ID: 1122261922

View in Genome Browser
Species Human (GRCh38)
Location 14:100528568-100528590
Sequence GCCTCATAGAAAGAAAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122261922_1122261923 7 Left 1122261922 14:100528568-100528590 CCTTGGCTTTCTTTCTATGAGGC 0: 1
1: 0
2: 3
3: 16
4: 201
Right 1122261923 14:100528598-100528620 GACTGCATTTAGTGTAATATAGG 0: 1
1: 0
2: 1
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122261922 Original CRISPR GCCTCATAGAAAGAAAGCCA AGG (reversed) Intronic
905298682 1:36971373-36971395 GCCTCACAGAAGCAAAGTCAAGG + Intronic
905615416 1:39394282-39394304 GCCACATAGAAAGCAAGCTTAGG + Intronic
905649317 1:39646004-39646026 GGCTCATAGAAAGAAAAGCCAGG - Intergenic
906639383 1:47432628-47432650 GCCTCATAGAAGCAAAGCCAGGG - Intergenic
907284219 1:53369959-53369981 GACTTTTAGAAAGAAACCCAAGG + Intergenic
907564479 1:55422129-55422151 GCCTCATTGCAAGAAAGACTGGG - Intergenic
909124136 1:71643581-71643603 GCCTCAAAGAAAGAGAGAAAAGG + Intronic
909895611 1:81065634-81065656 GCCACATAAAAAGAGAGCCTCGG + Intergenic
910126832 1:83851711-83851733 GCCTTATCCAAAGAAAACCAAGG + Intergenic
910728648 1:90365408-90365430 GCTGCACAGAAAGAAAGCCCAGG + Intergenic
911806823 1:102221016-102221038 TCCTGATAGAAAGAAAACCAAGG + Intergenic
911874303 1:103139368-103139390 GCCTCATAGATAGAATGAAATGG - Intergenic
912581256 1:110722953-110722975 TTCACATAGAAAGAAAGCAATGG + Intergenic
913177445 1:116287851-116287873 GCCACAAAGAAAGAGATCCATGG - Intergenic
913465601 1:119139845-119139867 CCCTCATAGCAAAAAAGTCAGGG - Intronic
917048906 1:170895654-170895676 TCATCACAGAAAGAAAGCCTGGG - Intergenic
918946529 1:191073047-191073069 GTATACTAGAAAGAAAGCCAAGG - Intergenic
921511400 1:216034929-216034951 GAATCAAAGAAAGCAAGCCAGGG + Intronic
922610480 1:226923489-226923511 GCCCCAGAGGCAGAAAGCCAAGG + Intronic
922956940 1:229611006-229611028 GCCTCACCGTAAGACAGCCAGGG - Intronic
923152018 1:231241695-231241717 GCCTGATAGAAAGAAAGAGAAGG - Intronic
924425655 1:243947684-243947706 GCGTCCTGGAAAGAAAGCAAGGG + Intergenic
924784784 1:247184761-247184783 TCATCATAGCCAGAAAGCCAGGG + Intergenic
1064262354 10:13796332-13796354 GCCTCATAGATGGAAAGGCGGGG - Intronic
1066342492 10:34549775-34549797 GCCTCATCTAAAGACAGACATGG - Intronic
1068593858 10:58880629-58880651 CACACATAGACAGAAAGCCAAGG - Intergenic
1068926679 10:62547174-62547196 GGCTTATAGAAAGAAAGCAAGGG - Intronic
1070351485 10:75597042-75597064 GACTCAAAGAGAGAAAGCAAGGG - Intronic
1071964912 10:90842663-90842685 ACATCCCAGAAAGAAAGCCATGG - Intronic
1072034546 10:91552259-91552281 GTCTCCTAGGAAGAAAGCCCTGG - Intergenic
1072096598 10:92187679-92187701 GCATCATAGGTAGAAAGTCAAGG + Intronic
