTCAACAAGG + Intronic
1134027377 16:10964556-10964578 AGGGTCTGGCAGATAGGACATGG + Intronic
1135208005 16:20499217-20499239 CAGTGCTTGCACATGGAACATGG + Intergenic
1135210894 16:20524483-20524505 CAGTGCTTGCACATGGAACATGG - Intergenic
1135309273 16:21392627-21392649 TGGTTCTTGCTGATGGAAGGTGG - Intergenic
1135390665 16:22090692-22090714 AGGCTCTTGGAAATGGATCAGGG - Intergenic
1135869989 16:26140781-26140803 AGGTTCTTTCAGATATAACAAGG + Intergenic
1135997210 16:27259496-27259518 AGGGTCTTGAAGCAGGAACATGG + Intronic
1136148850 16:28332946-28332968 TGGTTCTTGCTGATGGAAGGTGG - Intergenic
1136306016 16:29371757-29371779 TGGTTCTTGCTGATGGAAGGTGG - Intergenic
1141287173 16:82683252-82683274 AGGTTCCTGCAGATCAAACCTGG - Intronic
1143052650 17:4138965-4138987 AAGTTCTTGGAGTTGGACCATGG - Intronic
1143052674 17:4139207-4139229 AAGTTCTTGGAGTTGGACCATGG - Intronic
1143582846 17:7836486-7836508 GGGATCCTGCAGATGGAAGACGG + Intergenic
1144371453 17:14595463-14595485 AAGTGCTTGTAGAGGGAACAGGG + Intergenic
1146015405 17:29229158-29229180 AGGTCTTTGCAGATGAAATAAGG + Intergenic
1146477775 17:33176888-33176910 AGGCTCTTCCAGAAGGTACAGGG + Intronic
1147291967 17:39450953-39450975 AGGTTCTTGCAGATGTCCCATGG - Intronic
1150970463 17:70021313-70021335 ATGTTCTTGCACAGGGCACATGG - Intergenic
1151186219 17:72365873-72365895 AGCTTCTGGCTGATGGAATATGG - Intergenic
1153673219 18:7432391-7432413 AGGGTCTTGCTGATGGCACGGGG - Intergenic
1153777847 18:8469412-8469434 CAGTTCTTGCAGATAGAACCCGG - Intergenic
1154259139 18:12814345-12814367 CCTTTCTTGCAGATGGAAAAAGG - Exonic
1156435077 18:37118329-37118351 AGGTGCTTGCTGATGGCAAAGGG - Intronic
1157375207 18:47157445-47157467 CGGTTCTTACAGATCGAATAAGG + Exonic
1158617154 18:58998654-58998676 AGGCTCCTACAGATGGAACAAGG - Intergenic
1160511114 18:79454077-79454099 CTGCTCTTGCAGATGGAACCAGG + Intronic
1163123112 19:15230029-15230051 AGTTTCCTCCAGCTGGAACATGG + Intronic
924995991 2:361690-361712 AGGTTCATGCAGAAGAAAAAGGG + Intergenic
925847742 2:8048969-8048991 AGGTTCTGGCTGAGGGGACATGG - Intergenic
928536787 2:32248924-32248946 TAGTTATGGCAGATGGAACAGGG - Intronic
929888802 2:45902614-45902636 AAGTTCTTGGAGCTGGAACTTGG + Intronic
932514737 2:72334262-72334284 TGTTTCTTGCAGATTGAACTGGG - Intronic
933233127 2:79832186-79832208 AGTTTGTAGCACATGGAACATGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
941525588 2:166602909-166602931 AGGTTCTTGCTGAAGGCAAAGGG - Intergenic
941721865 2:168820882-168820904 ATGTTCTTGCAGACTGTACAAGG - Intronic
942179930 2:173370790-173370812 AGGTTCTGGCAGGGAGAACAAGG + Intergenic
943182549 2:184561587-184561609 AGGTGCTTGCAGAAGGCAAAGGG + Intergenic
945535401 2:211011477-211011499 AGACTCTTGCTTATGGAACAAGG - Intergenic
946724487 2:222648522-222648544 AGGTGATTGTAGATGGAATAAGG + Intronic
947458025 2:230274259-230274281 AGGTTCTAGGAGATAGGACATGG - Intronic
1169784377 20:9343324-9343346 AGCTTCCTCCACATGGAACATGG - Intronic
1170006331 20:11673446-11673468 AGGTGCTTGCTGAGGGAAAAGGG + Intergenic
1170048378 20:12112291-12112313 AGGTTCTAGGAGCTGGAAGAAGG - Intergenic
1170551324 20:17479985-17480007 AGGTTCTTGCAGTAGAAAGAAGG - Intronic
1170615894 20:17950673-17950695 TGGTTCTACCAGGTGGAACATGG + Intronic
1171413714 20:24963487-24963509 AGCTCCTTGCACTTGGAACAGGG - Exonic
1172757489 20:37296870-37296892 AGCTACTTGCAGATAGAGCAGGG + Intronic
1174146013 20:48453173-48453195 ATGTCCTTGCAGTTGGAACCTGG - Intergenic
