ID: 1122256244

View in Genome Browser
Species Human (GRCh38)
Location 14:100479216-100479238
Sequence CTGCTCTGAGTCCCTGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122256240_1122256244 3 Left 1122256240 14:100479190-100479212 CCTGGGGCCTCTGTGCTGCCACA 0: 1
1: 0
2: 0
3: 32
4: 369
Right 1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 296
1122256241_1122256244 -4 Left 1122256241 14:100479197-100479219 CCTCTGTGCTGCCACATTGCTGC 0: 1
1: 0
2: 0
3: 27
4: 274
Right 1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 296
1122256235_1122256244 28 Left 1122256235 14:100479165-100479187 CCAGCCGCTTGGCTGAAGCGAGT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 296
1122256234_1122256244 29 Left 1122256234 14:100479164-100479186 CCCAGCCGCTTGGCTGAAGCGAG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 296
1122256236_1122256244 24 Left 1122256236 14:100479169-100479191 CCGCTTGGCTGAAGCGAGTGTCC 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 296
1122256233_1122256244 30 Left 1122256233 14:100479163-100479185 CCCCAGCCGCTTGGCTGAAGCGA 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG 0: 1
1: 0
2: 1
3: 25
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122256244 Original CRISPR CTGCTCTGAGTCCCTGGCAT AGG Intronic
900227283 1:1539307-1539329 CTGCACTGAGTCCCTGGGCAGGG - Intronic
900859595 1:5218568-5218590 CTGCACTGAGTCCTTGACCTGGG + Intergenic
901222320 1:7590250-7590272 CTGCTATGAGTCCCTGGCCAGGG + Intronic
902470220 1:16643826-16643848 CTGCACTGAGTCCCTGGTGCTGG + Intergenic
902654834 1:17860002-17860024 CTCCTCTGAGTCCCTGGTCAAGG - Intergenic
902803449 1:18845845-18845867 CTGCTCTCAGTCACTTGCCTGGG - Intronic
903001263 1:20267606-20267628 CTTCCCTGAGTCTCTGGCAGTGG + Intergenic
903022608 1:20404650-20404672 CTACTTTGCATCCCTGGCATAGG + Intergenic
905183405 1:36179767-36179789 CTGCTCAGGGACCCTGGGATTGG - Intronic
907856997 1:58313374-58313396 CAGGTCTGTGTCCCTGTCATGGG - Intronic
907920365 1:58905823-58905845 CAGGTCTTAGTGCCTGGCATTGG + Intergenic
908543855 1:65146573-65146595 CTTCTCTGAGTCCTGGGTATTGG + Intergenic
911274166 1:95840650-95840672 CTGCACTGACTTTCTGGCATTGG + Intergenic
911902647 1:103525450-103525472 CGGCTCTTAATCCCTGGCCTTGG - Intergenic
913210686 1:116579825-116579847 CTTCTCAGAGACCGTGGCATTGG + Exonic
914674172 1:149895615-149895637 CTGCTTTGAGACCCGGACATTGG - Intronic
916010888 1:160704494-160704516 CTGCACTGACTCACTGGCAATGG + Intronic
917232995 1:172857959-172857981 CTGCTCCCAGTCCCTGGCTCTGG + Intergenic
918757754 1:188358619-188358641 CTGCACTGAGCCCCTGCCCTAGG - Intergenic
918951823 1:191150311-191150333 CTGCTCAGAGTCCCTTGCATTGG - Intergenic
920496735 1:206460300-206460322 CTGCCTTGAGTCCCTGGGCTAGG + Intronic
923125127 1:231028011-231028033 CTGCTCTGAGTTTCTGGGCTGGG - Intronic
1062834217 10:625281-625303 TGGCTCTGAGTCACTGTCATGGG - Intronic
1063499090 10:6536980-6537002 CTACTCTGAGCCCCTGGCTTGGG - Intronic
1066017582 10:31263630-31263652 CTTCACTCATTCCCTGGCATAGG - Intergenic