1075604184 10:123792516-123792538 GCCCCAGAGACAGGAAGCCAGGG + Intronic
1076082730 10:127598272-127598294 GCCCCATCTAAAGAAGGCCATGG - Intergenic
1077650270 11:3965023-3965045 ACCTAAAAGAAAGAAATCCAAGG - Intronic
1079374265 11:19878191-19878213 GCTTCTGAGAATGAAAGCCAGGG - Intronic
1080097629 11:28428035-28428057 ACTTAATAGAAAGAAAGTCAAGG - Intergenic
1081852102 11:46281084-46281106 TCCTCATAGAAAGAAAAATAAGG - Intronic
1083774605 11:64888257-64888279 GCCTCAGAGAGAGAAGGCCCAGG - Intronic
1085257061 11:75181066-75181088 ATCTCATTAAAAGAAAGCCAGGG + Intronic
1085816195 11:79739691-79739713 GCCTCATAGAAGGACAGAGATGG - Intergenic
1086296786 11:85377055-85377077 GCCACAAAGAAACATAGCCAAGG + Intronic
1086669624 11:89531246-89531268 GCCTCATAGAAAGAAATGCAGGG - Intergenic
1086852391 11:91825327-91825349 GCGTAAGAGAAAGAAGGCCAAGG - Intergenic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1089843375 11:121438725-121438747 GGCTTTTAGAAATAAAGCCATGG + Intergenic
1092296529 12:7203504-7203526 TCATCATAGTCAGAAAGCCAGGG - Exonic
1093372289 12:18379552-18379574 CCCTCTTAGGAAGAGAGCCAGGG - Intronic
1094334709 12:29335985-29336007 GCCTAATATAAACAAAGCAATGG + Intronic
1094755011 12:33457907-33457929 GTCTCATAAAACAAAAGCCAAGG + Intergenic
1096717968 12:53502232-53502254 GACTCCAAGAAACAAAGCCATGG - Intronic
1097742454 12:63259607-63259629 GCCACATGGAAAGACAGCTATGG + Intergenic
1098441595 12:70524532-70524554 TCCTCAGAGCAAGAAAGCTACGG - Exonic
1103171441 12:118823933-118823955 TCCTCATAAGAAGACAGCCATGG + Intergenic
1104605053 12:130182008-130182030 GCACCCTAGAAAGAAAACCATGG + Intergenic
1105540791 13:21314736-21314758 TCCTTACAGAAAGACAGCCACGG + Intergenic
1107656738 13:42599100-42599122 GACTCTTAGAAAGAAACCCTAGG - Intronic
1109417029 13:62053327-62053349 GTATAATAGAAAGAAATCCATGG - Intergenic
1109807368 13:67461043-67461065 ACCTCAGAAAAAAAAAGCCAAGG + Intergenic
1112597055 13:100816872-100816894 GCCTCTTAGAAAGATAGGAAAGG - Intergenic
1112661634 13:101516264-101516286 GTCTCATGAAAAGAAAGCAAAGG - Intronic
1114876335 14:26724258-26724280 GCTGTGTAGAAAGAAAGCCATGG + Intergenic
1117293228 14:54353739-54353761 GCCTCATACAAGTAAAGACAAGG - Intergenic
1117788964 14:59318157-59318179 ACCACATATAAAGAAAGCCCAGG - Intronic
1118075235 14:62290944-62290966 GCCTCATATAAATTAAGCCTTGG + Intergenic
1118753581 14:68823002-68823024 CCCTGAGGGAAAGAAAGCCAGGG + Intergenic
1119055064 14:71410917-71410939 GCCTCAAAGAAAGACAGGTATGG - Intronic
1119104827 14:71914103-71914125 GTCTCAGAGAAGCAAAGCCAGGG - Intergenic
1120278235 14:82405721-82405743 GCCTGATATTAAGAAAGCCACGG + Intergenic