1174633383 20:51977950-51977972 AGGTCTTTGCAGATGTAATAAGG + Intergenic
1175749109 20:61482947-61482969 AGGTTTGTGCAGCTGGAAGATGG + Intronic
1176180163 20:63746195-63746217 AGGCCCTTGCAGAGGGAACCTGG + Exonic
1181839002 22:25638485-25638507 AGGTGCTTGCTGATGGTAAAGGG - Intronic
1182543007 22:31055401-31055423 TGGGGCTTGGAGATGGAACAAGG - Intergenic
1182752032 22:32649546-32649568 ATGTTCTGGGAGTTGGAACAGGG - Intronic
1185110424 22:48897439-48897461 AGGTCCTTCCTGATGGTACAGGG - Intergenic
949169757 3:984651-984673 AGGTTCTTGCTGAAGGCAAAGGG - Intergenic
950520619 3:13495712-13495734 AGGTGGGTGCAGCTGGAACAGGG - Intronic
950703156 3:14764263-14764285 AGGTTCTTGAAAATGGAAAGAGG + Intronic
951213519 3:20001905-20001927 TCGTGCTTGCATATGGAACAGGG + Exonic
952974727 3:38683964-38683986 ATGTTCTTGAAGCTAGAACAAGG - Intergenic
956245470 3:67177436-67177458 AGGTTCTTGAAGATGGGGCAAGG + Intergenic
956534431 3:70260152-70260174 AGGATGTTTCAGAGGGAACATGG - Intergenic
956701334 3:71961570-71961592 AGGTGCATGCAGGTGGACCATGG + Intergenic
959377208 3:105601933-105601955 AGGTTCTTGCTGAAGGCAAAGGG - Intergenic
960161667 3:114356619-114356641 TGGGTCTTGCACATGAAACAGGG + Intronic
962338241 3:134557807-134557829 ACCTTCTTGCAGAAGAAACATGG + Intronic
963733441 3:148993130-148993152 TGTTTCTTGGAGATGGAACATGG + Intronic
966660242 3:182406506-182406528 AGGTTTATGCAGATTGATCACGG - Intergenic
969329108 4:6462759-6462781 AGATGCCTGCAGATGGAACGGGG + Intronic
969900443 4:10344427-10344449 AGGTGGTTTTAGATGGAACAAGG + Intergenic
970779273 4:19716284-19716306 ATGTTCTTGCAGATGCAAAGAGG + Intergenic
974377664 4:61098710-61098732 GGCTTCTTGCAGAAAGAACATGG - Intergenic
977489826 4:97698129-97698151 AGGTTCTTGCTGAAGGCAAAGGG - Intronic
978617865 4:110613938-110613960 AGGTTCTAGCAGATGAACCCAGG - Intergenic
979051925 4:115945511-115945533 AGGTTCTTGCTGAAGGCAAAGGG + Intergenic
979881447 4:125964209-125964231 AGTGCCTTGCAGGTGGAACATGG + Intergenic
980686194 4:136232783-136232805 AGGTTCTTACAGATGTGACAGGG + Intergenic
980880842 4:138708744-138708766 AGATCCTTACAGATGGAACGTGG + Intergenic
981909038 4:149956491-149956513 AGGGTCTTGGAAATAGAACAGGG + Intergenic
982856760 4:160392510-160392532 AGGTTCTTGATCATGGGACAGGG + Intergenic
982984269 4:162185490-162185512 AGGTTCTGTCAGCTGGACCATGG + Intergenic
983965948 4:173810120-173810142 GGGTTTTTGCAGCTGGAAAAGGG + Intergenic
984921497 4:184768218-184768240 AGGGTCATACAGATGGCACATGG + Intronic
985034492 4:185824408-185824430 GGGTCATTGCAGATGTAACAAGG - Intronic
985178116 4:187225167-187225189 AAGGTCTGGCAGATGGCACAGGG - Intergenic
985243348 4:187954617-187954639 AGGTTCTAGCAGTTAGGACATGG - Intergenic
986147367 5:5091322-5091344 AGGTGCTTGCTGAAGGAAAAGGG - Intergenic
990748059 5:58981696-58981718 AGGTGCTTGCTGAGGGAAAAGGG - Intronic
995851008 5:116545613-116545635 TGCTCCTCGCAGATGGAACACGG - Intronic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
997389334 5:133501041-133501063 AGCCAGTTGCAGATGGAACATGG + Intronic
997674374 5:135701694-135701716 AGGACCTTGCCGAGGGAACATGG - Intergenic
1000112706 5:158124340-158124362 AGGTTCTTGCTGATGATACAAGG + Intergenic
1000334766 5:160233936-160233958 AGGGCCTTGCAGCTAGAACATGG + Intronic
1001305880 5:170572352-170572374 AGCTCCTTGCAGATGGACCCCGG + Intronic
1001963472 5:175894543-175894565 ATGTCCTTCCACATGGAACAAGG + Intergenic