1067552156 10:47243740-47243762 CTGCACAGAGTCCCTGGCTTTGG - Intergenic
1067690268 10:48497294-48497316 CAGCTCTGTCTCCTTGGCATGGG + Intronic
1067698484 10:48552323-48552345 CTGCCCTGATTTCCTGGCCTAGG + Intronic
1068657895 10:59593390-59593412 CTGCACTGAGACCCTGCCACGGG - Intergenic
1069713961 10:70508903-70508925 CTGGTCTGAGCCCCTGCCCTGGG + Intronic
1069991794 10:72320807-72320829 CTGCCCTGAGTCACTGGAGTAGG + Intergenic
1072215888 10:93286806-93286828 TTGATCTGAGTCCCAGGCACTGG + Intergenic
1072311185 10:94156893-94156915 CTGCTCCCAGTTCCTGACATAGG - Intronic
1073571569 10:104584792-104584814 CTGCTCTGTGTCCCTTAGATGGG - Intergenic
1074159913 10:110829005-110829027 GTCCTCTGAGTCCCTGTCCTGGG - Intronic
1075177234 10:120176793-120176815 GTTCTCTGAGTACCTGGCACTGG + Intergenic
1075180294 10:120204933-120204955 CTCCTCTGAGTCCCAGGTCTGGG + Intergenic
1075863189 10:125695595-125695617 CTGCTCTGATTGGCTGGTATTGG - Intergenic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1077305308 11:1866322-1866344 CAGCACTGAGTGCCTGGCCTGGG - Intronic
1079075114 11:17380404-17380426 GTGCTCTGAGCCACTGGGATAGG + Intergenic
1080418106 11:32088562-32088584 CTGGCCTGGGTCCCTGGGATTGG - Intronic
1081910071 11:46694900-46694922 CTGCTCTGAGGCATTGGCGTGGG - Intronic
1082958218 11:58894421-58894443 CTGCTCTGTCACCCTGCCATTGG + Intronic
1083269402 11:61563998-61564020 CTGCTATGAGTGCCTGTCATTGG - Intronic
1083502917 11:63127998-63128020 CTGCTCTCAGTCTCTTGCGTCGG - Intronic
1083792862 11:64997061-64997083 CTGCTCAGAATCCCTGGCTCAGG + Intergenic
1084308549 11:68302399-68302421 CTGCTCTGTGTTCCTGTCCTGGG + Intergenic
1084553677 11:69863771-69863793 CAGCTCTGAGGCCCAGGCACTGG + Intergenic
1086079010 11:82883258-82883280 CTGCTTTGCCTCCCTGCCATGGG - Intronic
1086940210 11:92789491-92789513 CTGCTCTGAGTCCACCTCATTGG + Intronic
1089092975 11:115893640-115893662 TGTCTCTGAGTCCCTGGCACAGG + Intergenic
1090522436 11:127493692-127493714 CTCCACTGGGTCCCTGGCCTTGG + Intergenic
1092261930 12:6957561-6957583 ATGTTCTGAGTGCCTGGCACCGG - Intronic
1092970871 12:13693570-13693592 CTGAGCTGGGTCCCTGACATTGG + Intronic
1093448245 12:19284899-19284921 CTGCTCTGTCTCCCAGGCTTGGG - Intronic
1093624222 12:21327088-21327110 GTGCTCTGGGTCCCAGCCATGGG + Intronic
1096529590 12:52234372-52234394 CAGCCCTGAGTTCCTGGCTTTGG - Intronic
1097048539 12:56206054-56206076 CTGCTCTGATTCCCTGGTTTTGG + Exonic
1097513135 12:60568260-60568282 CTGCTCTCATTGGCTGGCATTGG - Intergenic
1101584745 12:106075654-106075676 CTGTCAAGAGTCCCTGGCATTGG - Intronic
1102025901 12:109714252-109714274 CTGCTCTGAGCCCCGGGTGTGGG - Exonic
1102760021 12:115376946-115376968 CTTTTCTGACTACCTGGCATTGG - Intergenic
1102949235 12:117018359-117018381 CTCCTCTTTGTCCCTGGAATCGG + Intronic
1103281165 12:119759142-119759164 CTGCTCTGTGGCCCTGGGGTTGG - Intronic
1103611877 12:122129115-122129137 CTGCTCTCTGTCCCTGTCCTAGG + Exonic
1104375117 12:128259056-128259078 CTTCCCTGAGGCTCTGGCATGGG - Intergenic
1104678562 12:130732410-130732432 CTGCCCTGAGTCCCTGTGAAGGG - Intergenic