1121516296 14:94553184-94553206 GCTTCATAGAATGAAAGAGAGGG + Intergenic
1121537366 14:94700070-94700092 GCCTCAGAGGAAGAATCCCAAGG + Intergenic
1121748171 14:96319352-96319374 GCCTCATAGACACAGAGTCATGG - Intronic
1122261922 14:100528568-100528590 GCCTCATAGAAAGAAAGCCAAGG - Intronic
1123678701 15:22739831-22739853 TGCTCATAGAAAGAAAACCGGGG - Intergenic
1125821348 15:42634690-42634712 GCTTCATAAAAAGATAGCTAAGG - Intronic
1126835036 15:52653527-52653549 GACTCAGAGAAAGAATGGCATGG + Intronic
1127291289 15:57573729-57573751 GACTCACAGGAAGAGAGCCAGGG + Intergenic
1128905815 15:71466726-71466748 GCCTCCTAGAAAGACAGCCCTGG - Intronic
1129103980 15:73292552-73292574 GCCTCATAGAAAGTAGTACATGG + Intronic
1130758327 15:86790302-86790324 GCTGAATAGAAAGGAAGCCATGG + Intronic
1133574538 16:7075925-7075947 GCCTCATTCAAATAAAGCCATGG - Intronic
1134256233 16:12613921-12613943 GCCTATTTTAAAGAAAGCCAGGG - Intergenic
1136660209 16:31751297-31751319 GCCTCATAGAATGAAAGGGGAGG + Intronic
1137587695 16:49673803-49673825 GCCCCACAGGAAGAAACCCAGGG + Intronic
1138882065 16:61028625-61028647 GACTCAGAGGAAAAAAGCCAAGG - Intergenic
1139304177 16:65969076-65969098 ACCTCATAGAAATAAAGGCTTGG - Intergenic
1140208678 16:72953967-72953989 GCCTCAGAGAAACAAGCCCAGGG + Intronic
1140681299 16:77387603-77387625 GCCTCATTACAAGAAAGACATGG - Intronic
1141087691 16:81108692-81108714 ACCTGTCAGAAAGAAAGCCAGGG + Intergenic
1142338275 16:89504591-89504613 GTCTCATAAAAAAAAAGACAGGG + Intronic
1143621867 17:8085443-8085465 GTCTCAAAAAAAGAAAGCCAGGG + Intronic
1146124018 17:30218036-30218058 GCTTCTTAAAAAGAAGGCCAGGG - Intronic
1146209899 17:30933936-30933958 GCCTGATACACAGAAAGTCAAGG + Intronic
1147589034 17:41669450-41669472 GACTTTGAGAAAGAAAGCCATGG + Intergenic
1147765993 17:42836555-42836577 CCCTCAGAGAAAGAAAGAAAAGG - Intronic
1148135404 17:45288742-45288764 GCCCGGTAGAAAGGAAGCCAGGG - Intronic
1150982004 17:70153081-70153103 GCCTCATAGAAAGCAATTCTTGG - Intergenic
1152846034 17:82600257-82600279 GCCCCAGAGAAACAGAGCCAAGG + Intronic
1203186338 17_KI270729v1_random:124924-124946 TCATCATAGAAAGAAATCGAAGG - Intergenic
1157027770 18:43867087-43867109 GCAGCATAGAAAGAAACCAATGG + Intergenic
1157754649 18:50206981-50207003 GCCTCTTAAAAAGAAATACAAGG - Intergenic
1159808212 18:72981244-72981266 GTCTCAAAGAAAGAAAGAAATGG + Intergenic
1159884431 18:73890880-73890902 GCCTCATAGAGAGAAAGGGCAGG + Intergenic
1159936006 18:74368098-74368120 GCAGCCTGGAAAGAAAGCCAAGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160125874 18:76170861-76170883 GCCTCCTAAAAAGATAGTCAAGG + Intergenic
1163095598 19:15054940-15054962 GCCTCTTAAAAAGAAAGGTAAGG - Intronic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
