ID: 1122262644

View in Genome Browser
Species Human (GRCh38)
Location 14:100531926-100531948
Sequence GTGGGGCATCGGTGGGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1122262644_1122262658 13 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262658 14:100531962-100531984 GTGGAGCACATGCCCCAGGCTGG No data
1122262644_1122262651 -9 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262651 14:100531940-100531962 ATGCCCCACACCTGCATTTGTGG No data
1122262644_1122262660 15 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262660 14:100531964-100531986 GGAGCACATGCCCCAGGCTGGGG No data
1122262644_1122262657 9 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262657 14:100531958-100531980 TGTGGTGGAGCACATGCCCCAGG No data
1122262644_1122262659 14 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262659 14:100531963-100531985 TGGAGCACATGCCCCAGGCTGGG No data
1122262644_1122262653 -6 Left 1122262644 14:100531926-100531948 CCCCGGCCCCACCGATGCCCCAC No data
Right 1122262653 14:100531943-100531965 CCCCACACCTGCATTTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1122262644 Original CRISPR GTGGGGCATCGGTGGGGCCG GGG (reversed) Intergenic
No off target data available for this crispr