1104901592 12:132192231-132192253 CTGCTCCGAGCCCCTGTCGTCGG + Intergenic
1105667007 13:22571028-22571050 CTGCACTGACTCTATGGCATTGG + Intergenic
1107703128 13:43069767-43069789 CTATTCTGAGTTCCTGGCACAGG + Intronic
1110616337 13:77546253-77546275 TTTCTCTGAGTGCCTGGTATGGG + Intronic
1110993167 13:82069733-82069755 TTGCTCTCAGTCCCAGGTATGGG + Intergenic
1114265974 14:21072811-21072833 CCGCTCTGAGACCTTGGCTTTGG - Intronic
1115963711 14:38863828-38863850 CTGCTCTCAGTCCCAGGTCTGGG + Intergenic
1117971187 14:61252400-61252422 TTGCTCTGAGTTCCTGACAGAGG + Intronic
1119779392 14:77268305-77268327 CTGCTGTGTGGCCCTGACATGGG - Intronic
1120578864 14:86221206-86221228 CTGCTGTTAGTCCCTGGCCTGGG + Intergenic
1121613505 14:95297154-95297176 CTCCACTGAGCCCCAGGCATAGG - Intronic
1121714150 14:96060742-96060764 CTGGGCTGAGTCCCTGGCACTGG - Intronic
1121820578 14:96962605-96962627 CTGCTCTGAGACACTGGGTTAGG - Intergenic
1122256244 14:100479216-100479238 CTGCTCTGAGTCCCTGGCATAGG + Intronic
1202905235 14_GL000194v1_random:67928-67950 CTGCTCTGGGTCCCTGAAAGAGG + Intergenic
1123404678 15:20012636-20012658 CTGGTCAGCGTCCCTGGGATGGG + Intergenic
1123514011 15:21019283-21019305 CTGGTCAGCGTCCCTGGGATGGG + Intergenic
1126662001 15:51042471-51042493 CTGGTCCTAGTCACTGGCATAGG + Intergenic
1127868075 15:63048080-63048102 CTTCTCTGGCTCCCGGGCATGGG + Intronic
1129362084 15:75030288-75030310 CTGTGCTGAGTCACTGGCACAGG - Intronic
1129413317 15:75361470-75361492 CTGCTATGTGACCCTGGCAGAGG + Intronic
1129461950 15:75704064-75704086 CTGCCAGGACTCCCTGGCATTGG - Intronic
1129722904 15:77887781-77887803 CTGCCAGGACTCCCTGGCATTGG + Intergenic
1130028019 15:80286448-80286470 GGGCTCTTAGTACCTGGCATAGG + Intergenic
1130993197 15:88889018-88889040 CTTCTCTGAGTGCCTCCCATTGG - Intronic
1131651004 15:94399725-94399747 TTGATAAGAGTCCCTGGCATGGG - Intronic
1133374705 16:5274727-5274749 CACCTCTCAGTCCCTTGCATAGG + Intergenic
1133665592 16:7964546-7964568 CTGCCCCGAGCCCCAGGCATTGG - Intergenic
1134443572 16:14313963-14313985 CTGCTTTGAGGCCAAGGCATGGG + Intergenic
1135247282 16:20867808-20867830 CTGCACTGAGTCACTGGCCCAGG + Intronic
1137559114 16:49491960-49491982 CTGCACTGAGTCCCTGTCTCTGG - Intronic
1138376853 16:56570115-56570137 CTGCTCTGTGACCTTGGCAAAGG - Intergenic
1139073950 16:63419928-63419950 CTCCTCTCTTTCCCTGGCATAGG + Intergenic
1140141647 16:72264018-72264040 CTGCTCTGTGTGGCTGGGATCGG + Intergenic
1142412736 16:89924492-89924514 CTGAGCTGGGTCCCTGGCCTTGG - Intronic
1144576326 17:16432017-16432039 CTGCACTGACTCTGTGGCATTGG - Exonic
1145017917 17:19411114-19411136 CGGCTCAGAATCCCTGGCAGAGG - Intronic
1145997346 17:29112218-29112240 TTGCTCTCACTCCCTGGCAGTGG + Intronic
1147382746 17:40065245-40065267 CTGCTCTGAGTCATTTGCCTGGG + Intronic
1147677381 17:42217494-42217516 ATGTCCTGAGACCCTGGCATGGG - Intronic
1148333107 17:46823830-46823852 CATCTCTGAGTCCCTGGCTTCGG + Intronic