1005221203 6:23590989-23591011 AAGTTGTAACAGATGGAACAGGG - Intergenic
1006574868 6:35037741-35037763 AGGTGCTTGCAGTTGGAAACTGG + Intronic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1007139186 6:39554484-39554506 GGTTTCCTGGAGATGGAACAGGG - Intronic
1009294180 6:61923802-61923824 AGGTTCTGGCTAATTGAACAAGG + Intronic
1011830315 6:91363867-91363889 AGGTTCTTGCTGAAGGCAGAGGG + Intergenic
1013835046 6:114324764-114324786 AGGTGCATTCAGATGGACCAGGG + Intronic
1014756307 6:125305047-125305069 GGGTTCTTAAAGATGGAAAAGGG + Intergenic
1015095170 6:129407662-129407684 AGGTGCTTGCAGAAGGCAAAGGG - Intronic
1018268172 6:162048377-162048399 AGGTTCTTGCAGTTGGCTAAGGG + Intronic
1018534756 6:164808464-164808486 AGGTGCTTGCAGAAGGCAAAGGG - Intergenic
1018713887 6:166516789-166516811 AGGGCCTGGCAGATGGAACAGGG - Intronic
1018801137 6:167223039-167223061 AGTGTTTTGAAGATGGAACAAGG + Intergenic
1018808996 6:167284147-167284169 AGTGTTTTGAAGATGGAACAAGG - Intronic
1018994584 6:168701314-168701336 TGGTGCTGCCAGATGGAACAGGG - Intergenic
1019999804 7:4749311-4749333 AGCTTCTACCAGGTGGAACATGG - Intronic
1022198635 7:28094648-28094670 ATTTTCTGGCAGAAGGAACATGG + Intronic
1023710136 7:42983478-42983500 AGGGTCTTGCTGATTGATCAGGG + Intergenic
1024301919 7:47893420-47893442 AGGCTGTTGCACATGGATCATGG + Intronic
1025058556 7:55784942-55784964 AGGTCCTGGCAGGTGGGACAGGG - Intergenic
1025827821 7:65024859-65024881 AGGTCCTGGCAGGTGGGACAGGG + Intergenic
1025886827 7:65602759-65602781 AGGGTCATGCAGAGGGAACATGG + Intergenic
1025915350 7:65861301-65861323 AGGTCCTGGCAGGTGGCACAGGG + Intergenic
1025944707 7:66096910-66096932 CTGGTCTTGCAGATGGAAGAAGG - Intronic
1026045025 7:66901204-66901226 AGTTTCTTGCCAATGGGACATGG + Intergenic
1026835681 7:73637658-73637680 AGGTTCTTACTGATGGTAGATGG + Intergenic
1029961803 7:104695638-104695660 AGGTCCATGCAGATGAAATAGGG + Intronic
1031543839 7:123028435-123028457 AGGCCGATGCAGATGGAACATGG + Intergenic
1031855594 7:126919183-126919205 AGGGTCATGCAGAGGGAACATGG - Intronic
1032085394 7:128880946-128880968 AGGATCTCGCAGATGGATAAAGG - Intronic
1032314058 7:130817692-130817714 AGGTGTTTGCAGATGGCAGATGG + Intergenic
1033982095 7:147178071-147178093 AGGTTCTTGGAGTTAGGACATGG - Intronic
1035332672 7:158106488-158106510 AGCTTCTTCCAGATGATACACGG - Intronic
1036541367 8:9715410-9715432 AGGTTCTTGGTGCTGGAAGATGG + Intronic
1038398917 8:27268123-27268145 AGGTTCTGGCACTTGGAATAAGG - Intergenic
1039434707 8:37552053-37552075 AGGTTCTTGAGGATTGGACAAGG - Intergenic
1043554047 8:81409357-81409379 AAGTTCTTAAAGGTGGAACACGG + Intergenic
1043755060 8:83993197-83993219 ATGTTCTAGCAGATGGCAAAAGG + Intergenic
1045646213 8:104301893-104301915 AGATGCTTCCAGATGGATCAAGG + Intergenic
1049714917 8:144085253-144085275 AGGCTCTTGGAGATGGACCCTGG - Intronic
1052738821 9:32373908-32373930 AGATGCCTGCAGATGGAGCATGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1058567721 9:106304360-106304382 AGGTTCTGAGAGCTGGAACAAGG + Intergenic
1060085163 9:120692656-120692678 AGGTACATGAAGGTGGAACAGGG - Intronic
1060168171 9:121437582-121437604 TGGTTCTTGTATATGGTACAAGG - Intergenic
1061331254 9:129895185-129895207 GGGATCATGTAGATGGAACAGGG + Intronic
1188950124 X:36360603-36360625 AGTTTGTTGCATATGGAACTTGG - Intronic
1189087072 X:38036566-38036588 CAGTTAATGCAGATGGAACAAGG - Intronic
1200062750 X:153490891-153490913 AGGGTCTTGCTGATGGTCCAGGG + Intronic