1165650449 19:37483367-37483389 GCTTCAGAGAAAGAAAATCAGGG - Intronic
1168065730 19:53919290-53919312 GCCTCAGAGAGAGAAAGACAGGG + Intronic
926910114 2:17844726-17844748 AACTCCTACAAAGAAAGCCAAGG + Intergenic
929167488 2:38897768-38897790 GGGTCATATCAAGAAAGCCAGGG + Intronic
930983226 2:57553266-57553288 GCCTCATTGCAATAAAGACAAGG - Intergenic
931662600 2:64581137-64581159 GCCACACAGAAGGTAAGCCAAGG - Intronic
932171283 2:69558801-69558823 GCCTCTGAGAAATAAAGCCTCGG + Intronic
936268501 2:111029993-111030015 GCCTGATCAAAAGAAAACCAGGG - Intronic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
938868495 2:135449758-135449780 GCCTCAAAAAAAGAAAGAAATGG - Intronic
940053598 2:149490150-149490172 TCCTCATAAAAAAAAATCCAAGG - Intergenic
940576767 2:155517562-155517584 GCGTCATAGTGAGAAAGCAAAGG + Intergenic
943405209 2:187474070-187474092 GCCACAAAGAAAGAAAGCCATGG + Intronic
944162809 2:196683817-196683839 ACCTTACAGAAAGAAAGACAAGG - Intronic
944634470 2:201661381-201661403 GCATCATGGAATGAATGCCAAGG + Intronic
946518732 2:220442638-220442660 GTTTCATAGAAAAAAAGTCAAGG - Intergenic
948222117 2:236278844-236278866 GTCTCAAAGAAAAAAAGCAATGG + Intergenic
948601561 2:239110515-239110537 GCTTCTCAGAAAGAAAACCATGG - Intronic
1169386475 20:5154302-5154324 GGCTCTTAGAATGAAAGCCTCGG - Intronic
1169563620 20:6828737-6828759 GCCCCATAGAAAGATAGTAAAGG + Intergenic
1170803639 20:19611143-19611165 GCCTCACAGAAGGAACCCCATGG + Intronic
1172852737 20:37978264-37978286 GCCTCACAAAAAATAAGCCAGGG - Intergenic
1173223458 20:41147499-41147521 ACTTCAGAGAAAGAAATCCAAGG + Intronic
1174075246 20:47930665-47930687 GCCTCACAGCTAGAAAACCAGGG - Intergenic
1174890366 20:54385272-54385294 GACGCAGAGAAAGAAAGACAGGG + Intergenic
1179994059 21:44965875-44965897 ACCTCATTAAAAGAGAGCCAGGG - Intronic
1181485222 22:23226375-23226397 GCCACATAGTAAGAGAGCAAAGG + Intronic
1183080619 22:35453669-35453691 GCATCAGAGACAGAAAGACAGGG + Intergenic
949781740 3:7697082-7697104 AGTTCATAGAAAGAAAGACATGG - Intronic
949964626 3:9345031-9345053 GTCTCAAAAAAAAAAAGCCAAGG + Intronic
953357486 3:42266892-42266914 GTCTCAAAGAAGGAAAGGCAAGG - Intergenic
955646438 3:61142846-61142868 GACACATAGAAAGAAAGAAAGGG + Intronic
956577150 3:70764557-70764579 GCCTCATTGAAAGAGACCCACGG - Intergenic
956587526 3:70880284-70880306 GCCCCATAGAAAGAAGGCACAGG + Intergenic
959024951 3:101230558-101230580 GGCTCATCGAAGGAAAGGCATGG - Intronic
964877930 3:161390523-161390545 TCCTCATAAAAATAAAGCAAGGG + Intergenic
965144624 3:164885580-164885602 GCGTCATACAAAGATGGCCAGGG - Intergenic