1150620713 17:66806092-66806114 CTACTCTGAGGACCTTGCATGGG - Exonic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1155663650 18:28281711-28281733 CTGGTCTCAGTCCCTGGTCTGGG - Intergenic
1157304617 18:46507886-46507908 CTGTCCTGTGTGCCTGGCATGGG + Intronic
1157427226 18:47594317-47594339 CTGCTTTGAGGGCTTGGCATAGG - Intergenic
1157500490 18:48187047-48187069 TTGATCTGTGTCCCTGGCAGAGG + Intronic
1157675660 18:49566806-49566828 CTGGTCTGAGTCCCTGTTACAGG - Intronic
1159566459 18:70056531-70056553 GTGTTCTGAGTGTCTGGCATAGG - Intronic
1161478748 19:4500185-4500207 CTGCTCTGAGCACCTGTAATGGG - Intronic
1162447209 19:10730833-10730855 CTGCTCAGTGGCCCTGGCAGGGG + Intronic
1163699162 19:18778572-18778594 CTGTTCTGTGGCCCTGGCAGAGG - Exonic
1165399840 19:35591701-35591723 CTGTTCTCAGTCCTTTGCATTGG + Intergenic
1165948065 19:39457239-39457261 CTGTTCTGAGTACCTGACACAGG - Intronic
1166467220 19:43043218-43043240 CTTCTCTGATTCCTGGGCATAGG + Intronic
1166473356 19:43099304-43099326 CTTCTCTGATTCCTGGGCATAGG + Intronic
1166786287 19:45369228-45369250 CTGTTCTGAGTTGGTGGCATTGG - Intronic
1166980758 19:46630816-46630838 CTGCTCTGAGCGCCTGGGTTGGG + Intergenic
1167459080 19:49614970-49614992 GTGCTCGGAAACCCTGGCATCGG + Exonic
1168589244 19:57618980-57619002 CTTCTCTGATTCCCTCACATAGG + Intronic
925349187 2:3189320-3189342 CTGCTATGACTCCCGGGCCTGGG - Exonic
925577665 2:5377229-5377251 CTGCACTGTGTGCCTGGCCTGGG + Intergenic
926164002 2:10506770-10506792 CTCCTCTGACTCCCTGGCCATGG - Intergenic
926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG + Intergenic
926394565 2:12427869-12427891 CTTCACTGAGGCCCTGGCAGGGG - Intergenic
926924639 2:17975198-17975220 CTGCTCTGAGACCCTAGGACAGG - Intronic
928300199 2:30117934-30117956 CCTTTCTTAGTCCCTGGCATTGG - Intergenic
928950283 2:36807833-36807855 CTTCCCTGAGTCCCTGAGATTGG - Intronic
928983036 2:37156076-37156098 CTGCTCTGATAAGCTGGCATGGG + Intronic
930140358 2:47945241-47945263 CTGCAGTGAGGCCCTGGCATAGG - Intergenic
931183762 2:59929839-59929861 CTGCTCTGAGGATCTGGCAGGGG + Intergenic
933204128 2:79485598-79485620 CTGCTCTCAGTGCCTATCATGGG - Intronic
933420728 2:82042770-82042792 CTGCTCTTAGTCCCTGTGAATGG - Intergenic
934138485 2:89020630-89020652 ATGCTCTGGGTCCCTGGTAAGGG - Intergenic
934230759 2:90179923-90179945 ATGCTCTGGGTCCCTGGTAAGGG + Intergenic
934501397 2:94862555-94862577 CTGCTCTGGGTCCCTGAAAGAGG - Intergenic
935207928 2:100912745-100912767 CTCCTCTTAGTACCTGGCTTTGG + Intronic
935291936 2:101618415-101618437 CAGATCTGAGCCCCTGACATAGG + Intergenic
936105091 2:109615946-109615968 CTGCTCTGGGTCCCTGAAAGAGG - Exonic
936551475 2:113445812-113445834 TTGATCTGGGTCTCTGGCATTGG + Intronic
937217586 2:120322417-120322439 CTGCCCTGTGACCTTGGCATTGG + Intergenic
937394374 2:121521644-121521666 CTGCTCTGAGTCACTGCATTCGG + Intronic
937485313 2:122309188-122309210 GTGCTCTGAGCACCTGGCCTGGG - Intergenic
938241733 2:129747625-129747647 CTGCTCTCAGTCCCAGGTCTGGG - Intergenic
940928642 2:159398249-159398271 TTGTTCTGATTTCCTGGCATGGG - Intronic
942248879 2:174031259-174031281 CTGCTCTGGGCACCTGGGATAGG + Intergenic
