ID: 1122260636 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:100518766-100518788 |
Sequence | CTGTAGTCCCAGCTAGAGGA CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 5842 | |||
Summary | {0: 1, 1: 4, 2: 98, 3: 965, 4: 4774} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1122260629_1122260636 | 27 | Left | 1122260629 | 14:100518716-100518738 | CCCCGTCTCTACTAAAATACAAA | 0: 2515 1: 7468 2: 9497 3: 21779 4: 156673 |
||
Right | 1122260636 | 14:100518766-100518788 | CTGTAGTCCCAGCTAGAGGACGG | 0: 1 1: 4 2: 98 3: 965 4: 4774 |
||||
1122260633_1122260636 | -3 | Left | 1122260633 | 14:100518746-100518768 | CCAGGCATTGCAACGTGTGCCTG | 0: 1 1: 0 2: 39 3: 393 4: 2907 |
||
Right | 1122260636 | 14:100518766-100518788 | CTGTAGTCCCAGCTAGAGGACGG | 0: 1 1: 4 2: 98 3: 965 4: 4774 |
||||
1122260631_1122260636 | 25 | Left | 1122260631 | 14:100518718-100518740 | CCGTCTCTACTAAAATACAAAAA | 0: 5223 1: 6023 2: 7527 3: 27046 4: 265462 |
||
Right | 1122260636 | 14:100518766-100518788 | CTGTAGTCCCAGCTAGAGGACGG | 0: 1 1: 4 2: 98 3: 965 4: 4774 |
||||
1122260630_1122260636 | 26 | Left | 1122260630 | 14:100518717-100518739 | CCCGTCTCTACTAAAATACAAAA | 0: 4694 1: 7812 2: 9669 3: 28265 4: 238330 |
||
Right | 1122260636 | 14:100518766-100518788 | CTGTAGTCCCAGCTAGAGGACGG | 0: 1 1: 4 2: 98 3: 965 4: 4774 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1122260636 | Original CRISPR | CTGTAGTCCCAGCTAGAGGA CGG | Intronic | ||
Too many off-targets to display for this crispr |