965376222 3:167927557-167927579 GTGTGATAGAGAGAAAGCCAAGG - Intergenic
966242921 3:177774746-177774768 GCCTCAGAGAAAAAAAGGAAAGG - Intergenic
966924512 3:184635684-184635706 GACTGATGGAAAGAAAGACAGGG + Intronic
971143331 4:23948529-23948551 GCCTCCTAGAGAGAAACCAAAGG - Intergenic
976202536 4:82593992-82594014 GCCTCATAAAAACAGAGCAATGG - Intergenic
979145068 4:117236214-117236236 TATTCATAGAAAAAAAGCCAAGG + Intergenic
979175865 4:117662438-117662460 GCATGATAAATAGAAAGCCAAGG - Intergenic
980101578 4:128546713-128546735 GCCTCTGAAAAAGAAATCCAAGG - Intergenic
984349884 4:178576906-178576928 GCCTCATTTATAGAAAGCAAGGG - Intergenic
986397868 5:7348032-7348054 TCCACATAGAAAGAAAAGCAGGG - Intergenic
988527313 5:31998510-31998532 GATTCATTGAAAGAAAGCCAGGG + Intronic
988737035 5:34033048-34033070 CCCTCATAGAACCAAATCCAAGG - Intronic
988885175 5:35548868-35548890 GCCGCATGGCAAGAAAACCATGG - Intergenic
992001766 5:72442987-72443009 GCCTCAGAGCAAGACAGCAATGG + Exonic
992630503 5:78675734-78675756 ACCTCAAAGAAGAAAAGCCATGG - Intronic
992678219 5:79126995-79127017 GCCACAGAGGAAGAAAGGCAAGG + Intronic
995868912 5:116724189-116724211 GCATGAGAGAAAGGAAGCCAGGG - Intergenic
997587456 5:135051902-135051924 GCCACATGGAAACAAAACCAGGG - Intronic
998548866 5:143057128-143057150 GCCTGCTAGAAAGAAAGAAATGG - Intronic
1000469839 5:161627664-161627686 CCCTCATTGCATGAAAGCCAAGG + Intronic
1000634828 5:163631982-163632004 GCCTCAGAGCAAGAAAGCCCTGG - Intergenic
1001308596 5:170594428-170594450 ACTTCATAGTATGAAAGCCAGGG + Intronic
1003355375 6:5364661-5364683 CCTTGATAGCAAGAAAGCCATGG + Intronic
1003412104 6:5874619-5874641 TCCTTACAGAAAGACAGCCACGG - Intergenic
1003840905 6:10118454-10118476 GCCTAAAGGAAAGAAGGCCAAGG + Intronic
1005018564 6:21396313-21396335 GTCACAGAGAAGGAAAGCCAAGG - Intergenic
1007418064 6:41703527-41703549 GACTCTTAAAAACAAAGCCAGGG - Intronic
1007719378 6:43876250-43876272 GCCTCATAGGAAGCAAGCACTGG - Intergenic
1008993238 6:57628137-57628159 GCCACATAAATAGCAAGCCATGG + Intronic
1009406407 6:63318881-63318903 GGCTTATAGAAAGAAAGTAAAGG - Intronic
1011207960 6:84921770-84921792 CCTTAAAAGAAAGAAAGCCAAGG - Intergenic
1011484226 6:87825704-87825726 GCCTGATGGAGAGAGAGCCATGG + Intergenic
1012942430 6:105429348-105429370 GCCTCATAGAAATACAGGTAAGG + Intergenic
1013416897 6:109933666-109933688 GCTTCACAGAAAGAAAGAAATGG - Intergenic
1013623533 6:111914899-111914921 GTCTCAAAGAAAGAAAGAGAGGG - Intergenic
1019029240 6:168995875-168995897 GCCTCACAGAAAGCAAGCTGAGG + Intergenic
1020093154 7:5352644-5352666 GGCTCGTAGAAAGAAGGGCAAGG - Intronic
1020410402 7:7885885-7885907 GCCTCAAAGAGAGATAGCCTGGG - Intronic