946772264 2:223100772-223100794 CCGATCTGTGTCACTGGCATCGG - Intronic
1169663929 20:8012952-8012974 CAGCTCTGAGTCTTTAGCATGGG + Intronic
1169856746 20:10111294-10111316 CTGCTCAGAGTCCACTGCATTGG + Intergenic
1169882826 20:10366083-10366105 CTGCTCACAGTTCCTGGCACAGG - Intergenic
1171284224 20:23924265-23924287 GTCCTCTGGGTCCCTGGCAAAGG - Intergenic
1171892602 20:30729344-30729366 CTGCTCTGGGTCCCTGAAAGAGG - Intergenic
1172102381 20:32493062-32493084 CTGCTGTGAGGCCCTGCCTTGGG + Intronic
1173428009 20:42959433-42959455 CGGGTCTCAGTCCCTGGCACAGG - Intronic
1174591161 20:51646149-51646171 CTGGCCTGAGTCCCTCACATGGG - Intronic
1174702174 20:52620197-52620219 CTTCTCTGAGTTCCTGACGTTGG + Intergenic
1175169498 20:57070205-57070227 CTGGTCTGAGGCCCTGGACTAGG - Intergenic
1175378240 20:58544145-58544167 CTCCGCTCAGTCCCAGGCATTGG - Intergenic
1175514633 20:59561207-59561229 CTTCTCTGCGTCCCTGGGTTTGG - Intergenic
1175829120 20:61952423-61952445 ATGCACTGAGACCCTGGCCTGGG + Intergenic
1175858990 20:62139578-62139600 CTGTTCTCAGTTCCTGGCATGGG - Intronic
1176017529 20:62943436-62943458 CTGCCCTAAGTCCCTGGCCTGGG + Intronic
1176341054 21:5696580-5696602 CTGCTCTGAGCCTCGGGCGTGGG - Intergenic
1176473308 21:7128733-7128755 CTGCTCTGAGCCTCGGGCGTGGG - Intergenic
1176503773 21:7627876-7627898 CTGCTCTGAGCCTCGGGCGTGGG + Intergenic
1178003723 21:28193078-28193100 CTGCCCTGAGTCCATGTCAGAGG + Intergenic
1178470976 21:32892465-32892487 CGGCTGTGAGTCTCAGGCATGGG + Intergenic
1179576862 21:42313340-42313362 CTGCTCTGAGGCCTTGGAACAGG + Intronic
1180210438 21:46292747-46292769 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210451 21:46292821-46292843 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210508 21:46293117-46293139 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210551 21:46293339-46293361 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210564 21:46293413-46293435 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210592 21:46293561-46293583 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210620 21:46293709-46293731 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210634 21:46293783-46293805 CCCCACTGAGTCCCGGGCATGGG - Intronic
1180210663 21:46293931-46293953 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210676 21:46294005-46294027 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210689 21:46294079-46294101 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210702 21:46294153-46294175 CTCCACTGAGTCCCGGGCACAGG - Intronic
1180210714 21:46294227-46294249 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210727 21:46294301-46294323 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210770 21:46294523-46294545 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180210798 21:46294671-46294693 CTCCACTGAGTCCCGGGCACGGG - Intronic
1180731766 22:17987614-17987636 TTGCTCGGAGTACCTGCCATAGG - Intronic
1180840853 22:18958215-18958237 CTGCTCAGAGGCCCTGGCTATGG + Intergenic
