ID: 1122260636

View in Genome Browser
Species Human (GRCh38)
Location 14:100518766-100518788
Sequence CTGTAGTCCCAGCTAGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5842
Summary {0: 1, 1: 4, 2: 98, 3: 965, 4: 4774}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122260629_1122260636 27 Left 1122260629 14:100518716-100518738 CCCCGTCTCTACTAAAATACAAA 0: 2515
1: 7468
2: 9497
3: 21779
4: 156673
Right 1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG 0: 1
1: 4
2: 98
3: 965
4: 4774
1122260633_1122260636 -3 Left 1122260633 14:100518746-100518768 CCAGGCATTGCAACGTGTGCCTG 0: 1
1: 0
2: 39
3: 393
4: 2907
Right 1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG 0: 1
1: 4
2: 98
3: 965
4: 4774
1122260631_1122260636 25 Left 1122260631 14:100518718-100518740 CCGTCTCTACTAAAATACAAAAA 0: 5223
1: 6023
2: 7527
3: 27046
4: 265462
Right 1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG 0: 1
1: 4
2: 98
3: 965
4: 4774
1122260630_1122260636 26 Left 1122260630 14:100518717-100518739 CCCGTCTCTACTAAAATACAAAA 0: 4694
1: 7812
2: 9669
3: 28265
4: 238330
Right 1122260636 14:100518766-100518788 CTGTAGTCCCAGCTAGAGGACGG 0: 1
1: 4
2: 98
3: 965
4: 4774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122260636 Original CRISPR CTGTAGTCCCAGCTAGAGGA CGG Intronic
Too many off-targets to display for this crispr