1023048420 7:36230963-36230985 TCCTCAGAGAAAGGGAGCCAGGG + Intronic
1023282122 7:38581528-38581550 GTCACTCAGAAAGAAAGCCAAGG - Intronic
1023575694 7:41623865-41623887 GCCTAATAGAAATAAATACATGG - Intergenic
1026788066 7:73314109-73314131 GCCGCAAGGAAAGAAGGCCAAGG + Intronic
1029859435 7:103553890-103553912 TGCTCATTGAAAGAAAGCAAAGG + Intronic
1030139300 7:106288301-106288323 GCCTCATCCACAGAAAGACACGG + Intergenic
1033069127 7:138185976-138185998 GCTTCACAGAAGGAAGGCCAAGG - Intergenic
1034063453 7:148114196-148114218 GAGTTATAGAAATAAAGCCATGG + Intronic
1034126043 7:148672361-148672383 CCCTCAGAGAGAGAAATCCAAGG + Intergenic
1036008905 8:4698367-4698389 GCATCAGAGAAAGAAGGCAAAGG + Intronic
1037208754 8:16359076-16359098 GCCTCAGGCAAAGAAAGCCCAGG - Intronic
1037724918 8:21475060-21475082 GCCTAACAGAAAGAAAGGAAAGG - Intergenic
1038942212 8:32317421-32317443 GCATCATTGAAACAAAGCCGAGG + Intronic
1039339693 8:36634042-36634064 GCCTCTTACAAAGAAAGCTATGG - Intergenic
1039872729 8:41560329-41560351 GACTAATAGGAAGAAAGCAATGG + Intergenic
1041858771 8:62487021-62487043 GCCCCATTGAAAGAAAGAGAAGG - Intronic
1042786409 8:72551503-72551525 GCCTTCTAGCAAGAAAGCCCAGG - Intronic
1043475899 8:80606023-80606045 GCCTGAGGGAGAGAAAGCCAAGG - Intergenic
1044589519 8:93900046-93900068 GCCTCAGAGGAAGAAAGCCCTGG - Intronic
1045150004 8:99395062-99395084 TCCTCATAGAAAGGAAACAAAGG + Intronic
1048453439 8:134554661-134554683 GCCTAATAAACAGAAAGCCCGGG + Intronic
1048665698 8:136658289-136658311 GCCTCAGGGAAAGACAGCTAGGG - Intergenic
1048999331 8:139814701-139814723 GCCTCAAAAAAAGAAAGGAAAGG + Intronic
1051090480 9:13401828-13401850 GCCTCTTACAAAGATAGCCAGGG - Intergenic
1051192718 9:14532176-14532198 ACCTCACAGATAGAAAGACAAGG + Intergenic
1055797477 9:79990706-79990728 GCCTCATAAGAAGAAGGCAATGG + Intergenic
1056595954 9:88007645-88007667 GCCACATAGCAAGAATGCCAGGG + Intergenic
1057734443 9:97641761-97641783 TCCCCATAGAAGTAAAGCCAAGG - Intronic
1058039688 9:100290349-100290371 GTCTCAAAGAAAGAAAGAAAGGG - Intronic
1188884175 X:35529792-35529814 TTCTCATAGAAAGAAAACCCTGG - Intergenic
1189253235 X:39617480-39617502 GCCTCATAGAGAGAATGCATTGG + Intergenic
1189560269 X:42185133-42185155 GCATCATAGAAGGAAAGAGAGGG + Intergenic
1190138375 X:47817679-47817701 GCCTCAAAGTAAGGAAGCCCTGG - Intergenic
1193600548 X:83504682-83504704 CCCTCTTAGAAACAAAGCAAGGG + Intergenic
1194610379 X:96035872-96035894 GCCTCAAAGAAAGGCAACCATGG + Intergenic
1197531342 X:127630981-127631003 TCCTAATAGCAAGAAAGCCAGGG + Intergenic
1198730887 X:139727043-139727065 GCCAGAAAGAAAGAAAGACAAGG - Exonic
1199353803 X:146836521-146836543 ACCTTACAGAAAGATAGCCAAGG + Intergenic