1181060637 22:20280559-20280581 CTGCTCAGAGGCCCTGGCTATGG - Intronic
1181306809 22:21921660-21921682 CTGCTGGGAGTCCATGGCACAGG - Exonic
1182038459 22:27217663-27217685 CTGTTCTGAGTGCCTTGCAAGGG - Intergenic
1182458419 22:30467625-30467647 CTTCTCTGAGTCCCCCGCCTGGG - Intronic
1182471511 22:30551268-30551290 TTGCTCTGTGACCCTGGCAGAGG + Intergenic
1185273975 22:49941992-49942014 CTGCACTGAGCACCTGCCATAGG - Intergenic
1185382890 22:50518257-50518279 CCCTTCTGGGTCCCTGGCATGGG - Exonic
1203240320 22_KI270733v1_random:11038-11060 CTGCTCTGAGCCTCGGGCGTGGG - Intergenic
950202779 3:11056745-11056767 CTGCTCAGGGTCGCTGGAATGGG + Intergenic
950641710 3:14352702-14352724 GTGCTCTGGGTTCCTGACATCGG + Intergenic
953026181 3:39146542-39146564 CTCCTCTGAGTCCCAGGCACGGG + Exonic
954299208 3:49690427-49690449 CTGCACTGAGTCCCTGGTGCTGG - Intronic
954460238 3:50622428-50622450 CTGCCCAGAGTTCCTGGCTTTGG + Intronic
954638873 3:52086199-52086221 CTGCTCTGAGTCTCAGGGAGAGG + Intronic
954676245 3:52317275-52317297 CTGCTCTCAGCACCTGGCATGGG - Intronic
954926284 3:54237959-54237981 GTGCTTTGAGTCCCTGGGAGTGG + Intronic
956489081 3:69752500-69752522 CTGCATTGTGTCCCTGCCATAGG + Intronic
956778957 3:72589533-72589555 GTGCTCTGAGTCCCTGTCTCAGG - Intergenic
959915115 3:111808041-111808063 CTGGGCTGGGTCCCAGGCATTGG - Intronic
960018706 3:112923764-112923786 CTTCTCTGTGTAGCTGGCATAGG + Exonic
960580693 3:119276185-119276207 CTTCACTGAGTCCCTTGCAGAGG + Intergenic
960882880 3:122363817-122363839 CTGCTCTCAGGGCCTGGCAATGG - Intronic
961371670 3:126435316-126435338 CTGCTCCGAGGCCCTGGCTCTGG - Intronic
961469586 3:127102923-127102945 CTGCTCTGAATCTCTGGCTGGGG - Intergenic
961597319 3:128028796-128028818 CTACTCTGAATTCCTGGCATTGG - Intergenic
961643922 3:128382342-128382364 CTGCTCTGAGACGAGGGCATAGG - Intronic
961939036 3:130618166-130618188 CTGCTCTGAGGCCCTTGTGTGGG - Intronic
964330341 3:155595086-155595108 CTGCTCAGCATCCCTGGAATGGG - Intronic
967537443 3:190623114-190623136 CTGCTCCCAGTTCCTGACATGGG - Intronic
969509474 4:7609604-7609626 CTGCTCTGTGTCCTTGGCCTAGG + Intronic
969906083 4:10397061-10397083 CTGCTCTCAGTCCCTGGTCTGGG + Intergenic
970291666 4:14579497-14579519 CTGCTCTGATTCTCAGGCTTTGG - Intergenic
970291670 4:14579546-14579568 CTGCTCTGATTCTCAGGCTTTGG - Intergenic
971223088 4:24726804-24726826 CTGCACTGAGTAAATGGCATGGG - Intergenic
973757051 4:54085548-54085570 CTGCCCTGAGTCTCTGGACTTGG - Intronic
975732718 4:77353568-77353590 CTGGTCTGACTCCCAAGCATTGG + Intronic
980985747 4:139692507-139692529 CTGCTCTGGGTCTGTGGCAGAGG + Intronic
983178822 4:164623378-164623400 CTGTGCTGAGGCCCTGCCATTGG - Intergenic
987254151 5:16132057-16132079 ATGCTCTGAGCCCTTGCCATGGG - Intronic
989410565 5:41115495-41115517 CTGCTCTGAGTGCTTCACATAGG - Intergenic
991386059 5:66091813-66091835 CTGCTCTGTGTCACTCCCATGGG + Intergenic
996768857 5:127064318-127064340 CAGCTCTAACTCACTGGCATAGG + Intronic
997295594 5:132766479-132766501 TTTCTCTGACTCCCTGGAATGGG + Intronic
997451307 5:133985882-133985904 CTGGTCAGAGGCCCTGCCATAGG - Intronic
997537275 5:134632623-134632645 CTACTCTGAGTCCCTGCCTGTGG - Intronic
998181645 5:139950217-139950239 ATCGTCTGTGTCCCTGGCATTGG - Intronic
998668683 5:144329010-144329032 CTGCTCTGAGTCTCAAGCCTGGG - Intronic
1000011060 5:157233276-157233298 CTGATCTCAGTCCATGGCATTGG + Intronic
1000175522 5:158748752-158748774 CTGCTCCGAGTCAGTGGCAAAGG + Intronic
1000716770 5:164653664-164653686 CTGCTCTGAGTCCTGGGTCTGGG + Intergenic
1001211422 5:169813508-169813530 TTGTTTTGAGTCCCTGGCAGGGG - Intronic
1001381038 5:171306925-171306947 CAGCCCTGAGTCCCGGGCACTGG + Exonic
1001555221 5:172632507-172632529 CAGCTCTGGGCCCCTGGCTTGGG - Intergenic
1002570938 5:180139005-180139027 CTGCTGTCAGTACCTGGCACAGG + Intronic
1003761963 6:9188616-9188638 CTGCCGTGTGTCCCTGGGATGGG - Intergenic
1004511306 6:16286272-16286294 CTGCTGTGAGCCCGTGGGATTGG + Intronic
1005434050 6:25788687-25788709 ATGCTCTGATTCCCTGACACAGG - Intronic
1005735601 6:28742751-28742773 GTGCACTTTGTCCCTGGCATAGG - Intergenic
1007064692 6:38977870-38977892 CTGTTCTGGGGCCCAGGCATTGG - Intronic
1007120627 6:39377756-39377778 CAGCTCTGAGTCCCCTGCAAGGG - Intronic
1007165060 6:39823405-39823427 CCTCTCTGAGTCTCTGGCCTAGG - Intronic
1007306241 6:40907608-40907630 CTGCTCTGCCTCACTGGCCTTGG - Intergenic
1009502831 6:64438039-64438061 CTGCTCTGAATACCTGGTTTAGG - Intronic
1011940581 6:92837319-92837341 CTGGTCTGAGGCCCTGGGATTGG - Intergenic
1014322110 6:119942873-119942895 CTGCTCTCAGTCCCAGGTCTGGG + Intergenic
1015555616 6:134458805-134458827 CTGCTCTCAAACCCTGGCAGTGG + Intergenic
1015672154 6:135702982-135703004 GTTCTATGAGTCCCTGGCATTGG - Intergenic
1017626325 6:156352578-156352600 CTGCCCTGGGGCCCTGGCAAAGG - Intergenic
1017809882 6:157977087-157977109 CTGCTCAGAGTCCCTGCCACAGG + Intergenic
1018643134 6:165923355-165923377 CTGCTCTGAACACCTGGAATAGG - Intronic
1018812065 6:167305498-167305520 CTGCTCTGAGGCCCCGGAAGAGG + Intronic
1019521065 7:1460663-1460685 CTGCCCTGACTCCCTGCCAGGGG - Intergenic
1022473194 7:30694282-30694304 CGCCTCTCAGTGCCTGGCATGGG + Intronic
1023891252 7:44393417-44393439 CTCCTCTGTGTCCCTGGGACAGG - Intronic
1024222417 7:47298992-47299014 CAGCCCTGGGTCCCTTGCATGGG - Intronic
1026934098 7:74242169-74242191 GTGCTCTGAGTACTTGGTATAGG - Intronic
1026950079 7:74340988-74341010 CTGCTCTGAGAACCTGGCAAAGG + Intronic
1029550887 7:101236553-101236575 CAGCGCTCAGTCTCTGGCATAGG + Intronic
1029651431 7:101895410-101895432 CTGGCCTGGGACCCTGGCATGGG + Intronic
1032843552 7:135733944-135733966 CTGCTCTGAGGTCCTGGTGTGGG + Exonic
1034243646 7:149627933-149627955 CTGCCGTGAGTCCCTGGGTTGGG - Intergenic
1034284780 7:149877669-149877691 CCCCTCTGAGGCCCTGCCATGGG - Intronic
1036180131 8:6577136-6577158 CTGCTCTCAGCCCCGGGCAAAGG + Intronic
1036212371 8:6852878-6852900 CTTCTCTGGCTCCCTGGGATGGG - Intergenic
1039504721 8:38043681-38043703 TCCCTCTGAGGCCCTGGCATGGG - Intronic
1040671614 8:49698108-49698130 CTGCTCAGCATCCCTGGCCTGGG - Intergenic
1048182641 8:132210347-132210369 CTGCAGTGAGTGCCTGCCATGGG + Intronic
1049901523 9:171316-171338 TTGATCTGGGTCTCTGGCATTGG - Intronic
1050283709 9:4079135-4079157 CTTCTCTGATTCCCTGAAATAGG + Intronic
1050647934 9:7742102-7742124 CTGCTCTGGGTCCCAAGGATGGG + Intergenic
1050654361 9:7809973-7809995 CTGCACTCAGAGCCTGGCATGGG + Intronic
1052995952 9:34551775-34551797 CTCCTGGGAGTCGCTGGCATTGG + Exonic
1053744556 9:41181611-41181633 TTGATCTGGGTCTCTGGCATTGG - Intronic
1054349825 9:64011504-64011526 TTGATCTGGGTCTCTGGCATTGG - Intergenic
1054356222 9:64066392-64066414 CTGCTCTGGGTCCCTGAAAGAGG + Intergenic
1054482715 9:65683599-65683621 TTGATCTGGGTCTCTGGCATTGG + Intronic
1054683789 9:68249639-68249661 TTGATCTGGGTCTCTGGCATTGG + Intronic
1055054817 9:72013975-72013997 CCACCCTGAGTGCCTGGCATAGG + Intergenic
1056953981 9:91067775-91067797 CTGCCCTGAAACCCTGGCCTGGG + Intergenic
1057229245 9:93308874-93308896 CTGCTCTGAGTGCGGGGCTTGGG - Intronic
1057706736 9:97400016-97400038 CTGTTATGAGTCAGTGGCATCGG - Intergenic
1058063173 9:100521053-100521075 CTTCTCTGCTTCCCTGGAATAGG + Intronic
1059001896 9:110357147-110357169 CTGCTCTGAGCCCCAGCCTTGGG + Intergenic
1060034148 9:120240675-120240697 CTTCTCTGTGTCCCTAGCACTGG - Intergenic
1060149010 9:121275466-121275488 CTTCTCTGAGTCCATGAAATGGG - Intronic
1061260361 9:129477254-129477276 CTGCTTTGTGTCCCTGGGGTTGG + Intergenic
1062629450 9:137457340-137457362 CTGCTGTCAGACCCTGGCAGCGG + Intronic
1062708276 9:137957252-137957274 CTGCTCAGAGCCGCAGGCATGGG - Intronic
1062729108 9:138098669-138098691 CTGCTCTGAGACTCTGGCTTTGG - Intronic
1203422013 Un_GL000195v1:1413-1435 CTGCTCTGAGCCTCGGGCGTGGG + Intergenic
1203561967 Un_KI270744v1:64863-64885 CTGCTCTGAGTCCCTGAAAGAGG - Intergenic
1185734491 X:2486645-2486667 CTGCCCTGCGTCCCCGGCCTCGG + Exonic
1187155057 X:16714163-16714185 CTCCTCAGAGGCCCTGGCCTTGG - Intergenic
1189337986 X:40182334-40182356 CTGCCCTCTGTCCCTGGCAGGGG + Intergenic
1190434608 X:50410978-50411000 CTGCTCTGTGTTCCTGCCAATGG + Intronic
1191773956 X:64792647-64792669 CTGCTCTTAGTCCCAGGTCTGGG - Intergenic
1191987191 X:66994725-66994747 CTGCTATAAGCCCCTGACATGGG + Intergenic
1192442158 X:71182609-71182631 CAGCTCTGAGTCCCTAGCAAAGG + Intergenic
1193951397 X:87804408-87804430 CTGCTCTCAGTCCTTGCTATGGG + Intergenic
1194059864 X:89182977-89182999 CTGCCCTGAGGCCCAGGCAGTGG + Intergenic
1194157044 X:90404202-90404224 CTGCTCTCAGTCCCAGGTCTGGG - Intergenic
1194333567 X:92615702-92615724 CTGCTGTCAGTCCTTGGCCTGGG + Intronic
1197156237 X:123273043-123273065 CTGCTCTGAGCTCATGTCATAGG + Intronic
1197499345 X:127225094-127225116 CTGCTCAGAGTCCCTTTCATTGG + Intergenic
1199100826 X:143797874-143797896 TTGTTCTGAGTCACTGGCTTGGG + Intergenic
1200012017 X:153126684-153126706 CTGCTCAGAGTGCCTGGAGTAGG + Intergenic
1200027583 X:153273235-153273257 CTGCTCAGAGTGCCTGGAGTAGG - Intergenic
1200642249 Y:5734706-5734728 CTGCTGTCAGTCCTTGGCCTGGG + Intronic
1201161109 Y:11168109-11168131 CTGCTCTGGGTCCCTGAAAGAGG + Intergenic